CN104593498A - Marker, primer, kit and identifying method for cordate houttuynia molecular identification - Google Patents
Marker, primer, kit and identifying method for cordate houttuynia molecular identification Download PDFInfo
- Publication number
- CN104593498A CN104593498A CN201510020435.7A CN201510020435A CN104593498A CN 104593498 A CN104593498 A CN 104593498A CN 201510020435 A CN201510020435 A CN 201510020435A CN 104593498 A CN104593498 A CN 104593498A
- Authority
- CN
- China
- Prior art keywords
- site
- base
- herba houttuyniae
- molecular identification
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a marker, a primer, a kit and an identifying method for cordate houttuynia molecular identification, and belongs to the field of plant molecular biology. The method comprises the following steps: comparing a DNA fragment amplified by PCR of a to-be-identified sample with a DNA bar code of cordate houttuynia plant by sequencing; identifying that the to-be-identified sample is cordate houttuynia when the similarity between an amplification product and a base sequence as shown in the cordate houttuynia DNA bar code is over 98%. The identifying method overcomes a technical problem that a sensory evaluation method is difficult to identify whether the cordate houttuynia is real or not, and especially can be used for quickly and effectively distinguishing the cordate houttuynia from counterfeit-species gymnotheca involucrate.
Description
Technical field
The invention belongs to field of plant molecular biology, particularly a kind of mark for Herba Houttuyniae Molecular Identification, primer, test kit and authentication method.
Background technology
Herba Houttuyniae (Houttuynia cordata Thunb) belongs to Saururaceae heartleaf houttuynia and belongs to, and is perennial root per nnial herb.Be commonly called as Herba Houttuyniae, hog snout hole, stinkweed, a kind of reed mentioned in ancient books grass etc., because of its cauline leaf rub with the hands broken after have a fish like smell, therefore named Herba Houttuyniae.Herba Houttuyniae not only young stem and leaf and subterraneous stem can do vegetables and eats, and complete stool can using fresh herb or dry be used as medicine again, it has formally been defined as one of resource of the great exploitation potential for its of " being medicine, is again food " by health ministry, day by day receive the concern of people.
Because sharply increasing the demand of Herba Houttuyniae both at home and abroad, make its source of goods not enough, once once there is adulterant in various places, minority lawless person mixes puppet and plays tricks, looks genuine with puppet, peddle counterfeit drug to seek exorbitant profit, in addition the personnel of some participation medicinal material circulation lack necessary discriminating knowledge or lack experience, and make Herba Houttuyniae mix adulterant and enter commodity circulation channel, had a strong impact on quality of medicinal material and clinical efficacy.
In the past mostly with morphological differences and anatomic characteristics such as terrestrial stem, subterraneous stem and blades, sometimes differentiate Herba Houttuyniae and mixed adulterant thereof in conjunction with physico-chemical analysis, but above authentication method one is the not competent former plant of personnel of non-this work of long campaigns and the qualification work of medicine; Two is waste time and energy, and precise Identification exists certain difficulty.In recent years, along with the development of Protocols in Molecular Biology, the DNA molecular embodying species inheritance has become effective analysis means of species identification.By DNA molecular feature, the research report that Herba Houttuyniae plant carries out taxonomy qualification is lacked at present to the nucleotide difference comparison information of true and false product, reliable molecular identificalion data can not be provided.DNA bar code utilizes the DNA fragmentation of one section of recognised standard in genome to carry out the new technology of precise Identification to species, it has easy and simple to handle, advantage accurately and rapidly, by the restriction of sample development stage (blade, seed, flower etc.), configuration of medicinal materials (crude drug or powder) and investigator's professional standards, there is stronger versatility.
But up to the present, also do not apply DNA bar code technology and molecular identificalion is carried out to Herba Houttuyniae, more there is no the report of the Special bar code of Herba Houttuyniae.The present invention utilizes DNA bar code technology to carry out Molecular Identification to Herba Houttuyniae by the selection of primer especially in a creative way.
Summary of the invention
The object of the invention is to overcome the defect existed in existing detection technique, provide a kind of mark for Herba Houttuyniae Molecular Identification, primer, test kit and authentication method from molecular level.The present invention will speed up the application of molecular marker assisted selection at Herba Houttuyniae and mixed adulterant authentication method thereof.
For a mark for Herba Houttuyniae Molecular Identification, sequence is as SEQ NO:1; Namely can be used as DNA bar code.
For a primer for Herba Houttuyniae Molecular Identification, sequence is as follows:
Forward sequence F:GTTATGCATGAACGTAATGCTC,
Reverse sequence R:CGCGCATGGATTCACAATCC.
For a test kit for Herba Houttuyniae Molecular Identification, comprise above-mentioned primer, and carry out all ingredients needed for PCR reaction.
All ingredients needed for PCR reaction comprises: 10 × Buffer, dNTP, MgCl
2, Taq DNA polymerase.
The described test kit for Herba Houttuyniae Molecular Identification also comprises sequencing reagent.
A kind of method for Herba Houttuyniae Molecular Identification: with above-mentioned nucleic acid molecule for primer, with the genomic dna of detected sample for template, carry out pcr amplification, the DNA fragmentation amplified is through order-checking, with the mark comparison of the Herba Houttuyniae Molecular Identification of sequence as shown in SEQ NO:1, when similarity reaches more than 98%, illustrate that sample to be identified is Herba Houttuyniae.
Amplification fragment out, for distinguishing Herba Houttuyniae and white luxuriant naked capsule, checks order by the method, sequence is as SEQ NO:1 and NO:2, the base of Herba Houttuyniae on site 46 is C, base on site 53 is T, base on site 88 and on 111 is all C, base on site 136 and 146 is all T, base on site 173 is G, base on the 187-188 of site is all TC, base on site 208 is G, base on site 277 and 279 is all A, and the base on site 297 is C, and the base on the 299-300 of site is TT, base on the 301-304 of site is TTCT, base on site 313 and 328 is T, and the base on site 334 is A, and the base on site 402 is T, and the base of white luxuriant naked capsule on site 46 is T, base on site 53 is C, base on site 88 and on 111 is all T, base on site 136 and 146 is all disappearance, base on site 173 is T, base on the 187-188 of site is disappearance, base on site 208 is T, base on site 277 and 279 is all G, base on site 297 is disappearance, base on the 299-300 of site is all disappearance, base on the 301-304 of site is all disappearance, base on site 313 is disappearance, base on site 328 is G, base on site 334 is G, base on site 402 is G.
PCR system comprises 10 × Buffer, 0.25mmol/L dNTP, 2.5mmol/L MgCL
2, 0.2U Taq DNA polymerase, 50ng template DNA, primer 0.2 μm of ol/L.
PCR reaction conditions: 97 DEG C of denaturation 4min → 30 circulations: comprise successively: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min and 72 DEG C of extension 1min → 72 DEG C extend 7min.
Sequence measurement:
Adopt the reaction system of 5 μ L, comprising: the order-checking mix of 1 μ L, the primer (namely PCR reacts the primer) of 0.5 μ L, the PCR purified product of 1 μ L and the distilled water of 2.5 μ L;
Response procedures is: 95 DEG C of denaturation 4min → 33 circulations: comprise 96 DEG C of sex change 10s, 50 DEG C of annealing 5s and 60 DEG C of extension 4min successively;
Sequencing reaction product is through 95% ethanol+sodium acetate precipitation, and use 70% ethanol, absolute ethanol washing afterwards, the distilled water adding 20 μ L after drying fully dissolves, and loading after 95 DEG C of sex change 4min, checks order.
Compared with conventional art, authentication method provided by the present invention: 1. overcome the true and false that prior art sense organ is difficult to differentiate Herba Houttuyniae raw material; 2. the Herba Houttuyniae DNA bar code by setting up, can make a distinction Herba Houttuyniae and other plant easily; 3. adopt Herba Houttuyniae chloroplast DNA the preceding paragraph intron region to be target fragment, the pcr amplification that the complicacy avoiding chromogene group is brought is successfully uncertain, and plant identification is more prone to; 4. by the PCR sequencing analysis of the Herba Houttuyniae chloroplast(id) DNA fragmentation to Different sources source, under finding Herba Houttuyniae and its section there is stable difference in other plant on sequence site, can distinguish them completely, thus the present invention can identify Herba Houttuyniae plant exactly; 5. the present invention utilizes high-efficient automatic technology to check order, and namely shortens experimental period and again reduces numerous and diverse artificial order-checking work, be easy to carry out normalized analysis to amplified sample, improve the reliability of data.
Accompanying drawing explanation
Fig. 1 is the amplification of primer pair specimen material;
Fig. 2 is that Herba Houttuyniae plant (right side) is compared with the form of the white luxuriant naked capsule (left side) of its mixed adulterant.
Embodiment
Following examples are intended to further illustrate the present invention, and unrestricted the present invention.
Embodiment 1: the process that the inventive method is implemented
(1) preparation of specimen material: get Herba Houttuyniae and its equal other plant young leaflet tablet about 10g respectively.
(2) extraction of genomic dna: utilize CTAB method to extract genomic dna, by cryodesiccated tobacco leaf grind into powder, add the CTAB extract of 65 DEG C of preheatings, 65 DEG C of insulation more than 45min, between or get supernatant liquor → add isopyknic chloroform after the centrifugal 20min of jog mixing → 12000r/min room temperature: primary isoamyl alcohol (24:1), mix more than 15min gently, the centrifugal 20min of 12000r/min room temperature, get supernatant liquor and to move in new centrifuge tube → add the Virahol of precooling, shake 5min gently, 95% ethanol of supernatant → precipitation 75% ethanol and 10mmol/L KAC extracting 2 ~ 3 times (the centrifugal 10min of each 8000r/min room temperature) → add precooling is removed after the centrifugal 10min of 8000r/min room temperature, turn upside down gently, ethanol is abandoned after the centrifugal 20min of 12000r/min room temperature, vacuum is drained or is naturally dried → add 200uL TE buffer, beat gently and make resolution of precipitate → add 1ul 10mg/mL RNAse 37 DEG C of water-baths, insulation 1h, remove RNA → DNA extraction thing be put in preserve in-20 DEG C of refrigerators for subsequent use.
(3) pcr amplification: be that template carries out SCAR-PCR amplification with leaves genomic DNA, PCR system comprises 10 × Buffer, 0.25mmol/L dNTP, 2.5mmol/L MgCL
2, 0.2U Taq DNA polymerase, 50ng template DNA, random primer 0.2 μm of ol/L.PCR reaction conditions: 97 DEG C of denaturation 4min → (DEG C annealing 1min → 72 DEG C, 94 DEG C of sex change 1min → 50 extend 1min) 30 circulations → 72 DEG C extend 7min.Wherein the primer is:
Forward sequence F:GTTATGCATGAACGTAATGCTC,
Reverse sequence R:CGCGCATGGATTCACAATCC.
(4) electrophoresis detection: the product after amplification carries out electrophoresis detection, all amplifies the band of about about 470bp.
(5) check order: amplimer is simultaneously as sequencing primer, and sequencing reaction carries out on PE9600PCR instrument, reaction system: 1 μ L order-checking mix, 0.5 μ L primer, 1 μ L PCR purified product and 2.5 μ L distilled waters.Response procedures is: 95 DEG C of denaturation 4min → (DEG C annealing 5s → 60 DEG C, 96 DEG C of sex change 10s → 50 extend 4min) totally 33 circulations.Reaction product is through 95% ethanol+sodium acetate precipitation, and use 70% ethanol, absolute ethanol washing afterwards, the distilled water adding 20 μ L after drying fully dissolves, loading after 95 DEG C of sex change 4min, and ABI3700 type automatic sequencer detects.
Embodiment 2: the inventive method implements the variance analysis of rear material DNA bar code
Apply primer pair material of the present invention and carry out pcr amplification, obtain the fragment that sequence length is respectively about 470bp, degree of variation very little (between 0.0%-0.16%) between the Herba Houttuyniae kind that this fragment is originated at Different sources, and informative site in Herba Houttuyniae plant species is very stable; And the degree of variation comparatively large (between 6.2%-9.1%) between planting, therefore this sequence is suitable as the bar code sequence of qualification Herba Houttuyniae plant, be easy to by Herba Houttuyniae and plant not of the same race as: white luxuriant naked capsule is differentiated to come.
Be more than the comparison of Herba Houttuyniae and the white luxuriant naked capsule base sequence amplified, the different piece of both shade representatives sequence, underscore is primer location.
Claims (10)
1. for a mark for Herba Houttuyniae Molecular Identification, it is characterized in that, sequence is as SEQ NO:1.
2. for a primer for Herba Houttuyniae Molecular Identification, it is characterized in that, sequence is as follows:
Forward sequence F:GTTATGCATGAACGTAATGCTC,
Reverse sequence R:CGCGCATGGATTCACAATCC.
3. for a test kit for Herba Houttuyniae Molecular Identification, it is characterized in that, comprise primer according to claim 2, and carry out all ingredients needed for PCR reaction.
4. the test kit for Herba Houttuyniae Molecular Identification according to claim 3, is characterized in that: all ingredients needed for PCR reaction comprises: 10 × Buffer, dNTP, MgCl
2, Taq DNA polymerase.
5. the test kit for Herba Houttuyniae Molecular Identification according to claim 3 or 4, is characterized in that: also comprise sequencing reagent.
6. the method for Herba Houttuyniae Molecular Identification, it is characterized in that: with nucleic acid molecule according to claim 2 for primer, with the genomic dna of detected sample for template, carry out pcr amplification, the DNA fragmentation amplified is through order-checking, with the mark comparison of the Herba Houttuyniae Molecular Identification of sequence as shown in SEQ NO:1, when similarity reaches more than 98%, illustrate that sample to be identified is Herba Houttuyniae.
7. the method for Herba Houttuyniae Molecular Identification according to claim 6, is characterized in that: amplification fragment out, for distinguishing Herba Houttuyniae and white luxuriant naked capsule, checks order by the method, sequence is as SEQ NO:1 and NO:2, the base of Herba Houttuyniae on site 46 is C, base on site 53 is T, base on site 88 and on 111 is all C, base on site 136 and 146 is all T, base on site 173 is G, base on the 187-188 of site is all TC, base on site 208 is G, base on site 277 and 279 is all A, and the base on site 297 is C, and the base on the 299-300 of site is TT, base on the 301-304 of site is TTCT, base on site 313 and 328 is T, and the base on site 334 is A, and the base on site 402 is T, and the base of white luxuriant naked capsule on site 46 is T, base on site 53 is C, base on site 88 and on 111 is all T, base on site 136 and 146 is all disappearance, base on site 173 is T, base on the 187-188 of site is disappearance, base on site 208 is T, base on site 277 and 279 is all G, base on site 297 is disappearance, base on the 299-300 of site is all disappearance, base on the 301-304 of site is all disappearance, base on site 313 is disappearance, base on site 328 is G, base on site 334 is G, base on site 402 is G.
8. the method for Herba Houttuyniae Molecular Identification according to claim 6, is characterized in that:
PCR system comprises 10 × Buffer, 0.25mmol/L dNTP, 2.5mmol/L MgCL
2, 0.2U Taq DNA polymerase, 50ng template DNA, primer 0.2 μm of ol/L.
9. the method for Herba Houttuyniae Molecular Identification according to claim 6 or 8, is characterized in that:
PCR reaction conditions: 97 DEG C of denaturation 4min → 30 circulations: comprise successively: 94 DEG C of sex change 1min, 50 DEG C of annealing 1min and 72 DEG C of extension 1min → 72 DEG C extend 7min.
10. the method for Herba Houttuyniae Molecular Identification according to claim 6 or 7, is characterized in that:
Sequence measurement:
Adopt the reaction system of 5 μ L, comprising: the order-checking mix of 1 μ L, the primer of 0.5 μ L, the PCR purified product of 1 μ L and the distilled water of 2.5 μ L;
Response procedures is: 95 DEG C of denaturation 4min → 33 circulations: comprise 96 DEG C of sex change 10s, 50 DEG C of annealing 5s and 60 DEG C of extension 4min successively;
Sequencing reaction product is through 95% ethanol+sodium acetate precipitation, and use 70% ethanol, absolute ethanol washing afterwards, the distilled water adding 20 μ L after drying fully dissolves, and loading after 95 DEG C of sex change 4min, checks order.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510020435.7A CN104593498A (en) | 2015-01-15 | 2015-01-15 | Marker, primer, kit and identifying method for cordate houttuynia molecular identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510020435.7A CN104593498A (en) | 2015-01-15 | 2015-01-15 | Marker, primer, kit and identifying method for cordate houttuynia molecular identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104593498A true CN104593498A (en) | 2015-05-06 |
Family
ID=53119549
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510020435.7A Pending CN104593498A (en) | 2015-01-15 | 2015-01-15 | Marker, primer, kit and identifying method for cordate houttuynia molecular identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593498A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200050A (en) * | 2015-10-26 | 2015-12-30 | 福建农林大学 | Molecular specific primers and method for identifying houttuynia cordata and whorlleaf stonecrop herb |
| CN115976261A (en) * | 2022-11-22 | 2023-04-18 | 安徽中医药大学 | DNA bar code of rubus plant and application thereof |
-
2015
- 2015-01-15 CN CN201510020435.7A patent/CN104593498A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| 冯毓秀: "三白草科4种植物、生药的鉴别", 《中药通报》 * |
| 陈士林: "中药材DNA条形码分子鉴定指导原则", 《中国中药杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105200050A (en) * | 2015-10-26 | 2015-12-30 | 福建农林大学 | Molecular specific primers and method for identifying houttuynia cordata and whorlleaf stonecrop herb |
| CN105200050B (en) * | 2015-10-26 | 2018-04-13 | 福建农林大学 | Differentiate the molecular specificity labeled primers and method of cordate houttuynia and Chinese gymnotheca herb |
| CN115976261A (en) * | 2022-11-22 | 2023-04-18 | 安徽中医药大学 | DNA bar code of rubus plant and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105861642B (en) | A kind of acipenser schrencki gender gap opposite sex molecular labeling and detection acipenser schrencki property method for distinguishing | |
| CN102888456B (en) | Method for quickly identifying pseudo-ginseng | |
| CN104004833B (en) | Based on EST-SSR core primers group and the application of the exploitation of sponge gourd transcript profile sequence | |
| CN106086167B (en) | The primer sequence and method of a kind of Rapid identification Larimichthys crocea, little yellow croaker and Collichthys lucidus | |
| CN104726564B (en) | A kind of primer sets, kit and its method for identifying different tobacco breds | |
| CN112980999B (en) | SSR molecular marker of mulberry variety Yuehei 74 and core primer group, kit and application thereof | |
| CN107090502B (en) | A kind of duplex PCR detection method for cordyceps sinensis authenticity | |
| Katz et al. | Taxonomic review and phylogenetic analysis of fifteen North American Entomobrya (Collembola, Entomobryidae), including four new species | |
| CN108034754A (en) | Differentiate the method for purple handsome new tea cultivar using SSR finger-prints | |
| CN108660246A (en) | One group of horse family's shaddock InDel molecular labeling and its application in Citrus Cultivars seedling early stage distinguishes tertia horse man shaddock | |
| CN105802960A (en) | Molecular marker and use thereof | |
| CN103937790B (en) | A kind of molecule marker of being closely related with Semen Brassicae campestris sulphur resources and application | |
| CN103667494A (en) | Detection method of sweet potato black rot pathogen | |
| CN101654709A (en) | Method for using sts primer to identify ginseng species | |
| CN104593498A (en) | Marker, primer, kit and identifying method for cordate houttuynia molecular identification | |
| CN105802962A (en) | Molecular marker and application thereof | |
| CN107022608A (en) | SNP marker and its application | |
| CN107475359A (en) | A kind of DNA bar code authentication method of integration of drinking and medicinal herbs medicinal material spina date seed and its mixed adulterant | |
| CN104593365B (en) | A kind of DNA bar code for cordate houttuynia Molecular Identification, primer, kit and authentication method | |
| CN103215365A (en) | DNA (Deoxyribonucleic Acid) molecular identification method for Luchuan pigs and meat products thereof | |
| CN106636411A (en) | Xyleborus sp insect gene barcode detection kit and detection method thereof | |
| CN109628599A (en) | ALK fusion gene detection and parting kit based on the analysis of sandwich method high-resolution fusion curve | |
| CN105132542A (en) | Method, primer and probe for identifying dalbergia latifolia among rosewood by aid of PCR (polymerase chain reaction) technologies | |
| CN105821128A (en) | SNP marker of medicinal plant murraya paniculata as well as identifying method and application thereof | |
| CN104673890B (en) | Cotton black aphid PCR quick determination methods based on specific SS COI primers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150506 |
|
| RJ01 | Rejection of invention patent application after publication |