CN104611223B - The chip of Electrochemical Detection dPCR amplified production and method - Google Patents
The chip of Electrochemical Detection dPCR amplified production and method Download PDFInfo
- Publication number
- CN104611223B CN104611223B CN201510043438.2A CN201510043438A CN104611223B CN 104611223 B CN104611223 B CN 104611223B CN 201510043438 A CN201510043438 A CN 201510043438A CN 104611223 B CN104611223 B CN 104611223B
- Authority
- CN
- China
- Prior art keywords
- micro
- dpcr
- reaction cabin
- microelectrode
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of chip and method of Electrochemical Detection dPCR amplified production, the invention belongs to field of biological detection.The chip of described Electrochemical Detection dPCR amplified production, it is made up of upper cover, micro-reaction cabin array, electrochemistry microelectrode and base, comprises fluid inlet and liquid outlet upper covering; Described electrochemistry microelectrode is positioned at base upper surface.Described method is: fully diluted by sample of nucleic acid and inject micro-reaction cabin array, inject no more than 1 of the To Template number of each micro-reaction cabin, apply to exchange or DC electric field to the microelectrode be positioned at bottom micro-reaction cabin while carrying out dPCR amplification, detect change in electric in dPCR amplification procedure.
Description
Technical field
The present invention relates to a kind of the non-fluorescent label chip and the method that utilize electrochemical techniques detection digital pcr amplified production amount, belong to field of biological detection, refer to a kind of chip and method of Electrochemical Detection dPCR amplified production especially.
Background technology
The application of DNA molecular amplification technique facilitates the development of Protocols in Molecular Biology, and accurate quantification DNA copy number is one of important application of modern molecular biology and medical science.1997, JamesF.Brown, JonathanE.Silver and 0lgaV.Kalinina constructs the blank of digital pcr (digitalpolymerasechainreaction, dPCR) technology, and obtains United States Patent (USP) (patent No.: US6143496A).With traditional PCR technique unlike, sample of nucleic acid fully dilutes by digital pcr, the sample form number of each reaction cabin is made to be less than or to equal 1, pcr amplification terminates the rear fluorescent signal to each reaction cabin and carries out statistical analysis, solve real-time fluorescence quantitative PCR (realtimequantitativePCR, qPCR) utilize the series of problems that reference standard sample and typical curve carry out in relative quantification process, achieve unique DNA absolute quantitation.This sensitivity is high, high specificity, detection flux are high, quantitatively accurately, be widely used in the aspects such as clinical diagnosis, quantitative, the unicellular genetic expression of transgene component, environmental microorganism detection and order-checking of future generation.
At present, detecting dPCR amplified production is all based on fluorescence detection, fluorescence labeling probe is added in reaction system, requiring that target molecule fully increases to reach fluorescence can sensing range, there is certain error, also need supporting Systems for optical inspection (light source, minitype reflector, microscope, filter etc.), complex structure, apparatus expensive, device is difficult to microminiaturization.In order to solve the problem, utilize the method for Electrochemical Detection dPCR amplified production to arise at the historic moment, its principle is with dPCR amplified production for sensitive objects, by characteristic signal real-time characterization dPCR reaction process such as electrochemical electrode sense potential, electric current or conductances.The method has that cost is low, highly sensitive, accuracy is good, manufacture craft is simple, be easy to the advantage such as integrated.
US Patent No. 2002/0072054A1 discloses " Sensorusingimpedancechangetodetecttheend-pointforPCRDNAa mplification ", impedance variations is utilized to characterize the amplification amount of PCR terminal DNA, along with the carrying out of PCR reaction, dNTPs is dissociated into dNMPs and many diphosphates, and electroconductibility increases and impedance declines.Patent CN1499194A " method by electrical signal detection PCR primer " thinks along with the increase of DNA concentration, hinders charged particle migration, thus causes impedance to increase.Patent W02012/152056A1 " Methodanddeviceformonitoringreal-timepolymerasechainreac tion (PCR) utilizingelectro-activehydrolysisprobe (e-tagprobe) " discloses the method and apparatus utilizing the hydrolysis probes of having modified electrochemical activity toughener to detect PCR process.
Above-mentioned patent has set forth the method and apparatus utilizing electrical signal detection pcr amplification product, but is all aimed at the sign of regular-PCR.DPCR single reaction cabin template number reaches single DNA molecular level, and amplification condition is harsh, and reaction weak output signal in early stage, detection difficulty is larger.
Summary of the invention
In order to overcome traditional dPCR fluorescence detecting system complex structure, apparatus expensive, device is difficult to the shortcomings such as microminiaturized, the invention provides a kind of chip and method of Electrochemical Detection dPCR amplified production, testing cost is cheap, highly sensitive, and device making technics is simple, be easy to integrated.
An object of the present invention is to provide a kind of chip of Electrochemical Detection dPCR amplified production, it is made up of upper cover, micro-reaction cabin array, electrochemistry microelectrode and base, comprises fluid inlet and liquid outlet upper covering; Described electrochemistry microelectrode is positioned at base upper surface.
In one embodiment of the invention, described upper cover material is silica glass or other high temperature resistant mechanically resistant materials, is preferably silica glass; Described micro-reaction cabin array by utilizing the method such as chemical corrosion, ion etching to prepare on the macromolecular materials such as silicon, metal or SU-8, and a large amount of micro-reaction cabin of micro-reaction cabin array solid matter, its cross section is circular, square, hexagon etc.
The material of base can be silicon, silicon-dioxide etc., by ordinary method and micro-reaction cabin array bonding, be positioned at the electrochemistry microelectrode of base upper surface, material is metal or the semiconductor material of the good biocompatibilities such as gold, platinum, apply to exchange or DC electric field to dPCR reaction system, to detect in pcr amplification process the dielectric parameter changes such as electromotive force, electric current, conductance, realize the detection by quantitative of dPCR amplified production.
In further embodiment of the present invention, described electrochemistry microelectrode is metal interdigital electrode, and utilize the method such as chemical corrosion, laser burn to carry out roughened to electrode surface, also can grow one deck iridium oxide, Graphene or organic conductive polymer, form nanoporous or nanometer columnar structure, greatly increase electrode contact area, improve detection sensitivity further.The interdigital electrode matched can be designed, as square interdigital electrode and circular interdigital electrode for difform micro-reaction cabin; Further say, in the present invention, the specification of described interdigital electrode is high 0.1-0.6 μm, wide 0.1-1.5 μm, and spacing is 0.1-1.5 μm.
Another object of the present invention is a kind of method adopting said chip to carry out Electrochemical Detection dPCR amplified production, described method is: fully diluted by sample of nucleic acid and inject micro-reaction cabin array, inject no more than 1 of the To Template number of each micro-reaction cabin, apply to exchange or DC electric field to the microelectrode be positioned at bottom micro-reaction cabin while carrying out dPCR amplification, detect change in electric in dPCR amplification procedure.
In further embodiment of the present invention, while sample of nucleic acid fully being diluted the micro-reaction cabin array of injection, in dPCR system, add electrochemistry indicator, described electrochemistry indicator can be any one or multiple combination in ferrocene, methylene blue, Hoechst33258, daunomycin, curcumine and Schuttgelb.
In one embodiment of the invention, apply electric field and be preferably alternating-electric field, range of frequency is 0.1Hz-50MHz, and intensity (Vrms) scope is 1mV-30V.
In another embodiment of the invention, before detecting, preferably fill micro-reaction cabin with the BSA solution that massfraction is 0.2%, soak 1 hour, reduce reaction cabin internal surface to the absorption of PCR reagent, sample template, improve reaction efficiency and the detection accuracy of dPCR.
The invention has the beneficial effects as follows, electrochemical measuring technique and dPCR technology are combined, in microelectrode detection reaction system, the characteristic signal such as electromotive force, electric current or conductance realizes the quantitative analysis of dPCR amplified production, without the need to the fluorescence detecting system of complex and expensive, detection sensitivity is high, with low cost, and device making technics is simple, be easy to integrated, can be applicable to cancer pole early detection, fetal disease examination, the gene diagnosis even aspect such as Personalized medicine, there is important scientific meaning and using value.
Accompanying drawing explanation
Below in conjunction with drawings and Examples, the present invention is described in more detail.
Fig. 1 is dPCR electro-chemical detection device longitudinal section of the present invention structural map.
Fig. 2 is dPCR electro-chemical detection device cover structure figure of the present invention.
Fig. 3 is dPCR Electrochemical Detection microelectrode structural map of the present invention.
Fig. 4 is dPCR Electrochemical Detection schema of the present invention.
Fig. 5 is that the present invention adopts electrochemical activity indicator to detect dPCR amplified production schematic diagram.
Fig. 6 is the impedance variations of the micro-reaction cabin having DNA profiling in embodiment 2 and do not have DNA profiling
Embodiment
See Fig. 1, Fig. 2, the invention provides a kind of dPCR Electrochemical Detection chip, its device comprises:
Upper cover 101, micro-reaction cabin array 102 and base 103.
The material of upper cover 101 is silica glass or other high temperature resistant mechanically resistant materials, comprises fluid inlet 106 and liquid outlet 107.
The macromolecular materials such as silicon, metal or SU-8 utilize the method such as chemical corrosion, ion etching preparation feedback cabin 102, a large amount of micro-reaction cabin 104 of micro-reaction cabin array 102 solid matter, and cross section is circular, square, hexagon etc.
The material of base 103 is silicon, silicon-dioxide etc., with reaction cabin 102 bonding.
Be positioned at the electrochemistry microelectrode 105 of base 103 upper surface, material is metal or the semiconductor material of the good biocompatibilities such as gold, platinum, apply to exchange or DC electric field to dPCR reaction system, to detect in pcr amplification process the dielectric parameter changes such as electromotive force, electric current, conductance, realize the detection by quantitative of dPCR amplified production.
In order to fully improve sensitivity and the accuracy of microelectrode detection system, the interdigital electrode that electrochemistry microelectrode of the present invention selects sensitivity high, and utilize the method such as chemical corrosion, laser burn to carry out roughened to electrode surface, also can grow one deck iridium oxide, Graphene or organic conductive polymer, form nanoporous or nanometer columnar structure, greatly increase electrode contact area, improve detection sensitivity further.The interdigital electrode matched can be designed, as square interdigital electrode 301 and circular interdigital electrode 302 (see Fig. 3) for difform micro-reaction cabin.
DPCR reaction system cumulative volume is 20 μ L, specifically composed as follows: 10.0 μ L (2X) Mix reagent (comprise Taq enzyme, dNPTs, MgCl
2deng), upstream primer 0.6 μ L (10mM), downstream primer 0.6 μ L (10mM), the template 1.0 μ L (ensureing no more than one of micro-reaction cabin template copy numbers of more than 50%) fully after dilution, 7.8 μ LH
2o.Three-step approach dPCR thermal circulation parameters is 95 DEG C of denaturation 5min, 95 DEG C of sex change 15s, and 58 DEG C of annealing 30s, 72 DEG C extend 45s, carry out 40 circulations altogether, wherein, have micro-reaction cabin of template to carry out pcr amplification, do not have micro-reaction cabin of template as a control group.
As shown in Figure 4, the present invention adds certain density daunomycin 401 in dPCR system, forms mixture 402 and loses electroactive, act on faint with single stranded DNA (ssDNA) with double-stranded DNA (dsDNA).The daunomycin dissociated along with the carrying out of dPCR reaction reduces gradually, and mixture 402 increases gradually.When utilizing Differential Pulse Voltammetry (DPV) to scan reaction system, current signal amplitude 403 also synchronously weakens, can indirect quantification dPCR amplified production amount, and sensitive and accurate, immunity from interference is strong.
As shown in Figure 5, Electrochemical Detection dPCR amplified production operating process of the present invention is as follows:
Step 501: first fill micro-reaction cabin with the BSA solution that massfraction is 0.2%, soaks 1 hour, reduces reaction cabin internal surface to the absorption of PCR reagent, sample template, improves reaction efficiency and the detection accuracy of dPCR;
Step 502: utilize Micropump that BSA solution extraction is clean, and dPCR reagent is injected micro-reaction cabin, then seal liquid inlet and outlet with mineral oil, paraffin oil or PDMS, prevent the volatilization of reagent in temperature cycle process;
Step 503: carry out thermal cycling, has micro-reaction cabin of template to carry out pcr amplification, does not have micro-reaction cabin of template as a control group.PCR thermal circulation parameters is 95 DEG C of denaturation 5min, 95 DEG C of sex change 15s, 58 DEG C of annealing 30s, and 72 DEG C extend 45s, carry out 40 circulations altogether;
Step 504: apply alternating-electric field (AC) to dPCR reaction system by microelectrode, range of frequency is 0.1Hz-50MHz, intensity (Vrms) scope is 1mV-30V, also can apply DC electric field (DC) if desired, and detect change in electric in PCR reaction process;
Step 505: statistics completes micro-reaction cabin number of dPCR amplification, and calculates the ratio that it accounts for total reaction cabin number, utilizes the former concentration of specimens of Poisson's distribution accurate quantitative analysis.
The preparation of embodiment 1dPCR Electrochemical Detection chip
1. select single-sided polishing, thickness to be 400500 μm, <100> crystal orientation, N-type silicon chip, and to clean up.
2. deposit at front side of silicon wafer PECVD the SiO that a layer thickness is 500nm
2film.
3. the uniform photoresist material of spin coating last layer (photoresist material model AZ4620) on silicon chip silicon dioxide film, photoresist spinner rotating speed is 5000RPM, and the thickness of glue is approximately 4-6 μm.
4. photoetching, forms interdigital electrode figure.
5. develop, chemical development liquid dissolves the photoresist material of exposure area.
It is that the Ti/Au of 100/300nm is as conductive layer that 6.PECVD deposits a layer thickness.
7. acetone removes photoresist material, and alcohol flushing, peels off the metal level in non-electrode region, completes interdigital electrode preparation.
8. spin coating one deck SU-8 photoresist material again, thickness 100 μm.
9. optical graving is for circular micro-reaction cabin, diameter 200 μm, and reaction cabin array is 100 × 100.
10. going up cover material is silica glass, and bench drill etching diameter is fluid inlet and the liquid outlet of 1mm.
11. plasma bombardment 30s, are bonded together upper cover (silica glass) and micro-reaction cabin, complete the preparation of dPCR chip.
The electrochemical chip of embodiment 2 plasmid DNA 129bp detects
The dPCR Electrochemical Detection chip adopting embodiment 1 to prepare detects, and concrete steps are as follows:
1. first fill micro-reaction cabin with the BSA solution that massfraction is 0.2%, soak 1 hour, reduce reaction cabin internal surface to the absorption of PCR reagent, sample template, improve reaction efficiency and the detection accuracy of dPCR;
2. utilize Micropump that BSA solution extraction is clean, and dPCR reagent is injected micro-reaction cabin, then seal liquid inlet and outlet with paraffin oil, prevent the volatilization of reagent in temperature cycle process;
3. inject dPCR reaction reagent, reagent system cumulative volume is 20 μ L, specifically composed as follows: 10.0 μ L (2X) Mix reagent (comprise Taq enzyme, dNPTs, MgCl
2deng), upstream primer 0.6 μ L (10mM), downstream primer 0.6 μ L (10mM), (template is the plasmid DNA 129bp comprising biotin acceptor polypeptide gene to template 1.0 μ L after abundant dilution, concrete sequence is gatatcgtcgacatggctcagcgtctgttccacatcctggacgctcagaaaatcga atggcacggtccgaaaggtggttctccatggctgcagtctagaggatccgaattcg agctcgatgacaagctt), 7.8LH
2o.
5. carry out dPCR thermal cycling, three-step approach parameter is 95 DEG C of denaturation 5min, 95 DEG C of sex change 15s, 58 DEG C of annealing 30s, 72 DEG C extend 45s, carry out 40 circulations altogether, wherein, there is micro-reaction cabin of template to carry out pcr amplification, there is no micro-reaction cabin of template as a control group.
6. apply alternating-electric field (AC) by microelectrode to dPCR reaction system at Thermal Cycling, range of frequency is 05MHz, and intensity (Vrms) scope is 10mV simultaneously, and detects the change of PCR reaction process middle impedance;
7. have DNA profiling and do not have DNA profiling micro-reaction cabin impedance variations as shown in Figure 6, the micro-reaction cabin resistance value that dPCR reaction occurs increases, and the resistance value not carrying out the negative control group of dPCR reaction almost remains unchanged.
8. the dPCR end point determination result Poisson statistics method process will obtained, then go out the absolute quantity of template molecule according to the volume computing of template molecule concentration, extension rate and micro-reaction cabin in reaction system.According to Poisson's distribution formula P (x=k)=(e
-λλ
k)/k! , each micro-reaction cabin, the quantity that namely in parallel PCR reaction, template molecule is assigned randomly to is stochastic variable x (x gets nonnegative integral value), then get k value for (0,1,2...).The target of digital pcr is Single Molecule Detection, and therefore getting x value is 1, obtains formula λ=-ln (1-P), and wherein λ is the average number of template DNA molecule in all parallel PCR answer, and P is the ratio of positive end-point reaction in all parallel PCR reactions.By λ, then according to each parallel volume of PCR reaction and the number of all parallel reactors, the absolute concentration of target dna molecule can be calculated.
The above; be only the embodiment in the present invention, but protection scope of the present invention is not limited thereto, any people being familiar with this technology is in the technical scope disclosed by the present invention; the conversion that can expect easily or replacement, all should be encompassed within protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain of claims.
Claims (5)
1. a chip for Electrochemical Detection dPCR amplified production, it is made up of upper cover, micro-reaction cabin array, electrochemistry microelectrode and base, comprises fluid inlet and liquid outlet upper covering; Described electrochemistry microelectrode is positioned at base upper surface;
Described upper cover material is silica glass;
Described micro-reaction cabin array by utilizing chemical corrosion or ion etching process preparation, a large amount of micro-reaction cabin of micro-reaction cabin array solid matter on silicon, metal or SU-8, and its cross section is circular, square or hexagon; The material of base is silicon or silicon-dioxide;
Described electrochemistry microelectrode is metal interdigital electrode, and utilizes chemical corrosion or laser burn method to carry out roughened to electrode surface, or at surface growth one deck iridium oxide, Graphene or organic conductive polymer, forms nanoporous or nanometer columnar structure;
The metal of described interdigital electrode is gold or titanium, and the specification of interdigital electrode is high 0.1 ~ 0.6 μm, and wide 0.1 ~ 15 μm, spacing is 0.1 ~ 15 μm.
2. the method adopting chip described in claim 1 to carry out Electrochemical Detection dPCR amplified production, it is characterized in that, sample of nucleic acid is fully diluted and injects micro-reaction cabin array, inject no more than 1 of the To Template number of each micro-reaction cabin, apply to exchange or DC electric field to the microelectrode be positioned at bottom micro-reaction cabin while carrying out dPCR amplification, detect change in electric in dPCR amplification procedure.
3. method according to claim 2, wherein while sample of nucleic acid fully being diluted the micro-reaction cabin array of injection, in dPCR system, add electrochemistry indicator, described electrochemistry indicator is any one or multiple combination in ferrocene, methylene blue, Hoechst33258, daunomycin, curcumine and Schuttgelb.
4. method according to claim 2, wherein applying electric field is alternating-electric field, and range of frequency is 0.1Hz ~ 50MHz, and strength range is 1mV ~ 30V.
5. method according to claim 2, wherein before detecting, fills micro-reaction cabin with the BSA solution that massfraction is 0.2%, soaks 1 hour, reduces reaction cabin internal surface to the absorption of PCR reagent, sample template.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510043438.2A CN104611223B (en) | 2015-01-28 | 2015-01-28 | The chip of Electrochemical Detection dPCR amplified production and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510043438.2A CN104611223B (en) | 2015-01-28 | 2015-01-28 | The chip of Electrochemical Detection dPCR amplified production and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611223A CN104611223A (en) | 2015-05-13 |
| CN104611223B true CN104611223B (en) | 2016-02-10 |
Family
ID=53145876
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510043438.2A Active CN104611223B (en) | 2015-01-28 | 2015-01-28 | The chip of Electrochemical Detection dPCR amplified production and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611223B (en) |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3402745B1 (en) * | 2015-12-23 | 2023-07-26 | The Regents of the University of California | Nano-sensors for nucleic acid detection and discrimination |
| CN105713824A (en) * | 2016-03-30 | 2016-06-29 | 华东医药（杭州）基因科技有限公司 | Special biological chip for droplet digital PCR (polymerase chain reaction) |
| CN106148509A (en) * | 2016-06-01 | 2016-11-23 | 山东省食品药品检验研究院 | The meat detection technique of a kind of animal derived materials and method |
| CN108456622B (en) * | 2018-01-26 | 2022-03-11 | 深圳市博瑞生物科技有限公司 | Data storage method and device |
| CN110819522B (en) * | 2018-08-13 | 2023-09-22 | 上海新微技术研发中心有限公司 | Digital PCR system and digital PCR liquid drop forming method |
| CN110819523B (en) * | 2018-08-13 | 2023-08-29 | 上海新微技术研发中心有限公司 | Digital PCR system and digital PCR liquid drop forming method |
| CN109536384B (en) * | 2018-12-24 | 2022-02-18 | 中国科学院上海微系统与信息技术研究所 | Digital PCR system for rapid absolute quantification of nucleic acid and application thereof |
| CN110184184B (en) * | 2019-05-07 | 2022-03-11 | 浙江正合谷生物科技有限公司 | Preparation method and application of nucleic acid reactor integrating nucleic acid extraction, enrichment and in-situ amplification |
| CN112239719A (en) * | 2019-07-19 | 2021-01-19 | 成都万众壹芯生物科技有限公司 | Digital PCR amplification device based on micropore array chip and method for amplifying by using same |
| CN114058686A (en) * | 2021-11-17 | 2022-02-18 | 东南大学 | Digital PCR chip based on impedance detection and detection method thereof |
| CN114632559B (en) * | 2022-01-26 | 2023-03-31 | 浙江大学 | On-chip micro-groove array digital PCR chip based on electrical impedance detection and manufacturing method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1605861A (en) * | 2004-11-15 | 2005-04-13 | 东南大学 | Preparation and detection method for electrochemical quantitative polymerase chain reaction detecting chip |
| CN102899244A (en) * | 2012-09-27 | 2013-01-30 | 中国科学院半导体研究所 | Solid phase-digital PCR (Polymerase Chain Reaction) chip and method for fabricating solid phase-digital PCR chip |
-
2015
- 2015-01-28 CN CN201510043438.2A patent/CN104611223B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1605861A (en) * | 2004-11-15 | 2005-04-13 | 东南大学 | Preparation and detection method for electrochemical quantitative polymerase chain reaction detecting chip |
| CN102899244A (en) * | 2012-09-27 | 2013-01-30 | 中国科学院半导体研究所 | Solid phase-digital PCR (Polymerase Chain Reaction) chip and method for fabricating solid phase-digital PCR chip |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611223A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104611223B (en) | The chip of Electrochemical Detection dPCR amplified production and method | |
| Shekar et al. | Measurement of DNA translocation dynamics in a solid-state nanopore at 100 ns temporal resolution | |
| Yuan et al. | Ratiometric electrochemical assay for sensitive detecting microRNA based on dual-amplification mechanism of duplex-specific nuclease and hybridization chain reaction | |
| Sanghavi et al. | Ultrafast immunoassays by coupling dielectrophoretic biomarker enrichment in nanoslit channel with electrochemical detection on graphene | |
| Congur et al. | Impedimetric detection of microRNA at graphene oxide modified sensors | |
| Wang et al. | Numerous long single-stranded DNAs produced by dual amplification reactions for electrochemical detection of exosomal microRNAs | |
| CN103645229B (en) | Array for bacterial detection multiple galvanochemistry constant-temperature amplification chip and preparation method thereof | |
| JP6271076B2 (en) | Target nucleic acid detection method, assay kit, and probe immobilization substrate | |
| CN102262118A (en) | Bioelectrochemical sensor for detecting tumor markers and preparation method thereof | |
| CN108226141A (en) | A kind of development and its application of the Ag nano-cluster Electrochemiluminescsensor sensors based on fabricated in situ | |
| Ghoreishi et al. | Fabrication of a graphene oxide nano-sheet modified electrode for determination of dopamine in the presence of tyrosine: A multivariate optimization strategy | |
| Tang et al. | Dual-signal amplification strategy for miRNA sensing with high sensitivity and selectivity by use of single Au nanowire electrodes | |
| Xiang et al. | Sensitive detection of microRNAs using hemin/G-quadruplex concatamers as trace labels and RNA endonuclease-aided target recycling for amplification | |
| Xia et al. | Label-free electrochemical sensor for MicroRNAs detection with ferroceneboronic acids as redox probes | |
| CN104152449A (en) | MiRNA capture probe, modifying electrode thereof, capture probe complementary strand, capture probe complementary strand modified carbon nanotube-gold magnetic nanoparticle compound | |
| CN108445067B (en) | Double-signal enzyme-free signal amplification RNA nano biosensor, preparation method and application thereof | |
| Zhang et al. | Peptide-modified nanochannel system for carboxypeptidase B activity detection | |
| CN103743801A (en) | Droplet-microfluidic-based preparation method of platinum black-modified electrode biosensor and application thereof | |
| Ferrario et al. | Development of a disposable gold electrodes-based sensor for electrochemical measurements of cDNA hybridization | |
| CN104777199A (en) | Nanometer material-based miniaturized electrochemical insulin sensor and preparation method thereof | |
| Kuche-Meshki et al. | A sensitive electrochemical genosensor for measuring gastric cancer biomarker, microRNA-106b, based on asparagine polymerization on carbon quantum dots modified electrode | |
| Ye et al. | Sensitive electrochemiluminescent detection of telomerase activity based on nicking enzyme assisted signal amplification | |
| CN104297314A (en) | Preparation method of electrochemical bladder cancer DNA sensor | |
| CN108490046B (en) | Electrochemical sensor for rapidly detecting unstable substances and method for rapidly and quantitatively detecting ATP (adenosine triphosphate) by using electrochemical sensor | |
| CN104316705B (en) | A kind of hybridization indicator 5, preparation method and the purposes of 7-dinitro-2-sulfo group-acridone |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Li Zhao Inventor after: Sun Yingnan Inventor after: Yang Ling Inventor after: Jiang Lijuan Inventor after: Liu Wenwen Inventor after: Zhang Xuelian Inventor after: Yu Yude Inventor before: Li Zhao Inventor before: Sun Yingnan Inventor before: Yang Ling Inventor before: Jiang Lijuan Inventor before: Liu Wenwen Inventor before: Yu Yude |
|
| COR | Change of bibliographic data | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |