CN104651369B - Aflatoxin B1 aptamer and its application in sample Magneto separate - Google Patents

Abstract

The invention discloses a kind of aflatoxin B1 aptamer and its application in sample Magneto separate, belong to biological technical field.The nucleotide sequence of aflatoxin B1 aptamer is as shown in SEQNO.1.The aflatoxin B1 aptamer of the present invention is prepared by free state target sieving Policy Filtering, has specificity good, stability is high, cost is cheap, is easy to chemical modification and synthesis, easy to use, the features such as nontoxic, it is expected to the potential reagent detected as aflatoxin in sample.The magnetism separate method based on aflatoxin B1 aptamer can be used for the detection pre-treatment of aflatoxin B1 in sample, have enrichment, catharsis, easy, quick.Compared with antibody, for aflatoxin B1 aptamer as a kind of single stranded DNA, stability is good, is easy to preserve, and is easy to modification and mark, at the same can a large amount of chemical syntheses, difference is small between batch, and cost is cheap.

Description

Aflatoxin B1 aptamer and its application in sample Magneto separate

Technical field

The invention belongs to biological technical field, more particularly to a kind of aflatoxin B1 aptamer and its in magnetic sample Application in separation.

Background technology

The pollution for influenceing mycotoxin in the Hazard factor of agricultural product quality and safety is one of most important factor.Aspergillus flavus Toxin (Aflatoxins, AF) is primarily present in peanut, corn, rice, wheat, milk, cottonseed as a kind of natural pollution source It is the general name of the similar mycotoxin of a kind of chemical constitution in various nuts and feed, two furans cumarin of category Derivative, kind more than 20 is had now been found that, mainly including B1, B2, G1, G2, M1 and M2 etc..AFB1 is to find that toxicity is most strong so far Mycotoxin, its toxicity is strong compared with potassium cyanide 10 times, strong compared with arsenic 68 times, the organ induced hepatocellular carcinoma such as main damage liver, into For the mankind's onset of liver cancer an important factor for and a kind of carcinogenic substance is regarded as by the World Health Organization.AFB1 physicochemical properties are more steady It is fixed, there is fat-soluble, high temperature resistant, hardly possible removes, and is a kind of potential serious threat to human and livestock health.Food hygiene and agriculture in the world AFB1 contents are required Inspection Index in Products Trade, and the national standard of AF allowances in food has all been formulated in countries in the world at present, because This, which carries out the identification for being directed to AFB1 and detection research, has important scientific meaning and application value.

At present, general AF detection methods are mainly divided to two major classes in the world：Chemical analysis and immunoassay.Thin layer color Spectrometry (TLC), microtrabeculae method, high performance liquid chromatography (HPLC) etc. belong to chemical analysis, these detection method high sensitivity, standards Exactness is good, but sample pre-treatments are complicated, detection is more time-consuming, instrument and equipment is relatively valuable, and has to testing staff higher Technical requirements.Enzyme linked immunosorbent assay (ELISA) is sensitive, safely, quickly, it is anti-interference, be that universal practical AF is immunized at present Detection method, but this micromolecular toxicity of AF is higher, the Antibody preparation cycle is long, technical difficulty is big, differences between batches are big, and prepares Good antibody is not easy to maintain, easy in inactivation, and these shortcomings greatly limit the popularization and fast development of immunological analysis method.Nucleic acid Aptamers, referred to as " chemical antibody ", have target scope wide (even malicious as a kind of single stranded oligonucleotide compared with antibody Property target), can external preparation, the construction cycle is short, production cost is low, it is specific it is high, stability is good, quality is homogeneous, differences between batches It is small and be easy to chemical synthesis and modification the advantages that.

At present, the Fast Detection Technique research and development based on aptamer are more and more hotter, in medical science very Extensively, and the application report in mycotoxin context of detection is also only limitted to ochratoxin A (OTA) and fumonisin B1 (FB1).Therefore, the exploitation for AF molecular recognition elements aptamer has important Research Significance and wide application The target molecule identification specificity of prospect, particularly its height (can distinguish the difference of single modification group, as the nucleic acid of theophylline is fitted Part can distinguish cocaine and theophylline molecule, and the two only has the difference of a methyl), it is especially suitable for AF this class formation extremely phase As small molecule analysis.

The content of the invention

The primary and foremost purpose of the present invention is to overcome shortcoming and deficiency present in prior art, there is provided a kind of aflatoxin B1 aptamers, the aptamer can specific recognition aflatoxin B1, its screening process uses free state target Screening strategy is that screening process holding aflatoxin B1 is free state, does not carry out any modification to it.

Another object of the present invention is to provide described aflatoxin B1 aptamer in sample Magneto separate Using.

The purpose of the present invention is achieved through the following technical solutions：A kind of aflatoxin B1 aptamer, its nucleotides Sequence is as follows：

CCTGCCACGCTCCGCAAGCTTATAGGGCACGTGTTGTCTTCCTGTGTCTCGTGCCCATCGCTAGGTTTACATAAGCT TGGCACCCGCATCGT。

Described aflatoxin B1 aptamer has secondary structure as shown in Figure 6.

Described aflatoxin B1 aptamer can apply to sample Magneto separate.

Preferably, described aflatoxin B1 aptamer can apply to aflatoxin B1 magnetic point in sample From.

Described aflatoxin B1 aptamer includes the derived sequence of amido modified above-mentioned nucleotide sequence, described Amido modified nucleotide sequence derived sequence have with aflatoxin B1 aptamer original sequence identical from sample Carry out aflatoxin B1 Magneto separate function.

Described aflatoxin B1 aptamer is applied to aflatoxin B1 Magneto separate in sample, including following step Suddenly：

(1) amido modified aflatoxin B1 aptamer is linked on the magnetic bead of carboxyl modified；

(2) magnetic bead of aflatoxin B1 aptamer and the sample extracting solution containing aflatoxin B1 will be modified with Mixing, magnetic bead is enriched with using Magneto separate frame, is washed out, finally affords the high aflatoxin B1 of purity levels.

The present invention is had the following advantages relative to prior art and effect：

1) aflatoxin B1 aptamer of the invention is obtained by free state target sieving strategy, screening process The modification of target molecules it is not related to, therefore the aflatoxin B1 aptamer obtained has preferably specificity.

2) compared with antibody, for aflatoxin B1 aptamer as a kind of single stranded DNA, stability is good, is easy to preserve, Be easy to modification and mark, at the same can a large amount of chemical syntheses, difference is small between batch, and cost is cheap.

Brief description of the drawings

Fig. 1 is fixed effect figure of the library on magnetic bead：A is Magnetic particles fluorescence microscope image；B is to be fixed with fluorescence Mark the magnetic bead fluorescence microscope image of library complexes；

Fig. 2 is screening library affinity with the screening increased situation of change result figure of round；

Fig. 3 is that screening library binding specificity investigates result figure；

Fig. 4 is cross-linking result figure of the amido modified aflatoxin B1 aptamer on magnetic bead：A is magnetic point after crosslinking From supernatant afterwards；B is the stoste before aflatoxin B1 aptamer is crosslinked；

Fig. 5 is the Magneto separate design sketch of the aptamer modified magnetic bead of aflatoxin B1：A it is) aflatoxin B1 500nM acetonitrile solution (1：1)；B) the aflatoxin B1 screening buffer solution with concentration is fitted by aflatoxin B1 nucleic acid Acetonitrile solution (1 after ligand modified magnetic capture-Magneto separate-elution：1)；C) for the aflatoxin B1 of concentration sieve Select buffer solution capture by Magnetic particles-Magneto separate-elution after acetonitrile solution (1：1)；

Fig. 6 is the secondary structure figure of aflatoxin B1 aptamer.

Embodiment

With reference to embodiment and accompanying drawing, the present invention is described in further detail, but embodiments of the present invention are unlimited In this.

Embodiment 1

The free state target sieving of aflatoxin B1 aptamer

SELEX single stranded DNA random libraries used in the present embodiment are designed as：Both ends are primer fixed sequence program, in Between be for toward the fixed sequence program that library is fixed on magnetic bead, respectively having one section between both ends fixed sequence program and middle fixed sequence program at random Library sequence：5’-CCTGCCACGCTCCGCAAGCTT-N10-CTGCAGCGATTCTTGATCG-N20- TAAGCTTGGCACCCGCATCGT-3 ', storage capacity more than 1014.The library designs and design of traditional fixed sequence program at both ends Difference, the primer fixed sequence program at one side both ends carry out hybridization blocker using short sequence in screening process, avoid library and exist Participate in combining with primer sequence in target cohesive process, while there is bigger downstream exploitation convenience, sequence is fixed in middle library Row can introduce fluorescence labeling short chain sequence, be easy to design " configuration switches type " aptamer sensor.The primer P1： 5 '-Cy3-GCGGAGCGTGGCAGG-3, primer 2：5 '-ACGATGCGGGTGCCAAGCTTA-3 ', primer 3： 5’- CCTGCCACGCTCCGC-3 ', primer 4：5’-Biotin-TACCGCAAAAAAAAACAAGAATCGCTGCAG-3’.

First by 1nmol DNA libraries, 1.5nmol primers 1,1.5nmol primer 2s, 5nmol primers 4 in screening buffer solution In 4 DEG C of overnight hybridizations together, then the library complexes after hybridization are washed and disperseed with screening cushioning liquid in advance with 200 μ L Streptavidin modification magnetic bead at room temperature gently concussion be incubated 30min, Magneto separate remove supernatant and with screen buffer solution again Wash magnetic bead 5 times, it is respectively 1uM aflatoxin B1, B2, G1, G2 screening μ L room temperatures of buffer solution 200 to be eventually adding final concentration Under gently concussion be incubated 1h.Directly enter performing PCR amplification after reaction to the supernatant that Magneto separate obtains, the PCR primer after amplification utilizes Isopropanol precipitating method purifies the screening for being directly used in next round.It is ensuing more than ten wheel amplification, first by it is last round of obtain it is pure Change library and the primer 1,2,4 newly added heats 5min in 95 DEG C, then hybridize 30min under room temperature condition, other operations are same On.After screening carries out ten wheels, carries out independent parllel screening with aflatoxin B1, B2, G1, G2 respectively, and by target with it is literary The incubation time in storehouse shortens to 10min.Cloning and sequencing finally is carried out to satisfactory library, so as to obtain high-affinity, height Specific aflatoxin B1 aptamer.

Fixed effect of the library complexes on magnetic bead is as shown in Figure 1.Because the band of primer 1 of hybridization can be held with library 5 ' There is fluorophor, so the magnetic bead in unfixed library does not have fluorescence under fluorescence microscope, be fixed with the magnetic bead in library glimmering There is fluorescence under light microscope.

As the positive screening process containing target, negative screening is done with the screening buffer solution without aflatoxin B1, will Compared with it elutes supernatant and target elution supernatant, screening library affinity is investigated with screening the increased situation of change of round, As a result it is as shown in Figure 2.With the increase of screening round, the amount in the library that the target buffer solutions of same concentrations elutes gradually exists Increase, while the fluorescence intensity of supernatant gradually strengthens.By the screening of more than ten wheels, the amount in the library that target elutes no longer increases Add or increased comparison is slow, that is, elute the unobvious that the fluorescence intensity of supernatant no longer strengthens or strengthened, now show to sieve Process is selected to progressively reach a platform, signal screening is so far.

Make the specificity in target investigation gained library with other structures similitude small molecule, as a result as shown in Figure 3.Contain Huang Aspertoxin B1 screening buffer solution and the fluorescence for being fixed with the supernatant eluent after the magnetic bead of library fluorescent composition is incubated are strong Degree is stronger, and glimmering with being fixed with library with other structures similitude small molecule aflatoxin B 2, G1, G2 screening buffer solution The fluorescence intensity of supernatant eluent after the magnetic bead incubation of recovery compound is weaker or does not have, it was demonstrated that the screening text finally obtained Storehouse it is specific relatively good, carry out cloning and sequencing, wherein frequency of occurrences highest sequence be 5 '- CCTGCCACGCTCCGCAAGCTTATAGGGCACGTGTTGTCTTCCTGTGTCTCGTGCCCATCGCTAGGTTTACATAAGCT TGGCACCCGCATCGT-3’.Described aflatoxin B1 aptamer has secondary structure as shown in Figure 6.

Embodiment 2

Application of the aflatoxin B1 aptamer before sample Magneto separate in terms of processing

100 μ L carboxyl modifieds magnetic beads (carboxyl mark rate is more than 10 μm of ol/ μ L) Magneto separate is taken to remove dispersion liquid, then same 2- (N- morpholinoes) ethyl sulfonic acid (MES) buffer solution (25mM, pH=5) 200 μ L are mixed 10 minutes, and Magneto separate removes supernatant in triplicate, Finally disperse washed magnetic bead with 150.5 μ L MES buffer solutions, add the amido modified aflatoxin B1 nucleic acid of 9.5 μ L and fit Part (100 μM), while it is rapidly added the MES of 30 μ L1- (3- dimethylamino-propyls) -3- ethyl-carbodiimide hydrochlorides (EDC) Buffer solution (100mg/mL), sealing, lucifuge, 4 DEG C of jogs react 2h, and then Magneto separate takes supernatant to do gel electrophoresis experiment and tied Fruit identifies that cross-linking result is as shown in Figure 4.Under this cross linking conditions, the aptamer of aflatoxin B1 almost 100% is handed over It is linked on magnetic bead.500 μ L aflatoxin B1s concentration for 500nM screening buffer soln and are modified with aflatoxin B1 The magnetic bead room temperature jog reaction 10min of aptamer, is then washed 3 times with screening buffer solution, is eventually adding 500 μ L acetonitrile The aqueous solution (volume ratio 1：1) concussion elution 5min, Magneto separate take supernatant to make testing sample.Check experiment is used without nucleic acid adaptation The magnetic bead of body modification, other operations are constant the same, as a result as shown in Figure 5.It is modified with the magnetic of aflatoxin B1 aptamer Pearl separation, enrichment, the efficiency of purifying aflatoxin B1 are very high, and the rate of recovery is 90% or so；Do not modify aflatoxin B1 The magnetic bead of aptamer, only on a small quantity absorption or do not adsorb, it is impossible to capture aflatoxin B1, without separation, enrichment, Purify aflatoxin B1 the effect of, as a result prove the aptamer be expected to as in sample aflatoxin detect it is potential Reagent, the magnetism separate method based on aflatoxin B1 aptamer are expected to be used in sample before aflatoxin B1 detection Processing, there is enrichment, catharsis.

Above-described embodiment is the preferable embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment Limitation, other any Spirit Essences without departing from the present invention with made under principle change, modification, replacement, combine, simplification, Equivalent substitute mode is should be, is included within protection scope of the present invention.

Claims (1)

1. A kind of 1. application of aflatoxin B1 aptamer, it is characterised in that：Described aflatoxin B1 nucleic acid adaptation Body is applied to aflatoxin B1 Magneto separate in sample, comprises the following steps：

   (1) amido modified aflatoxin B1 aptamer is linked on the magnetic bead of carboxyl modified；

   (2) magnetic bead for being modified with aflatoxin B1 aptamer and the sample extracting solution containing aflatoxin B1 are mixed Close, be enriched with magnetic bead using Magneto separate frame, be washed out, finally afford the high aflatoxin B1 of purity levels；

   The nucleotide sequence of described aflatoxin B1 aptamer is as shown in SEQ ID NO.1.