CN104651378A - Hog cholera vaccine infectious cDNA (Complementary Deoxyribonucleic Acid) as well as construction method and application thereof - Google Patents

Abstract

The invention belongs to the technical field of animal biological products, and in particular relates to construction of plasmid pASPITI-CS. The plasmid comprises hog cholera vaccine C strain infectious cDNA clone, fusion of a hog RNA (Ribonucleic Acid) polymerase I promoter sequence at the 5' tail end of the genome cDNA, and insertion of plasmid pASPITI-CS of a mouse RNA polymerase I termination sub-sequence at the 3' tail end. The plasmid is transfected to hog origin cells PK15, so that hog cholera vaccine C strain virus can be directly generated. Escherichia coli DH10B/pASPITI-CS transformed with the plasmid pASPITI-CS is preserved in the China centre for type culture collection; and the preservation number is CCTCC NO.M2015062. The hog cholera vaccine C strain infectious cDNA clone can be used for genetically modifying to prepare high-titre hog cholera vaccines or constructing bivalent vaccines based on a hog cholera vaccine vector.

Description

A kind of swine Fever Vaccine infectious CDNA and construction process thereof and application

Technical field

The invention belongs to veterinary biologics technical field, relate to and utilize reverse genetic manipulation to obtain a kind of swine fever attenuated vaccine C strain infectious CDNA clones, relate to this infectious CDNA clones simultaneously and building the application in high-titer Recombinant Swine fever live vaccine and swine Fever Vaccine carrier.

Background technology

Swine fever is the extremely strong virus disease of a kind of infectivity of pig, is called hog cholera (Hog Cholera, HC) in early days, and can infect various age pig, popular throughout the year, M & M is all very high, endangers huge.The pathogenic agent of swine fever is Pestivirus suis (Classical swine fever virus, CSFV), in " International Animal Health code " that International Office of Epizootics (OIE) formulates, swine fever is put into one of transmissible disease of category-A 16 kinds of statutory reports.China in recent years swine fever takes place frequently, and causes serious financial consequences to pig industry, hampers development and the export trade of pig industry.Strengthening the effective prevention and control to swine fever, is promote that pig industry develops in a healthy way, improves culture benefit and allow its people be able to eat the inevitable requirement of quality-assured meat; Develop efficient swine fever control techniques and vaccine product, promote the key subjects that swine fever prevention and control level is scientific and technical research.

CSFV genome is the single-stranded positive RNA being about 12.3kb, be made up of 5' end non-coding region (5'Untranstaled region, 5'UTR), a large open reading frame (ORF) and 3' end non-coding region (3'UTR).ORF encodes a polyprotein be made up of 3898 amino-acid residues, and polyprotein, in translation process or after translation, is processed into 12 kinds of mature proteins by virus self proteolytic enzyme of coding and the proteolytic enzyme of host cell, comprises 4 kinds of structural protein C, E ^rns, E1, E2 and 8 kinds of Nonstructural Protein N ^pro, P7, NS2, NS3, NS4A, S4B, NS5A and NS5B.Wherein, E ^rns, E1 and E2 embed in bilayer lipid membrane, form cynapse at virion surface, the absorption of mediate retroviral and invasion are CSFV virulence correlation factor and protective antigen albumen.E2 is often present in the surface of virus particle and host cell with homodimer or ElE2 heterodimer; CSFV infected pigs physical efficiency induction body produces E ^rnswith E2 antibody, again infecting swine fever to pig body has provide protection.

Swine Fever Vaccine inoculation is the most effectual way of prevention and corntrol swine fever.As far back as nineteen fifty-one, China researchist filters out the excellent CSFV crossdrift strain (Yin Zhen, 1997) of immunogenicity, and this strain is used till today as Chinese CSFV standard virulent strain.Used CSFV crossdrift strain at that time, swine fever Viola crystallina glycerine inactivated vaccine is made in deactivation, uses the rear swine fever epidemic situation controlling rapidly China.Between 1954-1956, CSFV virulent strain (comprising the strong malicious Strain Shimen of standard) is adapted to rabbit by the researchist of the units such as China Veterinary Drugs Supervisory Inst., continuous passage in rabbit body, select a strain to the basic avirulence of pig, and keep the immunogenic lapinized virus strain of CSFV, i.e. Chinese swine fever rabbitization attenuated vaccine strain (hog cholera lapinized vaccine, HCLV), is called for short swine Fever Vaccine C strain.The successful development and application of hog cholera lapinised virus vaccine, plays decisive role to the prevention and corntrol of China's swine fever.But hog cholera lapinised virus vaccine widely using over 60 years, does not control the generation of swine fever.Although the dosage of inoculation of vaccine and immune time increase, not only do not eradicate swine fever, in recent years, China's swine fever there is many new features, show as from being very popular of taking place frequently change into irregular distribute popular; Clinical symptom becomes non-typical swine fever from typical case, and virus virulence reduces, and the course of disease is changed into by acute, subacute based on chronic, occurs the congenital infection etc. of persistent infection, placental infection, sow breeding difficulty and newborn piglet.Swine Fever Vaccine strain viral titer in cell is not high, prepare high-titer vaccine difficulty is one of major reason causing the low and swine fever prevention and control difficulty of vaccine Vaccine effectiveness.The generation of swine fever, propagation and popular be seriously restrict the bottleneck that China's pig industry develops in a healthy way, increases farmers' income and develop international trade.

For meeting China's prevention, controlling and the final needs eradicating swine fever, new generation high-titer swine Fever Vaccine goods, improve swine Fever Vaccine immune protection effectiveness, imperative.In addition, improving swine Fever Vaccine Growth of Cells titre is also the basic assurance reducing production of vaccine enterprise production cost, improve vaccine quality and benefit.

On the other hand, CSFV infects the immunosuppression causing pig body, and PCV-II more easily occurs the pig body infecting CSFV, pig breeds and the polyinfection of breathing syndrome virus, encephalitis b virus etc., causes pig mortality ratio higher, endangers huger.Build bivalent vaccine based on other cause of disease protective antigen albumen of live vaccines of hog cholera vector expression, energy is prevention and control swine fever and relevant swine disease simultaneously, has important using value.

Summary of the invention

Primary and foremost purpose of the present invention is to provide a kind of full-length infectious CDNA of swine Fever Vaccine, this full-length infectious CDNA contains swine Fever Vaccine kind poison full-length cDNA, in this cDNA 5 ' terminal fusion pig rna plymerase i promotor, inserts mouse rna plymerase i terminator at cDNA 3 ';

Further, the invention provides the full-length infectious CDNA of swine Fever Vaccine C strain, this full-length infectious CDNA contains swine Fever Vaccine C strain full-length cDNA, this cDNA 5 ' terminal fusion pig rna plymerase i promotor (GenBank No.L31782.1), its sequence is SEQ ID NO:1; Insert mouse rna plymerase i terminator at cDNA 3 ', its sequence is SEQ ID NO:2;

For achieving the above object, the invention provides a kind of method building the full-length infectious CDNA clones of above-mentioned swine Fever Vaccine C strain, comprising:

1) with swine Fever Vaccine C strain RNA for template, apply the 6 pairs of specific PCR amplimers (SEQ ID NO:3-14) according to swine Fever Vaccine C strain full-length gene group sequence (Genbank No.AF091507) design and synthesis, adopt RT-PCR, obtain swine Fever Vaccine C strain full-length gene group 6 cDNA fragments (CSf1-6);

2) strategy adopting digestion with restriction enzyme, T4 ligase enzyme to connect increased PCR fragment, is cloned in plasmid vector;

3) structure of swine Fever Vaccine C strain infectious CDNA clones plasmid:

(1) 5 ' end half long genome large fragment is built: be connected to low copy plasmid pACNR1180 (being given by N.Ruggli and J.D.Tratschin doctor) successively by fragment CSf1, CSf2 and CSf3, build pA-CSf123;

(2) 3 ' end half long genome large fragment is built: be connected to low copy plasmid pACNR1180 successively by fragment CSf4, CSf5 and CSf6, build pA-CSf456;

(3) the recombinant plasmid pSPI-CSf123 of the swine Fever Vaccine 5 ' end merging pig rna plymerase i promotor is built;

A). prepared by pig rna plymerase i promotor (pSPolI) fragment: design promoter fragment pcr amplification primer (SEQ ID NO:15-16) according to pig rna plymerase i promoter sequence (GenBank No.L31782.1), with the DNA of pig source PK-15 cell for template, amplification pig rna plymerase i promotor, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

B). swine Fever Vaccine C strain 5 ' end 784bp fragment amplification: build swine Fever Vaccine cDNA sequence, design one couple of PCR primers (SEQ ID NO:17-18), amplification gene group 5 ' end 784bp fragment, with pA-CSf123 recombinant plasmid for template, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

C) .pACNR1180 vector backbone segment amplification: according to pACNR1180 carrier sequence (SEQ ID NO:19) design of amplification primers (SEQ ID NO:20-21), with pA-CSf123 recombinant plasmid for template, obtain pACNR1180 carrier segments PCR primer, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

D). merge the pACNR1180 vector backbone segment amplification of swine Fever Vaccine C strain 5 ' end and pig rna plymerase i promotor: with the swine Fever Vaccine C strain 5 ' end 784bp fragment of above-mentioned preparation, pig rna plymerase i promotor and pACNR1180 carrier segments mixture are template, with SEQ ID NO:20 for upstream primer, SEQ ID NO:18 is downstream primer, pcr amplification obtains the pACNR1180 vector backbone segment PCR primer A-SPI-CS-5 ' merging swine Fever Vaccine 5 ' end and pig rna plymerase i promotor, DNA is adopted to reclaim kits PCR primer, order-checking confirmation,-70 DEG C save backup,

E). the swine Fever Vaccine 5 ' end recombinant plasmid pSPI-CSf123 merging pig RNA polymerase I promotor builds: use restriction enzyme PmlI and MluI double digested plasmid pA-CSf123 and A-SPI-CS-5 ' DNA fragmentation respectively, DNA reclaims kits and prepares △ CSf123 and A-SPI-CS-5 ' fragment, two kinds of fragments press 1:2 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, order-checking confirmation obtains pSPI-CSf123;

(4) fusion mouse RNA polymerase I terminator (T is built _i) swine Fever Vaccine 3 ' end recombinant plasmid pA-CSf456-T _i:

According to mouse rna plymerase i terminator sequence (SEQ ID NO:2) and swine Fever Vaccine C strain 3 ' end sequence, design and synthesis merges the long aligning primer (SEQ ID NO:9,22) of mouse terminator sequence, with recombinant plasmid pA-CSf456 for template, obtained the swine Fever Vaccine 3 ' end PCR primer CSf456-T merging mouse RNA polymerase I terminator by PCR _ifragment;

Use double digested plasmid pA-CSf456 and CSf456-T of restriction enzyme SphI and MluI respectively _ifragment, DNA reclaims linearizing pA-CSf456 and CSf456-T that kits prepares double digestion sticky end _ifragment, two kinds of fragments press the mixing of 1:3-1:10 molar ratio, and T4DNA ligase enzyme connects, conversion, selects positive colony, and order-checking confirmation obtains pA-CSf456-T _i;

(5) based on pig rna plymerase i promotor (pSPolI) and mouse rna plymerase i terminator (T _i) swine Fever Vaccine infectious CDNA clones pASPIT _i-CS builds:

By swine Fever Vaccine 5 ' end large fragment plasmid pSPI-CSf123 and the 3 ' end large fragment plasmid pA-CSf456-T of above-mentioned structure _iuse BamHI and MluI double digested respectively, reclaim linearizing pSPI-CSf123 and CSf456-T _ifragment, both press the mixing of 4:1 molar ratio, and T4DNA ligase enzyme connects, conversion, selects positive colony, and order-checking confirmation, obtains swine Fever Vaccine infectious CDNA clones plasmid pASPIT _i-CS, transform competent E. coli E.coli DH10B, coating, containing the agar plate culture of amicillin resistance, selects positive recombinant intestinal bacteria DH10B/pASPIT _i-CS (E.coli DH10B/pASPIT _i-CS), deliver China on January 23rd, 2015. Wuhan. Wuhan University's China typical culture collection center preservation, preserving number is CCTCC NO:M2015062.

Another object of the present invention is used for by the full-length infectious CDNA of constructed swine Fever Vaccine C strain saving live vaccines of hog cholera kind poison.That is: liposome Lipofectamine2000 is adopted, by swine Fever Vaccine infectious CDNA plasmid pASPIT _i-CS transfection is to pig source PK15 or SK6 cell, and produce viral RNA in the record of PK15/SK6 transit cell, then carry out virus protein translation, processing, virus particle is assembled, and obtains genetically engineered live vaccines of hog cholera kind poison;

Another object of the present invention is by the full-length infectious CDNA clones plasmid pASPIT of constructed swine Fever Vaccine C strain _i-CS as carrier, for expressing foreign protein;

Further, the method that the present invention also provides construction expression foreign protein to recombinate swine Fever Vaccine infectious CDNA clones, it comprises the steps: 1) and build swine Fever Vaccine C strain full-length infectious CDNA clones, obtain recombinant plasmid pASPIT _i-CS; 2) pcr amplification obtains external source antigen-4 fusion protein gene, and its 5 ' end merges Pestivirus suis C protein 7 amino acid coding, and its 3 ' end merges foot and mouth disease virus 2A albumen coded sequence; 3) adopt multi-step over-lap PCR amplification foreign protein genes to merge fragment, the foreign gene of acquisition is inserted into swine Fever Vaccine genome N ^proand between C protein coding region, the restructuring swine Fever Vaccine obtaining expressing foreign protein is fitted together to infectious CDNA clones;

Described foreign protein is luciferase, and luciferase (Luc) gene and foot and mouth disease virus 2A protein gene are fused to Luc2A, so that Luc is correctly processed from swine Fever Vaccine polyprotein, release.

Another object of the present invention is to provide the application of this vaccine in prevention swine fever.

Plasmid pASPIT _i-CS can be widely used in swine Fever Vaccine and modify transformation, expresses exogenous antigen albumen, to prepare high-titer live vaccines of hog cholera or recombinate bivalent and multivalence swine fever carrier live.

A kind of New Kind of Vaccine for Classical Swine Fever infectious CDNA clones of the present invention tool has the following advantages: when classical swine fever vaccine infection cDNA clones and produces virus, need through cDNA being cloned linearizing, adopting T7DNA polysaccharase in-vitro transcription viral genome vRNA, vRNA liposome transfection is obtained virus to the rescue of pig source cell, complex steps, usual inefficiency; Infectious CDNA clones of the present invention includes pig rna plymerase i promotor and the mouse rna plymerase i terminator of directly synthesis virus genome RNA in pig source cell.By being transfected into by infectious CDNA clones in pig source cell, can directly produce swine Fever Vaccine virus, and efficiency improves tens of to hundreds of times; Therefore, there is the features such as simple, quick and efficient, be applicable to build, screen high-titer live vaccines of hog cholera kind poison; Foreign gene is inserted into the N of swine Fever Vaccine genome encoding by the present invention ^proand express between C protein, there is foreign gene 3 ' terminal fusion foot and mouth disease virus the 2A protein gene of Self cleavage function, foreign protein correct cutting and effectively release from the polyprotein of swine Fever Vaccine encoding viral can be made, can be used for the expression of other swine disease pathogen antigen, be suitable for building the bivalent based on live vaccines of hog cholera carrier or polyvalent vaccine.

Accompanying drawing explanation

Fig. 1 is that a kind of restructuring swine Fever Vaccine infectious CDNA clones builds schematic diagram;

Fig. 2 is each cDNA cloned sequence electrophoretic analysis figure in infectious CDNA clones building process;

Fig. 3 is the swine Fever Vaccine cDNA cloning recombinant plasmids (A) and principle of work schematic diagram (B) that form based on pig rna plymerase i promotor and mouse rna plymerase i terminator;

Fig. 4 produces swine Fever Vaccine Viral diagnosis figure based on novel infectious CDNA clones transfectional cell:

A. Pestivirus suis NS3 protein antibodies immunofluorescence dyeing detects swine Fever Vaccine virus in PK15 cell;

B. Auele Specific Primer RT-PCR detects swine Fever Vaccine viral nucleic acid in PK15 cell;

Fig. 5 produces based on novel infectious CDNA clones the detection figure expressing foreign protein luciferase Recombinant Swine pest vaccine virus:

A. Pestivirus suis NS3 protein antibodies immunofluorescence dyeing detects PK15 cell Recombinant Swine pest vaccine virus;

B. uciferase activity in Recombinant Swine pest vaccine virus PK15 cell pyrolysis liquid is infected.

Fig. 6 is Temperature changing after restructuring vaccinated pig and the strong malicious lethal challenge of control experiment pig CSFV;

Embodiment

The features and advantages of the invention can be understood further by reference to the accompanying drawings by following detailed description.The embodiment provided is only the explanation to the inventive method, and does not limit the present invention in any way all the other contents of announcement.

The experimental technique of unreceipted actual conditions in the following example, usually conveniently condition, the condition as described in " molecular cloning: lab guide " (New York:Cold Spring Harborlaboratory Press, 2001) is carried out.

[embodiment 1] a kind of novel infectious CDNA clones construction process preparing swine Fever Vaccine kind poison

1. the design and synthesis of primer

According to swine Fever Vaccine C strain full-length gene group sequence (Genbank No.AF091507), design and synthesis 6 pairs of specific PCR amplimers, for the external synthesis of swine Fever Vaccine C strain full-length gene group 6 cDNA fragments.Each primer is synthesized by Shanghai Sheng Gong company.Swine Fever Vaccine C pnca gene group cDNA adopts the external reverse transcription synthesis of 9 Nucleotide random primer pd (N) 9, and pd (N) 9 is Biocolor Products (Britain).

As follows to 3 ' end each cDNA fragment length, 6 pairs of specific primer sequences and numbering from genome 5 ' successively:

1). fragment 1 (CSf1:1-2431nt) pcr amplification primer

Upstream primer P1F (SEQ ID NO.3):

5′-GC GTCGACTCTTAATACGACTCACTATAGTATACGAGGTTAGTTCATTC-3′

Downstream primer P1R (SEQ ID NO.4):

5′-CCAGTT ACTAGTAACAGCCATACCACACCTTGC-3′

(amplified production is 2459bp, and at its 5 ' end containing SalI site, 3 ' end is containing SpeI site)

2). fragment 2 (CSf2:2414-4457nt) pcr amplification primer

Upstream primer P2F (SEQ ID NO.5)

5′-GCTGTT ACTAGTAACTGGGGCACAAGGCCGG-3′

Downstream primer P2R (SEQ ID NO.6):

5′-CAT GGTACCTGTCATTGAACTTGTC-3′

(amplified production is 2043bp, and at its 5 ' end containing SpeI site, 3 ' end is containing KpnI site)

3). fragment 3 (CSf3:4441-6458nt) pcr amplification primer

Upstream primer P3F (SEQ ID NO.7)

5′-CAATGACA GGTACCATGTTGCCATTG-3′

Downstream primer P3R (SEQ ID NO.8):

5′-CACCCTCAGGTTAGAT GGATCC-3′

(amplified production is 2217bp, and at its 5 ' end containing KpnI site, 3 ' end is containing BamHI site)

4). fragment 4 (CSf4:6434-8681nt) pcr amplification primer

Upstream primer P4F (SEQ ID NO.9)

5′-AGA GGATCCATCTAACCTGAGGG-3′

Downstream primer P4R (SEQ ID NO.10):

5′-ATTT CTGCAGAGAAATGAACCTTCC-3′

(amplified production is 2247bp, and at its 5 ' end containing BamHI site, 3 ' end is containing PstI site)

5). fragment 5 (CSf5:8652-11169nt) pcr amplification primer

Upstream primer P5F (SEQ ID NO.11)

5′-GAGGAGGAAGGTTCATTTCT CTGCAG-3′

Downstream primer P 5R (SEQ ID NO.12):

5′-CATTTA GCATGCTGTTGCCCG-3′

(amplified production is 2517bp, and at its 5 ' end containing PstI site, 3 ' end is containing SphI site)

6). fragment 6 (CSf6:11149-12310nt) pcr amplification primer

Upstream primer P6F (SEQ ID NO.13)

5′-CGGGCAACA GCATGCTAAATG-3′

Downstream primer P6R (SEQ ID NO.14):

5′-T ACGCGTGAGCCCGGGCCGTTAG-3′

(amplified production is 1174bp, and at its 5 ' end containing SphI site, 3 ' end is containing MluI site)

2. swine Fever Vaccine geneome RNA extracts and cDNA synthesis

Swine Fever Vaccine geneome RNA total RNA extraction reagent box (two step method total serum IgE extraction agent box, Invitrogen), the step introduced by test kit process specifications extracts total serum IgE (comprising swine Fever Vaccine geneome RNA).Concrete:

Swine Fever Vaccine C strain virus infects PK15 cell, after infecting 72h, discards substratum, in cell, adds 1ml reagent, after mixing for several times, room temperature leaves standstill 5min; Add the trichloromethane of 1/5 volume, tighten lid and manually acutely mix 15s, room temperature places 2-3min; 12000g, in 4 DEG C of centrifugal 15min, draws upper strata aqueous phase and manages to another EP, add equal-volume Virahol, and fully after mixing, room temperature leaves standstill 10min; 12000g is in 4 DEG C of centrifugal 10min; Remove supernatant, add 1ml 75% ethanol (ice precooling) and wash RNA precipitation; Rotating speed 7500g is in 4 DEG C of centrifugal 5min; Blot supernatant, dry air RNA precipitates.

The RNA of extraction is dissolved in 15.5 μ l without in RNase distilled water (Ambion company), add 2 μ l reverse transcription pd (N9) random primers (100ng/ μ l), 70 DEG C, 5min, put rapidly ice bath 5min, add reverse transcription mixed solution: 5 × reverse transcriptase buffer (RT Buffer) 5 μ l, dNTPs (10 μMs) 1 μ l, RNasin0.5 μ l (40U/ μ l), M-MLV 1 μ l (200U/ μ l).PCR thermal cycler carries out following reaction: 37 DEG C of 60min, 95 DEG C of sex change 10min, put ice bath, and obtain swine Fever Vaccine strand cDNA ,-70 DEG C frozen for subsequent use.3.PCR amplification swine Fever Vaccine cDNA fragment

With the swine Fever Vaccine cDNA of above-mentioned preparation for template, to increase respectively corresponding gene fragment with above-mentioned 6 pairs of Auele Specific Primers a pair PCR wherein, amplification reaction system and concrete reaction conditions as follows:

With pipettor, said components is mixed, PCR thermal cycler carries out following reaction: 94 DEG C of sex change 60Sec, then 94 DEG C of 30Sec, 55 DEG C of 30Sec, 72 DEG C of 90Sec carry out 35 circulations, obtain the PCR primer of fragment 1 (CSf1).Under same reaction system and amplification condition, add P2F/R to P6F/R primer pair respectively, obtain the PCR primer of fragment 2 to fragment 6 (CSf2-CSf6) successively.

PCR reagent used comprises mononucleotide mixture dNTPs, 5 × PCR damping fluid and pfu archaeal dna polymerase, work of all making a living biotechnology company limited product, lower same.

After pcr amplification, agarose gel electrophoresis detects PCR primer.As shown in Figure 2, swimming lane 1 is standard molecular weight, and swimming lane 2-7 is followed successively by amplified production CSf1, CSf2, CSf3, CSf4, CSf5 and CSf6.

4. reclaim product

The various PCR primer obtained that step 3 increased utilize sepharose DNA recovery test kit (D2500-02, Omega Products) to reclaim purified pcr product;

5.PCR product cloning is to pMD18-T carrier

1) .PCR amplified production end adds " A " reaction

reaction system and condition as follows:

2) .PCR amplified production is connected to pMD18-T carrier: adopt pMD18-T test kit (Takara Products), operate by test kit specification sheets.Get pMD18-T vector plasmid DNA 0.5 μ l, the pcr amplification product 2.5 μ l that end adds " A ", add ligation mixture Solution I 3 μ l, add without RNase bi-distilled water to cumulative volume 10 μ l, mixing, 4 DEG C of connections are spent the night or 16 DEG C of connection 60min.

3). fragment transforms and positive clone identification with plasmid vector connector: join in 100 μ l DH5 α competent cells by being connected product, ice bath 30min; 42 DEG C of accurate response 90Sec; Ice bath 1 ~ 2min; Add 800 μ l LB substratum, 37 DEG C of shaking culture 45min; Containing overnight incubation on the Agar Plating of X-Gal, IPTG, Amp.Select white colony from flat board, with the Auele Specific Primer pcr amplification of respective segments, agarose cohesion electrophoresis, observing amplified production is the positive colony being connected with object fragment.Increase positive bacteria in LB liquid nutrient medium, extracts plasmid (plasmid extraction kit D6943-02, Omega Products) by the operation of test kit specification sheets, builds after sequencing analysis confirmation for follow-up cDNA clone.

6. the structure of swine Fever Vaccine C strain infectious CDNA clones plasmid

1). build 5 ' end half long genome large fragment: be connected to low copy plasmid pACNR1180 successively by fragment CSf1, CSf2 and CSf3 and build pA-CSf123.

Use restriction enzyme SalI and SpeI double digested plasmid pMD18T-CSf1 and plasmid pMD18T-CSf2 respectively, DNA reclaims test kit (by the operation of test kit specification sheets) purification CSf1 fragment and linearizing pMD18T-CSf2, two kinds of fragments press 4:1 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, enzyme is cut qualification and is obtained pMD18T-CSf12.

Use double digested pMD18T-CSf12 and the pACNR1180 plasmid vector of restriction enzyme SpeI and KpnI respectively, DNA reclaims test kit (by the operation of test kit specification sheets) purification CSf12 fragment and linearizing pACNR1180 plasmid, both press 4:1 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, enzyme cuts qualification, obtains recombinant plasmid pA-CSf12.

Use double digested plasmid pMD8T-CSf3 and pA-CSf12 of restriction enzyme KpnI and BamHI respectively, DNA reclaims test kit (by the operation of test kit specification sheets) purification CSf3 fragment and linearizing pA-CSf12, both press 4:1 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, order-checking confirmation obtains recombinant plasmid pA-CSf123, i.e. 5 ' end half long genome large fragment.

2). build 3 ' end half long genome large fragment: i.e. the connection successively of fragment CSf4, CSf5 and CSf6.

Use double digested plasmid pMD18T-CSf4 and pFastBacHTA of restriction enzyme BamHI and PstI (Invitrogen Products) respectively, reclaim linearized vector pFastBacHTA and CSf4 fragment respectively, mix by 4:1 molar ratio, T4DNA ligase enzyme connects, conversion, select positive colony, enzyme is cut qualification and is obtained plasmid pFastBacHTA-CSf4.

With the double digested plasmid pMD18T-CSf5 of restriction enzyme PstI and SphI and pFastBacHTA-CSf4 plasmid, reclaim purifying CSf5 fragment and linearizing pFastBacHTA-CSf4 plasmid, both press 4:1 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, enzyme is cut qualification and is obtained recombinant plasmid pFastBacHTA-CSf45.

Use double digested pMD18T-CSf6 and pACNR1180 of restriction enzyme SphI and MluI respectively, reclaim CSf6 fragment and linearization plasmid pACNR1180, both press 4:1 mixing, and T4DNA ligase enzyme connects, conversion, select positive colony, enzyme is cut qualification and is obtained recombinant plasmid pA-CSf6.

Use double digested plasmid pFastBacHTA-CSf45 and pACNR1180-CSf6 of restriction enzyme BamHI and SphI respectively, reclaim CSf45 fragment and linearization plasmid pACNR1180-CSf6, both press 4:1 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, order-checking confirmation obtains recombinant plasmid pA-CSf456, i.e. 3 ' end half long genome large fragment (Fig. 1).

3). build the recombinant plasmid pSPI-CSf123 of the swine Fever Vaccine 5 ' end merging pig rna plymerase i promotor

A). prepared by pig rna plymerase i promotor (pSPolI) fragment: design promoter fragment pcr amplification primer according to pig rna plymerase i promoter sequence (GenBank No.L31782.1):

Upstream primer SPI-F (SEQ ID NO.15):

5′-CCGGATCCGGAGTGTTTCCCTGTCG-3′

Downstream primer SPI-R (SEQ ID NO.16):

5′-AGGGTACCTCTAGACTCGAGCGTCTCCATCTACCTGGTGACAGAAAAGGCG-3′

Fragment PCR increases: with pig source PK-15 cell for material, uses QIAamp DNAmini kit test kit to extract genomic dna.Operation steps presses the operation of test kit specification sheets.Take genomic dna as template, employing SPI-F/SPI-R is primer, by following reaction system and condition amplification

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 30Sec carry out 33 circulations, obtain pSPolI fragment PCR products.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

B). swine Fever Vaccine C strain 5 ' end 784bp fragment amplification:

Build swine Fever Vaccine cDNA sequence, design one couple of PCR primers amplification gene group 5 ' end 784bp fragment;

Upstream primer CS-F (SEQ ID NO.17):

5′-CAGGTAGATGTATACGAGGTTAGTTCATTCTCG-3′

Downstream primer CS-R (SEQ ID NO.18):

5′-CCATCGATGCACACATAAG-3′；

Fragment PCR increases: with pA-CSf123 recombinant plasmid for template, employing CS-F/CS-R is primer, by following reaction system and condition amplification:

Said components is mixed, PCR thermal cycler carries out following reaction: 94 DEG C of sex change 60Sec, then 94 DEG C of 30Sec, 55 DEG C of 30Sec, 72 DEG C of 90Sec carry out 30 circulations, obtain genome 5 ' end 784bp fragment PCR products.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

C) .pACNR1180 vector backbone segment amplification:

According to pACNR1180 carrier sequence (SEQ ID NO X3) design of amplification primers

Upstream primer ACNRF (SEQ ID NO.20): 5 '-TGGACTAAGGTAATTTCTAACGGC-3 '

Downstream primer ACNRR (SEQ ID NO.21): 5 '-ACTCCGGAGTCGACGTCAGGTGGC-3 '

Fragment PCR increases: with pA-CSf123 recombinant plasmid for template, employing ACNRF/ACNRR is primer, by following reaction system and condition amplification:

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 90Sec carry out 33 circulations, obtain pACNR1180 carrier segments PCR primer.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

D). merge the pACNR1180 vector backbone segment amplification of swine Fever Vaccine 5 ' end and pig rna plymerase i promotor:

With the swine Fever Vaccine 5 ' end 784bp fragment of above-mentioned preparation, pig rna plymerase i promotor and pACNR1180 carrier segments mixture for template, take ACNRF as upstream primer, CS-R is downstream primer, pcr amplification obtains the pACNR1180 vector backbone segment merging swine Fever Vaccine 5 ' end and pig rna plymerase i promotor.

by following reaction system and condition amplification

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, 98 DEG C of 10Sec again, 55 DEG C of 30Sec, 72 DEG C of 120Sec carry out 33 circulations, obtain the pACNR1180 vector backbone segment PCR primer pASPI-CS-5 ' merging swine Fever Vaccine 5 ' end and pig rna plymerase i promotor.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

E). the swine Fever Vaccine 5 ' end recombinant plasmid pASPI-CSf123 merging pig RNA polymerase I promotor builds:

Use restriction enzyme PmlI and MluI double digested plasmid pA-CSf123 and pASPI-CS-5 ' DNA fragmentation respectively, DNA reclaims kits and prepares △ CSf123 and pASPI-CS-5 ' fragment, two kinds of fragments press 1:2 mixing, T4DNA ligase enzyme connects, conversion, select positive colony, order-checking confirmation obtains pASPI-CSf123.

4). build the swine Fever Vaccine 3 ' end recombinant plasmid pA-CSf456-T merging mouse RNA polymerase I terminator _i

According to mouse rna plymerase i terminator sequence (SEQ ID NO.2) and swine Fever Vaccine C strain 3 ' end sequence, design and synthesis merges the long aligning primer of mouse terminator sequence, by PCR, mouse terminator is fused to swine Fever Vaccine cDNA sequence 3 ' end:

Upstream primer: upstream primer P4F (SEQ ID NO.9)

5′-AGAGGATCCATCTAACCTGAGGG-3′

Downstream primer CS-RT _i(SEQ ID NO.22):

5′-CGACGCGT CGGAGTACTGGTCGACCTCCGAAGTTGGGGGGGAGGGCCGTTAGAAATTAC-3′

(underscore part is mouse terminator sequence)

With recombinant plasmid pA-CSf456 for template, upstream and downstream primer is respectively P4F and CS-RT _i, pcr amplification is carried out by following reaction system and condition:

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 60Sec carry out 33 circulations, obtain the swine Fever Vaccine 3 ' end PCR primer CSf456-T merging mouse RNA polymerase I terminator _ifragment.

Use double digested plasmid pA-CSf456 and CSf456-T of restriction enzyme SphI and MluI respectively _ifragment, DNA reclaims linearizing pA-CSf456 and CSf456-T that kits preparation has double digestion sticky end _ifragment, two kinds of fragments press the mixing of 1:3-1:10 molar ratio, and T4DNA ligase enzyme connects, conversion, selects positive colony, and order-checking confirmation obtains pA-CSf456-T _i.

5). based on pig rna plymerase i promotor (pSPolI) and mouse rna plymerase i terminator (T _i) swine Fever Vaccine infectious CDNA clones pASPIT _i-CS builds:

By swine Fever Vaccine 5 ' end large fragment plasmid pSPI-CSf123 and the 3 ' end large fragment plasmid pA-CSf456-T of above-mentioned structure _iuse BamHI and MluI double digested respectively, reclaim linearizing pSPI-CSf123 and CSf456-T _isegments-segment, both press the mixing of 4:1 molar ratio, and T4DNA ligase enzyme connects, conversion, selects positive colony, and order-checking confirmation, obtains swine Fever Vaccine infectious CDNA clones plasmid pASPIT _i-CS (Fig. 3 A);

By above-mentioned swine Fever Vaccine cDNA cloned plasmids pASPIT _i-CS transform competent E. coli E.coli DH10B, coating, containing the agar plate culture of amicillin resistance, is selected in positive recombinant inoculation LB and is cultivated, extract plasmid DNA, will containing swine Fever Vaccine cDNA cloned plasmids pASPIT _ie. coli DH10B (the E.coli DH10B/pASPIT of-CS _i-CS), deliver China on January 23rd, 2015. Wuhan. Wuhan University's China typical culture collection center preservation, deposit number is CCTCC NO:M2015062.

6). based on the swine Fever Vaccine kind poison preparation of New Policy swine Fever Vaccine infectious CDNA clones

When preparing swine Fever Vaccine kind poison, first get and preserve bacterium E.coli DH10B/pASPIT containing infectious CDNA clones plasmid _ion-CS streak inoculation LB flat board, 37 DEG C of overnight incubation, choose next day in single colony inoculation LB liquid medium, 200 revs/min of joltings, 37 DEG C of overnight incubation, collect bacterium liquid, extract plasmid (plasmid extraction kit D6943-02, Omega Products) by the operation of test kit specification sheets, agarose cohesion electrophoresis detection ,-70 DEG C save backup.

Get in growth 6 porocyte culture plate, pig source PK15 or SK6 cell that density is 80% individual layer, adopt liposome Lipofectamine2000, transfection cDNA cloned plasmids pASPIT _iin-CS to PK15/SK6 cell (by the operation of liposome Lipofectamine2000 transfection reagent box specification sheets), plasmid-transfected cells nutrient solution is Opti-MEM (Invitrogen Products).After transfection 6h, use the DMEM containing 2% foetal calf serum instead, after continuing to cultivate 72h, frozen-thawed cell culture, 10000 revs/min centrifugal 10 minutes, removes precipitation, collects supernatant, detects swine Fever Vaccine kind poison and produce.

Swine Fever Vaccine virus produces and detects: get transfection pASPIT _ithe pig source SK6 cultivating 72h after-CS plasmid is primary antibodie with the anti-NS3 polyclonal antibody of rabbit, and two resist and carry out indirect IF staining detect swine Fever Vaccine kind poison for fluorescein (Alexa Flour488) marks goat anti-rabbit igg antibody (Invitrogen Products).As shown in Figure 4 A, stained positive (green fluorescence) cell is for producing swine Fever Vaccine virocyte for result.Collecting cell cracking supernatant liquor inoculation PK15 cell, gathers in the crops cells infected after cultivating 72h, extracts total serum IgE and carries out RT-PCR detection viral nucleic acid.Result as shown in Figure 4 B, detects in the PK15 cell of the prepared swine Fever Vaccine kind poison of inoculation and has swine Fever Vaccine virus genome RNA to exist.

Based on New Policy swine Fever Vaccine infectious CDNA clones pASPIT _i-CS transfection to the principle of work of PK15/SK6 cellular rescue swine Fever Vaccine kind poison is: pASPIT _i-CS plasmid comprises swine Fever Vaccine C pnca gene group cDNA, this cDNA is under pig rna plymerase i promotor and mouse rna plymerase i terminator control, swine Fever Vaccine viral genome vRNA is produced at pig source cell PK15/SK6 transcription, take vRNA as template translation, processing generation viral protein, this vRNA carries out copying generation progeny virus genome vRNA simultaneously, then carry out virion assembling, produce swine Fever Vaccine progeny virus (as shown in Figure 3 B).

Go down to posterity amplicon virus in PK15/SK6 clone, and obtain genetically engineered swine Fever Vaccine kind poison, packing ,-70 DEG C frozen for subsequent use.

[embodiment 2] expresses the structure of foreign protein luciferase Recombinant Swine pest vaccine virus

According to swine Fever Vaccine C strain full-length gene group sequence (Genbank No.AF091507), sea cucumber luciferase-encoding sequences (GenBank No.AF025846.2), foot and mouth disease virus (FMDV) 2A encoding sequence (GenBank No.M95781.1), the various RT-PCR of design and synthesis or pcr amplification primer.Each primer is synthesized by Shanghai Sheng Gong company.

1. build the recombinant plasmid pASPI-CSf123/RLuc merging luciferase gene swine Fever Vaccine 5 ' end

A). nearly 5 ' terminal restriction restriction endonuclease PmlI site fragment (the being positioned at genome 290-900nt) preparation of swine Fever Vaccine genome: according to swine Fever Vaccine genome sequence design primer, the nearly 5 ' terminal restriction restriction endonuclease PmlI site fragment of pcr amplification genome:

Upstream primer CS-fPmF (SEQ ID NO.23):

5′-CACCACGTGATGGGAGTACG-3′

Downstream primer CS-fPmR (SEQ ID NO.24):

5′-TCCCACTCGCGCCATC-3′；

Take pASPI-CSf123 as template, adopt CS-fPmF/CS-fPmR primer, by following reaction system and condition amplification

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 30Sec carry out 33 circulations, obtain CS-fPm fragment PCR products.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

B). merge the luciferase encoding gene fragment preparation of foot and mouth disease virus (FMDV) 2A albumen coded sequence: design primer according to luciferase gene sequence (GenBank No.AF025846.2) and (FMDV) 2A albumen coded sequence (GenBank No.M95781.1), pcr amplification merges RLuc2A fragment, upstream primer holds 7 amino acid coding containing swine Fever Vaccine C protein N, and downstream primer is containing 2A encoding sequence:

Upstream primer Luc2AF (SEQ ID NO.25):

5′-CACCACGTGATGGGAGTACG-3′

Downstream primer Luc2AR (SEQ ID NO.26):

5′-CCACTTGCGCCATCATCGGAG GGCCCTGGGTTGGACTCGACGTCTCCGGCCAACTTGAGAAGGTCAAAGTTTTGTTCATTTTTGAG-3′

Underscore part is 2A gene.

With pRL-TK plasmid (Promega Products) for template, adopt Luc2AF/Luc2AFR primer, by following reaction system and condition amplificationluc2A fusion sequence:

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 30Sec carry out 33 circulations, obtain RLuc2A fragment PCR products.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

C). nearly 5 ' terminal restriction restriction endonuclease SpeI site fragment (the being positioned at genome 878-2442nt) preparation of swine Fever Vaccine genome: according to swine Fever Vaccine genome sequence design primer, the nearly 5 ' terminal restriction restriction endonuclease SpeI site fragment of pcr amplification genome:

Upstream primer CS-fSpF (SEQ ID NO.27):

5′-CACCACGTGATGGGAGTACG-3′

Downstream primer CS-fSpR (SEQ ID NO.28):

5′-TCCCACTCGCGCCATC-3′；

With pASPI-CSf123 plasmid for template, adopt CS-fSpF/CS-fSpR primer, by following reaction system and condition amplification

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, then 98 DEG C of 10Sec, 55 DEG C of 30Sec, 72 DEG C of 45Sec carry out 33 circulations, obtain CS-fSp fragment PCR products.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

D). merge luciferase gene swine Fever Vaccine 5 ' end large fragment CSf123/Luc preparation

With nearly 5 ' terminal restriction restriction endonuclease PmlI site fragment CS-fPm, RLuc2A fragment of the swine Fever Vaccine genome of above-mentioned preparation and the nearly 5 ' terminal restriction restriction endonuclease SpeI site fragment CS-fSp mixture of genome for template, take CS-fPmF as upstream primer, CS-fSpR be downstream primer, pcr amplification:

by following reaction system and condition amplification

Said components is mixed, PCR thermal cycler carries out following reaction: 98 DEG C of sex change 30Sec, 98 DEG C of 10Sec again, 55 DEG C of 30Sec, 72 DEG C of 90Sec carry out 33 circulations, obtain RLuc2A coding region to merge to swine Fever Vaccine 5 ' end sequence with frame, PCR primer CS-fPm-RLuc2A-CS-fSp fragment.

Adopt DNA to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup.

E). the recombinant plasmid pASPI-CSf123/Luc merging luciferase gene swine Fever Vaccine 5 ' end builds

Use the double digested plasmid pSPI-CSf123 of restriction enzyme PmlI and SpeI and CS-fPm-RLuc2A-CS-fSp DNA fragmentation respectively, DNA reclaims kits and prepares linearized vector and CS-fPm-RLuc2A-CS-fSp fragment, two kinds of fragments press the mixing of 1:3-1:10 molar ratio, T4DNA ligase enzyme connects, conversion, select positive colony, order-checking confirmation, obtains pASPI-CSf123/RLuc recombinant plasmid.

2. merge luciferase gene swine Fever Vaccine recombinant plasmid pASPIT _i-CS/RLuc builds

By swine Fever Vaccine 5 ' end large fragment plasmid pASPI-CSf123/RLuc and the 3 ' end large fragment plasmid pA-CSf456-T of above-mentioned structure _iuse BamHI and MluI double digested respectively, reclaim linearizing pSP _i-CSf123/Luc and CSf456-T _isegments-segment, both press the mixing of 4:1 molar ratio, and T4DNA ligase enzyme connects, conversion, selects positive colony, and order-checking confirmation, obtains swine Fever Vaccine infectious CDNA clones plasmid pASPIT _i-CS/RLuc;

3. expressing luciferase Recombinant Swine pestilence seed poison preparation

By above-mentioned swine Fever Vaccine cDNA cloned plasmids pASPIT _i-CS/Luc transform competent E. coli E.coli DH10B, coating, containing the agar plate culture of amicillin resistance, is selected in positive recombinant inoculation LB and is cultivated, extract plasmid DNA.

Get pig source PK15 or the SK6 cell of growth 80% individual layer, adopt liposome Lipofectamine2000, transfection cDNA cloned plasmids pASPIT _iin-CS/Luc to PK15/SK6 cell (by the operation of liposome Lipofectamine2000 transfection reagent box specification sheets), transfectional cell nutrient solution is Opti-MEM (Invitrogen Products).After transfection 6h, use the DMEM containing 2% foetal calf serum instead, after continuing to cultivate 72h, frozen-thawed cell culture, collects viral supernatant liquid.The fluoroscopic examination of swine fever virus resistant NS3 antibody mediated immunity shows, transfection pASPIT _ithe PK15 cellular rescue of-CS/Luc plasmid DNA goes out swine Fever Vaccine virus (Fig. 5 A).

Go down to posterity amplicon virus in PK15/SK6 clone, and obtain the Recombinant Swine pestilence seed poison of expressing luciferase, packing ,-70 DEG C frozen for subsequent use.

4. the chimeric swine Fever Vaccine expressing protein uciferase activity of restructuring measures

A). get stand density 85-95% individual layer PK15 cell, by the Recombinant Swine pestilence seed toxogen liquid of expressing luciferase by serial doubling dilution inoculation PK15 cell, after virus inoculation, cell adds the DMEM nutrient solution of 2% foetal calf serum in 37 DEG C, 5%CO ₂cMC model 24h, harvested cell, blots nutrient solution, and PBS washed cell once.

B). uciferase activity measures, and measures the operation of test kit (Promega) specification sheets by uciferase activity.Particularly: the 5 × sea cucumber luciferase lysis buffer getting 4ml, add in the aseptic deionized water of 16ml, mixing, preparation 1 × cell pyrolysis liquid, 1 × cell pyrolysis liquid is joined in the 24 each holes of orifice plate, 50 μ l/ holes, lysis at room temperature cell 15 ~ 20min, period shakes 24 orifice plates, so that all cells is cleaved; Get 5 μ l cell pyrolysis liquids and 5 μ l luciferase substrate solution respectively to join in 1.5ml EP pipe and mix, immediately mixing solutions is put into luciferase detector (_ 20/20Luminometer), read fluorescent value, time of lag is set to 10s.Experimental result shows, and compares with negative control cell, infects Recombinant Swine pestivirus PK15 cells express high levels uciferase activity (Fig. 5 B).

5. the chimeric swine Fever Vaccine virus titer of restructuring measures

Get be grown in 12 orifice plates, density 85-95% individual layer PK15 cell, by Recombinant Swine pestilence seed toxogen liquid dilution MOI=0.01 inoculating cell, after virus inoculation, cell adds the DMEM nutrient solution of 2% foetal calf serum in 37 DEG C, 5%CO ₂cMC model, respectively at infect the 6th after virus, 12,24,48,72h, take out and infect virocyte (comprising supernatant), freeze thawing twice, collected by centrifugation supernatant, adopt anti-NS3 polyclonal antibody to be primary antibodie, indirect IF staining measures viral TCID ₅₀.Result shows, and the titre of the chimeric swine Fever Vaccine virus of restructuring on PK15 cell is about 10 ⁴tCID ₅₀/ ml.

The immune efficacy of the anti-CSFV of [embodiment 3] restructuring swine Fever Vaccine induction pig body detects

1. pig body immunization

Choose and do not inoculate swine fever, the health 2 monthly age piglet that negative through Immunofluorescence test CSFV, ELISA detects CSFV serum antibody feminine gender, be divided into two groups at random, for vaccination experiments group and non-vaccine inoculation control group.

Particularly, get the newborn sodium selenite in 6 week age not inoculating swine Fever Vaccine, precaval vein is taken a blood sample, and is divided into two parts, a separation of serum, detects CSFV antibody for ELISA; Another part of whole blood is used for Pestivirus suis and detects.Concrete detection method: get pig whole blood freezing-thawing and cracking, centrifugation supernatant, carries out 10 times of serial dilutions with serum-free DMEM, inoculation PK15 cell, and to cultivate after 72h with NS3 antibody for primary antibodie carries out indirect IF staining, inverted fluorescence microscope is observed.Allly occur that immunofluorescence dyeing cell is judged to be the positive.Choose Pestivirus suis and negative antibody piglet 6 is divided into two groups at random, subfield is raised, detection serum antibody of again taking a blood sample to 8 weeks age, and negative antibody sodium selenite is used for testing.

Vaccination experiments group: every pig is through intramuscular injection path inoculation 1 × 10 ⁴tCID ₅₀recombiant vaccine C strain virus.Non-vaccine inoculation negative control group: adopt through the isopyknic PBS of intramuscular injection.

After vaccine inoculation, every day carries out measurement of bldy temperature and clinical observation to experimental group and each head pig of control group.The the 7th, 14 and 21 day after immunity, gather pig precaval vein blood, separation of serum, measure CSFV neutralizing antibody.

2. pig body challenge test

Pig body immunization is after 23 days, with 5 × 10 ⁵tCID ₅₀cSFV crossdrift virulent strain virus liquid, adopt collunarium approach to attack poison and infect, in attack poison infect after every day measure the change of each head temperature of pig body, record pig morbidity clinical symptom and death toll; Respectively at attacking poison precaval vein blood sampling in latter 4th, 8,14 and 21 day, separation of serum, detects change of serum C SFV NAT.

Neutralizing antibody detects

(1). by 1 × 10 ⁵cell/ml concentration inoculation PK15 cell suspension (100 μ l/ hole) in flat-bottomed microtiter 96 well culture plate; 5%CO ₂37 DEG C are cultured to formation 70% ~ 80% cell monolayer;

(2). by porcine blood serum to be detected in 56 DEG C of deactivation 30min, make 2 times of serial dilutions with serum-free EMEM nutrient solution; By the serum to be checked of dilution and containing 100TCID ₅₀the CSFV virus liquid equal-volume mixing of/50 μ l, puts 37 DEG C and hatches 1-2h;

(3). with serum-free DMEM (SH30002.01, HyClone Products) wash PK15 monolayer cell, add serum/viral mixed solution (100 μ l/ hole), hatch 1h for 37 DEG C, suck serum/viral mixed solution, add the DMEM nutrient solution containing 2% calf serum, 5%CO ₂, 37 DEG C continue to cultivate 48-72h;

(4). take out Tissue Culture Plate, detect serum Neutralizing titer (every part of serum sample repeats 2 experiments) by the indirect immunofluorescence described in enforcement 2 step 3.Particularly, serum/viral mixed solution inoculation about 90% individual layer PK15 cell will be inoculated, after culturing cell 48-72h, discard substratum, with PBS washed cell 3 times, acetonformaldehyde (1:1)-20 DEG C of fixing 1h of precooling, successively with the anti-CSFV NS3 of rabbit be primary antibodie (1:300 dilution), goat anti-rabbit igg-FITC is two anti-(1:400 dilution) immunofluorescence dyeings, observations under Olympus inverted fluorescence microscope.

(5). NAT judges: in energy and the most highly diluted multiple (unstressed configuration staining reaction) of the infective serum of CSFV as the Neutralizing titer of serum.

Result is as shown in table 1, and CSFV virulent strain is attacked after poison infects and started for the 3rd day, and vaccinated pig CSFV NAT continues to raise, and all can't detect neutralizing antibody in non-vaccine inoculation negative control group porcine blood serum.

Table 1 is recombinated serum NAT after swine Fever Vaccine Pigs Inoculated and contrast pig body CSFV strong malicious lethal challenge

3). the immunoprotection of the strong malicious lethal challenge of the vaccine inoculation induction anti-CSFV of pig body

Observations display (Fig. 6 and table 2) after experiment pig infects with CSFV strong virus attack, after non-vaccine inoculation negative control group experiment pig attacks poison, mean body temperature started to increase to over 40 DEG C in the 3rd day, and within the 4th day, whole 3 temperature of pig body are more than 41 DEG C, and lasted till that all pigs are dead.Have 1 temperature of pig body slightly to raise (40.7) in vaccine immunization pig of the present invention, continue within 5 days, then to recover normal, all the other 2 pigs always body temperature are normal, all vaccinated pig survivals.

Table 2 is recombinated Temperature changing and survival condition after swine Fever Vaccine Pigs Inoculated and contrast pig body CSFV strong malicious lethal infection

SEQUENCE LISTING

 

<110> Wuhan University

<120> swine Fever Vaccine infectious CDNA and construction process thereof and application

<130>

<160> 28

<170> PatentIn version 3.3

 

<210> 1

<211> 388

<212> DNA

<213> pig rna plymerase i promoter sequence

<400> 1

cggagtgttt ccctgtcggt cggtcgatcg gtcgggaggt ggggaccggc ctgagctgga 60

 

tggtgtgtcc tggattttgg gggagccaag tccccgtctg gagctccgga cagaccgata 120

 

cctgcccgcg tgggcaagcc gggaagggct tcccggctgg ccggccggct ccacctcctt 180

 

catgtccctg tcccttccct gcggtcacgc tccccgggtc gaccagatgg ctctgagagc 240

 

gctgggtctg gcgactctag ggcagggctg ggggacaagt gtccggatgg gggttccggg 300

 

gataccccca cgtcctgtgg gtgggccccg ctgctgggca tggacatttt tcgcggccga 360

 

aatacgcctt ttctgtcacc aggtagat 388

 

<210> 2

<211> 34

<212> DNA

<213> mouse terminator sequence

<400> 2

tcccccccaa cttcggaggt cgaccagtac tccg 34

 

<210> 3

<211> 49

<212> DNA

<213> Artificial

<223> P1F

<400> 3

gcgtcgactc ttaatacgac tcactatagt atacgaggtt agttcattc 49

 

<210> 4

<211> 33

<212> DNA

<213> Artificial

<223> P1R

<400> 4

ccagttacta gtaacagcca taccacacct tgc 33

 

<210> 5

<211> 31

<212> DNA

<213> Artificial

<223> P2F

<400> 5

gctgttacta gtaactgggg cacaaggccg g 31

 

<210> 6

<211> 25

<212> DNA

<213> Artificial

<223> P2R

<400> 6

catggtacct gtcattgaac ttgtc 25

 

<210> 7

<211> 26

<212> DNA

<213> Artificial

<223> P3F

<400> 7

caatgacagg taccatgttg ccattg 26

 

 

<210> 8

<211> 22

<212> DNA

<213> Artificial

<223> P3R

<400> 8

caccctcagg ttagatggat cc 22

 

 

<210> 9

<211> 23

<212> DNA

<213> Artificial

<223> P4F

<400> 9

agaggatcca tctaacctga ggg 23

 

<210> 10

<211> 25

<212> DNA

<213> Artificial

<223> P4R

<400> 10

atttctgcag agaaatgaac cttcc 25

 

<210> 11

<211> 26

<212> DNA

<213> Artificial

<223> P5F

<400> 11

gaggaggaag gttcatttct ctgcag 26

 

<210> 12

<211> 21

<212> DNA

<213> Artificial

<223> P5R

<400> 12

catttagcat gctgttgccc g 21

 

<210> 13

<211> 21

<212> DNA

<213> Artificial

<223> P6F

<400> 13

cgggcaacag catgctaaat g 21

 

<210> 14

<211> 23

<212> DNA

<213> Artificial

<223> P6R

<400> 14

tacgcgtgag cccgggccgt tag 23

 

<210> 15

<211> 25

<212> DNA

<213> Artificial

<223> SPI-F

<400> 15

ccggatccgg agtgtttccc tgtcg 25

 

<210> 16

<211> 51

<212> DNA

<213> Artificial

<223> SPI-R

<400> 16

agggtacctc tagactcgag cgtctccatc tacctggtga cagaaaaggc g 51

 

<210> 17

<211> 33

<212> DNA

<213> Artificial

<223> CS-F

<400> 17

caggtagatg tatacgaggt tagttcattc tcg 33

 

<210> 18

<211> 19

<212> DNA

<213> Artificial

<223> CS-R

<400> 18

ccatcgatgc acacataag 19

 

<210> 19

<211> 585

<212> DNA

<213> pACNR1180 is used for cloning region sequence

<400> 19

aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 60

 

ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 120

 

aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtcgacc tgaggtaatt 180

 

ataacccggg ccctatatat ggatccaatt gcaatgatca tcatgacaga tctgcgcgcg 240

 

atcgatatca gcgctttaaa tttgcgcatg ctagctatag ttctagaggt accggttgtt 300

 

aacgttagcc ggctacgtat actccggaat attaataggc ctaggatgca tatggcggcc 360

 

gcctgcagct ggcgccatcg atacgcgtac gtcgcgaccg cggacatgta cagagctcga 420

 

gcaagacgtt tcccgttgaa tatggctcat aacacccctt gtattactgt ttatgtaagc 480

 

agacagtttt attgttcatg atgatatatt tttatcttgt gcaatgtaac atcagagatt 540

 

ttgagacaca acgtggcttt gttgaataaa tcgaactttt gctga 585

 

<210> 20

<211> 24

<212> DNA

<213> Artificial

<223> ACNRF

<400> 20

tggactaagg taatttctaa cggc 24

 

<210> 21

<211> 24

<212> DNA

<213> Artificial

<223> ACNRR

<400> 21

actccggagt cgacgtcagg tggc 24

 

<210> 22

<211> 59

<212> DNA

<213> Artificial

<223> CS-RTI

<400> 22

cgacgcgtcg gagtactggt cgacctccga agttgggggg gagggccgtt agaaattac 59

 

<210> 23

<211> 20

<212> DNA

<213> Artificial

<223> CS-fPmF

<400> 23

caccacgtga tgggagtacg 20

 

<210> 24

<211> 16

<212> DNA

<213> Artificial

<223> CS-fPmR

<400> 24

tcccactcgc gccatc 16

 

<210> 25

<211> 20

<212> DNA

<213> Artificial

<223> Luc2AF

<400> 25

caccacgtga tgggagtacg 20

 

<210> 26

<211> 86

<212> DNA

<213> Artificial

<223> Luc2AR

<400> 26

ccacttgcgc catcatcgga gggccctggg ttggactcga cgtctccggc caacttgaga 60

 

aggtcaaagt tttgttcatt tttgag 86

 

<210> 27

<211> 20

<212> DNA

<213> Artificial

<223> CS-fSpF

<400> 27

caccacgtga tgggagtacg 20

 

<210> 28

<211> 16

<212> DNA

<213> Artificial

<223> CS-fSpR

<400> 28

tcccactcgc gccatc 16

 

 

Claims (10)

1. the full-length infectious CDNA of a swine Fever Vaccine kind poison, it is characterized in that: described full-length infectious CDNA comprises swine Fever Vaccine kind poison full-length cDNA, in this cDNA 5 ' terminal fusion pig rna plymerase i promotor, sequence is for shown in SEQ ID NO:1, hold at cDNA 3 ' and insert mouse rna plymerase i terminator, sequence is for shown in SEQ ID NO:2.

2. the full-length infectious CDNA of swine Fever Vaccine kind poison according to claim 1, is characterized in that: described swine Fever Vaccine kind poison is swine Fever Vaccine C strain.

3. one kind comprises the plasmid pASPIT of swine Fever Vaccine infectious CDNA clones according to claim 2 _i-CS, is characterized in that: transform plastids pASPIT _ithe intestinal bacteria DH10B/pASPIT of-CS _i-CS ( e.colidH10B/pASPIT _i-CS), be deposited in China typical culture collection center, preserving number is CCTCC NO:M 2015062.

4. one kind builds plasmid pASPIT according to claim 3 _ithe method of-CS, is characterized in that this plasmid prepares as follows:

Prepared by step 1) swine Fever Vaccine C pnca gene group cDNA fragment:

With swine Fever Vaccine C strain RNA for template, according to swine Fever Vaccine C strain full-length gene group sequence (Genbank No. AF091507) design and synthesis 6 pairs of specific PCR amplimers (SEQ ID NO:3-14), adopt RT-PCR, obtain swine Fever Vaccine C strain full-length gene group 6 cDNA fragments (CSf1-6);

Step 2) the long genome large fragment structure of swine Fever Vaccine C strain 5 ' end half:

Fragment CSf1, CSf2 and CSf3 are connected to successively low copy plasmid pACNR1180 (being given by N.Ruggli and J.D.Tratschin doctor), build pA-CSf123;

Step 3) the long genome large fragment structure of swine Fever Vaccine C strain 3 ' end half:

Fragment CSf4, CSf5 and CSf6 are connected to successively low copy plasmid pACNR1180, build pA-CSf456;

Step 4) builds the recombinant plasmid pSPI-CSf123 of the swine Fever Vaccine 5 ' end merging pig rna plymerase i promotor:

(1) pig rna plymerase i promotor (pSPolI) fragment preparation: design promoter fragment pcr amplification primer (SEQ ID NO:15-16) according to pig rna plymerase i promoter sequence (GenBank No. L31782.1), with the DNA of pig source PK-15 cell for template, amplification pig rna plymerase i promotor, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

(2) swine Fever Vaccine C strain 5 ' end 784bp fragment amplification: build swine Fever Vaccine cDNA sequence, design one couple of PCR primers (SEQ ID NO:17-18), amplification gene group 5 ' end 784bp fragment, with pA-CSf123 recombinant plasmid for template, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

(3) pACNR1180 vector backbone segment amplification: according to pACNR1180 carrier sequence (SEQ ID NO:19) design of amplification primers (SEQ ID NO:20-21), with pA-CSf123 recombinant plasmid for template, obtain pACNR1180 vector backbone segment PCR primer, DNA is adopted to reclaim kits PCR primer, order-checking confirmation ,-70 DEG C save backup;

(4) the pACNR1180 vector backbone segment amplification of swine Fever Vaccine C strain 5 ' end and pig rna plymerase i promotor is merged: with the swine Fever Vaccine C strain 5 ' end 784bp fragment of above-mentioned preparation, pig rna plymerase i promotor and pACNR1180 vector backbone DNA segments mixture are template, with SEQ ID NO:20 for upstream primer, SEQ ID NO:18 is downstream primer, pcr amplification obtains the pACNR1180 vector backbone segment PCR primer A-SPI-CS-5 ' merging swine Fever Vaccine 5 ' end and pig rna plymerase i promotor, DNA is adopted to reclaim kits PCR primer, order-checking confirmation,-70 DEG C save backup,

(5) the swine Fever Vaccine 5 ' end recombinant plasmid pSPI-CSf123 merging pig RNA polymerase I promotor builds: use restriction enzyme respectively pmli and mlui double digested plasmid pA-CSf123 and A-SPI-CS-5 ' DNA fragmentation, DNA reclaims kits and prepares △ CSf123 and A-SPI-CS-5 ' fragment, and two kinds of fragments press 1:2 mixing, and T4 DNA ligase connects, conversion, select positive colony, order-checking confirmation obtains pSPI-CSf123;

Step 5) builds the swine Fever Vaccine 3 ' end recombinant plasmid pA-CSf456-TI merging mouse RNA polymerase I terminator (TI):

According to mouse rna plymerase i terminator sequence (SEQ ID NO:2) and swine Fever Vaccine C strain 3 ' end sequence, design and synthesis merges the long aligning primer (SEQ ID NO:9,23) of mouse terminator sequence, with recombinant plasmid pA-CSf456 for template, obtained the swine Fever Vaccine 3 ' end PCR primer CSf456-T merging mouse RNA polymerase I terminator by PCR _ifragment;

Use restriction enzyme respectively sphi and mludouble digested plasmid pA-CSf456 and CSf456-T of I _ifragment, DNA reclaims kits, prepares linearizing pA-CSf456 and CSf456-T of double digestion sticky end _ifragment, two kinds of fragments press the mixing of 1:3-1:10 molar ratio, and T4 DNA ligase connects, conversion, selects positive colony, and order-checking confirmation obtains plasmid pA-CSf456-T _i;

Step 6) is based on pig rna plymerase i promotor (pSPolI) and mouse rna plymerase i terminator (T _i) swine Fever Vaccine infectious CDNA clones pASPIT _i-CS builds:

By swine Fever Vaccine 5 ' end large fragment plasmid pSPI-CSf123 and the 3 ' end large fragment plasmid pA-CSf456-T of above-mentioned structure _iuse respectively bamHi and mlui is double digested, reclaims linearizing pSPI-CSf123 and A-CSf456-T _ifragment, both press the mixing of 4:1 molar ratio, and T4 DNA ligase connects, conversion, selects positive colony, and order-checking confirmation, obtains swine Fever Vaccine infectious CDNA clones plasmid pASPIT _i-CS, transform competent E. coli e.colidH10B, coating, containing the agar plate culture of amicillin resistance, selects positive recombinant e.colidH10B/pASPIT _i-CS, is deposited in China typical culture collection center, and preserving number is CCTCC NO:M2015062.

5. plasmid pASPIT according to claim 3 _ithe application of-CS in rescue swine Fever Vaccine C strain, comprises and adopts liposome Lipofectamine2000, transfection cDNA cloned plasmids pASPIT _i-CS is to the PK15 cell of Pestivirus suis sensitivity or SK6 cell, and rescue obtains swine Fever Vaccine kind poison C strain kind poison.

6. in claim 5, save the application of swine Fever Vaccine C strain in prevention swine fever obtained.

7. plasmid pASPIT according to claim 3 _i-CS is used for swine Fever Vaccine and modifies transformation and express exogenous antigen albumen, to prepare high-titer swine Fever Vaccine or bivalent and polyvalent recombinant swine Fever Vaccine.

8. plasmid pASPIT according to claim 7 _i-CS, is characterized in that comprising the steps: expressing the application in foreign protein as carrier

1) adopt the amplification of multi-step over-lap PCR to obtain external source antigen-4 fusion protein gene, its 5 ' end merges Pestivirus suis C protein 7 amino acid coding, and its 3 ' end merges foot and mouth disease virus 2A albumen coded sequence;

2) the external source antigen-4 fusion protein gene of acquisition is inserted into swine Fever Vaccine genome N ^proand between C protein coding region, the restructuring swine Fever Vaccine obtaining expressing foreign protein is fitted together to infectious CDNA clones.

9. application according to claim 8, is characterized in that: described foreign protein take luciferase as reporter gene, and luciferase (Luc) gene and foot and mouth disease virus 2A protein gene are fused to Luc2A.

10. application according to claim 8, is characterized in that: described foreign protein is other swine disease pathogenic agent protective antigen albumen.