CN104593393A - Formica sinensis AChE gene, formica sinensis AChE and preparation method thereof - Google Patents

Abstract

The invention belongs to the technical field of gene engineering, and in particular relates to a formica sinensis acetylcholin esterase (AChE) gene, encoded formica sinensis acetylcholin esterase (AChE) and a method for preparing the enzyme. The base sequence and the amino acid sequence of the formica sinensis AChE gene and the encoded formica sinensis AChE are as shown in a sequence list. The preparation method of the enzyme comprises the following steps: (1) constructing a formica sinensis AChE gene complete sequence and carrying out polymerase chain reaction (PCR) amplification; (2) constructing an eukaryotic expression recombinant vector of the formica sinensis AChE gene complete sequence; (3) converting a pichia pastoris host cell, cultivating and inducing expression; and (4) purifying. Experiments prove that the prepared formica sinensis AChE, compared with the existing drosophila melanogaster AChE, is higher in activity and sensitivity; therefore, the formica sinensis AChE has a relatively good application prospect in the technical field of future pesticide detection reagent preparation.

Description

Red woods ant AChE gene, red woods ant AChE and preparation method thereof

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of red woods ant acetylcholinesterase (AChE) gene, coded red woods ant acetylcholinesterase (AChE), prepare the method for this enzyme.

Background technology

Present global environmental pollution especially pesticidal contamination is day by day serious, can detect pesticide residue fast, easily especially aobvious urgent.Most agricultural chemicals is organophosphorus and amino formate, is applied to the production of all kinds of farm crop in a large number.But this type of agricultural chemicals causes severe contamination to environment, poisons people and animals, develops sensitive Monitoring Pesticide Residues fast and has important sincere justice for this reason.

The wider detection pesticide residue method of current utilization is the inhibited reaction utilizing acetylcholinesterase (achetylcholinesterase, AChE) and organophosphorus and carboxylamine class agricultural chemicals, by the method for Spectrophotometric Assays come quantitative pesticide residue number.This method have cost low, detect soon, relatively sensitive advantage, be suitable for the residual detection demand of agriculture in a big way.Therefore, the core reagent raw material of the residual detection kit of agriculture---namely the preparation of acetylcholinesterase becomes the key of technology.

Using genetic engineering means to prepare AChE with pichia spp eukaryotic expression system is mainstream development trend.In prior art, though have in a large number about research and the report of the eukaryotic expression system that utilizes studies of acetylcholinesterasegenes genes from insects to prepare, due to the sensitivity of agricultural chemicals still not too rationality, thus still to be modified.And up to the present, there is not yet the relevant research report of the acetylcholinesterasegene gene about utilizing red woods ant and the eukaryotic expression system that utilizes it to prepare.

Summary of the invention

The object of the invention is to provide a kind of red woods ant acetylcholinesterase (AChE) gene, coded red woods ant acetylcholinesterase (AChE), prepares the method for this enzyme, in brief, the object of the invention is that providing a kind of utilizes red woods ant acetylcholinesterasegene gene and utilize the pichia spp eukaryotic expression system constructed by this gene, utilize this system to express the red woods ant acetylcholinesterase obtained and may be used for preparation Detecting Pesticide test kit, thus realize the application in pesticide residue reagent context of detection.

The technical solution used in the present invention is as follows.

Red woods ant acetylcholinesterase (AChE) gene, base sequence is as shown in sequence 1.

The red woods ant acetylcholinesterase (AChE) of red woods ant acetylcholinesterase (AChE) coded by said gene, its aminoacid sequence is as shown in sequence 2.

The preparation method of described red woods ant acetylcholinesterase (AChE), comprises the following steps:

(1) build also pcr amplification red woods ant acetylcholinesterase (AChE) gene complete sequence, specifically comprise the following steps:

1, extract total serum IgE, reverse transcription obtains cDNA;

2, red woods ant acetylcholinesterase (AChE) gene conserved sequence is obtained;

Primer sequence design is as follows:

U-ACHE-F：GGTTCGAGGGAGAGGAGATGTGGAA，

U-ACHE-R：CCGTGCATCACTCCCATCCATTC；

With red woods ant cDNA for template, with designed U-ACHE-F and U-ACHE-R for primer, pcr amplification goes out the conserved sequence of the acetylcholinesterasegene gene of red woods ant;

3, the 3 ' end and 5 ' of red woods ant acetylcholinesterase (AChE) gene holds amplification;

Design 3 ' end and 5 ' holds special primer, and primer sequence design is as follows:

3`GSP-Outer:CACGCAGAGGACGAGTACCAACGTA，

3`GSP-Inner:GAATATGTCACAAATCGAGCGAGAAGCC；

5`GSP-Outer:GACGCTTAGTGAAGTATCGCCTGCA，

5`GSP-Inner: GAGATGTTGGTGTTTGGGTTCCACA。

3 ' end of pcr amplification red woods ant acetylcholinesterasegene gene and 5 ' end gene fragment;

4, pcr amplification red woods ant acetylcholinesterase (AChE) gene complete sequence;

According to known red woods ant acetylcholinesterasegene gene (AChE) gene complete sequence design primer, design of primers object is the restriction enzyme site introducing restriction enzyme EcoRI and NotI, design of primers sequence following (in sequence, underscore part is restriction enzyme site):

FF：TCA GAATTCATGAGTTTTTGGATGAATTGTCCGTC，

FR：CAA GCGGCCGCCCCTGTGTATGCGAATTGCGAGAA；

Carry out pcr amplification with 3 ' end of step 2 gained red woods ant acetylcholinesterasegene gene (AChE) gene conserved sequence, step 3 gained red woods ant acetylcholinesterase (AChE) gene and 5 ' end for template, obtain red woods ant acetylcholinesterasegene gene (AChE) gene complete sequence (i.e. red woods ant acetylcholinesterasegene gene (AChE) coding region open reading frame);

(2) red woods ant acetylcholinesterasegene gene (AChE) complete sequence constructed by step 1 is utilized to build recombinant eukaryotic expression plasmid;

The carrier for expression of eukaryon adopted is pPICZ α A, and this carrier is the efficient expression vector of expression 6 × His label, and this carrier has many restriction enzyme sites simultaneously, is easy to insert exogenous genetic fragment as red woods ant acetylcholinesterase (AChE) gene coded sequence;

(3) the eukaryon recombinant plasmid expression vector conversion constructed by step 2 is entered pichia spp host cell, cultivate, abduction delivering red woods ant acetylcholinesterase (AChE);

Enter pichia spp X33 competence bacterial strain by electroporated for constructed eukaryon recombinant plasmid expression vector, screening positive strain, amplification cultivation, methanol induction red woods ant acetylcholinesterase (AChE) is expressed;

(4) the purifying of red woods ant acetylcholinesterase (AChE);

Due to the adopted specific expressed 6 × His label of carrier for expression of eukaryon pPICZ α A, the red woods ant acetylcholinesterase (AChE) of purifying thus can be obtained further by Ni-NTA His-Bind Resins post.

The application of described red woods ant acetylcholinesterase (AChE) in pesticide residue, described agricultural chemicals is organophosphorus or carbamate chemicals for agriculture.

Red woods ant ( formica cinae), belong to Formicinae (Formicinae) ant and belong to (Fomicia), take episite as food, be extensively distributed in the northern area of China.The present invention, by by being transformed in pichia spp after red woods ant acetylcholinesterasegene gene clone, restructuring, adding methanol induction, obtaining target protein acetylcholinesterase, for the residue detection of agricultural-food Pesticides.Prove by experiment, the red woods ant acetylcholinesterase prepared by the present invention has higher activity and sensitivity compared to existing fruit bat acetylcholinesterase, thus has good application prospect at the Pesticides Testing reagent preparing technical field in future.

Accompanying drawing explanation

Fig. 1 is that the enzyme of recombinant plasmid is cut and PCR qualification figure, in FIG, and M:DNA Maker (DL 5000); 1,2: recombinant plasmid EcoRI and NotI double digestion result; 3,4: recombinant plasmid PCR qualification result.

Fig. 2 is that eukaryon recombinant plasmid expression vector is converted into different steps electrophorogram after pichia spp X33; M in figure: low molecular weight protein (LMWP) Maker; 1: methanol induction expresses restructuring red woods ant acetylcholinesterase (AChE) of rear purifying, supernatant protein in 2: pichia spp X33 fermented liquid, 3: supernatant protein in the fermented liquid of non-abduction delivering, 4: unpurified supernatant protein after methanol induction.

Embodiment

Below in conjunction with embodiment the present invention will be further explained explanation.

Before introducing specific embodiment, first briefly introduce as follows to key instrument equipment used in the present invention and reagent.

Major equipment: table model high speed centrifuge (Hunan Xiang Yi Laboratory Instruments development corporation, Ltd., H1650-W);

Electrophoresis apparatus (Liuyi Instruments Plant, Beijing, DYY-7C type), PCR instrument (TAKARA BIO INC, D-8707);

Ultraviolet device (Liuyi Instruments Plant, Beijing, DWD-9403C type);

Constant temperature culture oscillator (Shanghai ZHICHENG Anaiytical Instrument Manufacturing Co., Ltd., ZWY-2012C);

Bio-Rad MicroPulser(Beijing friend Hua Zhaoqin Medical Devices Co., Ltd., Micro Pulser);

CL-B eight passage remains of pesticide determinator (Shanghai Bona New Technology Research Institute, CL-B eight passages).

Main agents: Mollusc RNA Kit (OMEGA, R6875-00);

Prime Script ^TM 1st strand cDNA Synthesis kit(TaKaRa,6210A)；

3`-Full RACE CoreSet(TaKaRa,D314)；

5`-Full RACE CoreSet (TaKaRa,D315)；

TaKaRa MiniBEST Plasmid Purification Kit Ver.4.0(TaKaRa,9760)；

T4 DNA ligase enzyme (Niu Yinglun biotechnology (Beijing) company limited, M0202);

Yeast powder (Tianjin Ke Miou chemical reagent company limited);

Peptone (Beijing extensive and profound in meaning star biotechnology limited liability company);

Methyl alcohol (Tianjin Fengchuan Chemical Reagent Science & Technology Co., Ltd.);

S-Acetylthio vagusstoff, 96%(Alfa Aesar, A Johnson Mathey Company, A16802);

DTNB (raw work is biological, D8350);

Acetylcholinesterase (housefly) (in Beijing Sheng Ruitai Science and Technology Ltd., 9000-81-1);

Malathion, methidathion, Volaton, acephate are Pesticides Testing standard substance (Shanghai

Pesticide research institute, SPL-BA-017, SPL-BA-022, SPL-BA-009, SPL-BA-011).

Bacterial strain and carrier:

E. coli competent E.coli JM109(TaKaRa, 9052);

PMD ^TM19-T Vector Cloning Kit（TaKaRa，6013）；

Pichia spp Pichia pastoris X33 (Invitrogen, K1740-01);

Yeast expression carrier pPICZ α A (Invitrogen, K1740-01).

Experiment material:

Red woods ant, in September, 2013 has drawn from Henan Province's Jiaozuo City Yuntai Shan Mountain.

Embodiment

Red woods ant acetylcholinesterase (AChE) gene, base sequence is as shown in sequence table SEQ ID NO.1.

The red woods ant acetylcholinesterase (AChE) of red woods ant acetylcholinesterase (AChE) coded by said gene, its aminoacid sequence is as shown in sequence table SEQ ID NO.2.

The know-why preparing red woods ant acetylcholinesterase is: utilize recombinant DNA technology that red woods ant acetylcholinesterasegene gene is cloned into carrier for expression of eukaryon, and make its great expression in pichia spp, be further purified and can obtain its expression product acetylcholinesterase.

The preparation method of red woods ant acetylcholinesterase, specifically comprises the following steps:

1, also pcr amplification red woods ant acetylcholinesterase (AChE) gene complete sequence is built

(1) extract total serum IgE, reverse transcription obtains cDNA

a. total serum IgE is extracted,using the red woods ant of the Taihang mountain range of catching as experiment material, extract total serum IgE according to Moluse RNA kit experimental procedure; Extraction step is specific as follows:

A. get red woods ant head about 50 mg, liquid nitrogen grinding, go to 1.5 mL EP and manage in (RNase-free), add 1 mL RNA-Solv reagent vortex to red woods ant head abrasive material agglomerate of exerting oneself and all dissolve, incubated at room 3 min;

B. add 0.2 mL chloroform, firmly mixing 15 s, room temperature places 3 min; 4 DEG C, 12000 × g centrifugal 15 min, RNA are dissolved in the upper strata aqueous phase of low phenol chloroform phase completely;

C. be transferred in new centrifuge tube by the aqueous phase being no more than 80 %, add isopyknic Virahol, mixing, room temperature leaves standstill 10 min; 4 DEG C, centrifugal 3 min of 12000 × g, abandon supernatant (inversion drains raffinate);

D.100 μ L aseptic DEPC water (being preheated to 65 DEG C) is resuspended; Add 350 μ L Buffer RB(2-mercaptoethanols) and the mixing of 250 μ L dehydrated alcohols, mixed solution is transferred to HiBind RNA Column; Centrifugal 30 s of room temperature 10000 × g, abandon supernatant; Add 500 μ L RNA Wash Buffer, centrifugal 30 s of 10000 × g, abandon supernatant;

E. centrifugal adsorbing column is placed on a new collection tube (2 mL), adds 400 μ L RNA WashBuffer , centrifugal 30 s of 10000 × g, abandon supernatant, and repeat once, and blank pipe is (20000 × g) centrifugal 2 min at full speed, dry residual liquid;

F. centrifugal adsorbing column being moved to 1.5 new mL EP manages on (RNase-free), with the aseptic DEPC water elution of 40 μ L, and centrifugal 1 min at full speed; Obtain red woods ant total serum IgE 40 μ L ,-80 DEG C save backup.

.RNA reverse transcription becomes cDNA,utilize Prime Script ^tM the red woods ant RNA reverse transcription that steps A is extracted by 1st strand cDNA Synthesis kit becomes cDNA.Specifically comprise the following steps:

A. in EP pipe, following reaction solution is added:

Oligo dT Primer(50 μM )，1 μL；

dNTP Mixture (10mM each)，1 μL；

Red woods ant RNA, 4 μ g;

RNase free dH ₂o to 10 μ L.

65 DEG C of insulation 5min, then cool rapidly on ice.

B. in EP pipe, following reaction solution is added again:

5×PrimerScript Buffer，4μL；

RNase Inhibitor (20U)，0.5 μL(40 U/μL)；

PrimerScript RTase (200U)，1μL (200 U/μL)；

Reaction solution after sex change in step a, 10 μ L;

RNase free dH ₂o adds to 20 μ L.

C. slowly mix, by following condition reverse transcription: 42 DEG C, 60min, 70 DEG C, 15min; Cooled on ice after reaction, obtain 20 μ L 1st cDNA ,-20 DEG C of preservations are stand-by.

(2) acquisition of red woods ant acetylcholinesterase (AChE) gene conserved sequence

design primer, pcr amplification: with reference to other studies of acetylcholinesterasegenes genes from insects in GenBank, design the PCR universal primer of red woods ant AchE gene conserved sequence, primer sequence design is as follows:

U-ACHE-F：GGTTCGAGGGAGAGGAGATGTGGAA，

U-ACHE-R：CCGTGCATCACTCCCATCCATTC。

Primer is synthesized by Jin Weizhi (Beijing) bio tech ltd to be provided.

With the red woods ant of gained in step B cDNA for template, with designed U-ACHE-F and U-ACHE-R for primer, pcr amplification goes out the conserved sequence of the acetylcholinesterasegene gene of red woods ant.

Pcr amplification program is: 95 DEG C of denaturation 5 min; 95 DEG C of sex change 0.5 min, 60 DEG C of annealing 0.5 min, 72 DEG C extend 1.5 min, totally 32 circulations; 72 DEG C extend 7min.

PCR product is cut glue by 1% agarose gel electrophoresis and is reclaimed.

construction recombination plasmid:be connected with pMD-19T carrier by the red woods ant acetylcholinesterase AchE gene conserved sequence of pcr amplification in step (2), construction recombination plasmid, concrete steps are as follows:

A. by cut in step (2) glue reclaim after the red woods ant acetylcholinesterase AchE gene order of pcr amplification be connected with pMD-19T carrier, linked system is as follows:

pMD 19-T Vector，1 μL；

Insert DNA(and step (2) are cut glue and are reclaimed product), 2 μ L;

DdH ₂o adds to 5 μ L and mixes;

Then Solution is added, 5 μ L.

Linked system cumulative volume 10 μ L.16 DEG C of reactions are spent the night.

B. heat shock method will connect product conversion to E. coli JM109, and coating LB is dull and stereotyped, cultivate 10 ~ 12 h for 37 DEG C.

C. picking positive colony carries out bacterium colony PCR qualification and EcoRI and Hind double digestion qualification (qualification result is shown in Fig. 1), identifies that correct bacterial strain extracts plasmid and to check order further qualification, checks order to be completed by Jin Weizhi (Beijing) bio tech ltd.

Double digestion identification system is as follows:

EcoRI，0.5 μL；

Hind ，0.5 μL；

10×NEB Buffer 4，5 μL；

100×BSA，0.2 μL；

Containing positive recombinant plasmid liquid after screening, 4 μ L; ,

DdH ₂o adds to 20 μ L.

37 DEG C of reaction 3.5h.

(3) 3 ' end and 5 ' of red woods ant acetylcholinesterase (AChE) gene holds amplification

design primer, pcr amplification: according to woods ant AchE conserved sequence sequencing fragment result red in step (2), design 3 ' end and 5 ' holds special primer, and primer sequence design is as follows:

3`GSP-Outer:CACGCAGAGGACGAGTACCAACGTA，

3`GSP-Inner:GAATATGTCACAAATCGAGCGAGAAGCC；

5`GSP-Outer:GACGCTTAGTGAAGTATCGCCTGCA，

5`GSP-Inner: GAGATGTTGGTGTTTGGGTTCCACA。

Primer is synthesized by Jin Weizhi (Beijing) bio tech ltd to be provided.

According to 3`-Full RACE CoreSet (TaKaRa) and 5`-Full RACE CoreSet (TaKaRa) test kit specification sheets increase red woods ant acetylcholinesterasegene gene 3 ' end and 5 ' hold gene fragment.

Pcr amplification program is: 94 DEG C of denaturation 3 min; 94 DEG C of sex change 0.5 min, 60 DEG C of annealing 0.5 min, 72 DEG C extend 0.75 min, totally 30 circulations; 72 DEG C extend 10 min.

1% sepharose detects Race amplification PCR primer, and glue reclaims,

construction recombination plasmid:reclaimed red woods ant acetylcholinesterase (AChE) gene 3 ' end is connected with pMD-19T carrier with 5 ' terminal sequence (linked system and the same step of reaction conditions (2)), heat shock method will connect product conversion to E. coli JM109, the positive recombinant plasmid of coating LB plate screening.

Picking positive colony carries out bacterium colony PCR qualification and EcoRI and Hind double digestion qualification (identification system and the same step of reaction conditions (2)), identifies that correct bacterial strain extracts plasmid and to check order further qualification, checks order to be completed by Jin Weizhi (Beijing) bio tech ltd.

(4) pcr amplification red woods ant acetylcholinesterase (AChE) gene complete sequence

design primer, pcr amplification: according to known red woods ant acetylcholinesterasegene gene (AChE) gene complete sequence design primer, design of primers object is the restriction enzyme site introducing restriction enzyme EcoRI and NotI, design of primers sequence following (in sequence, underscore part is restriction enzyme site):

FF：TCA GAATTCATGAGTTTTTGGATGAATTGTCCGTC，

FR：CAA GCGGCCGCCCCTGTGTATGCGAATTGCGAGAA。

Primer is synthesized by Jin Weizhi (Beijing) bio tech ltd to be provided.

Hold as template carries out pcr amplification, to obtain red woods ant acetylcholinesterasegene gene (AChE) gene complete sequence (i.e. red woods ant acetylcholinesterasegene gene (AChE) coding region open reading frame) with the 3 ' end and 5 ' of step (2) gained red woods ant acetylcholinesterasegene gene (AChE) gene conserved sequence, step (3) gained red woods ant acetylcholinesterase (AChE) gene.

Pcr amplification program is: 95 DEG C of denaturation 5 min; 95 DEG C of sex change 0.5 min, 60 DEG C of annealing 0.5 min, 72 DEG C extend 2.5min, totally 32 circulations; 72 DEG C extend 7 min.

Cut glue and reclaim PCR primer.

construction recombination plasmid:reclaimed red woods ant acetylcholinesterase (AChE) gene complete sequence is connected with pMD-19T carrier (linked system and the same step of reaction conditions (2)), heat shock method will connect product conversion to E. coli JM109 competent cell, the positive recombinant plasmid of coating LB plate screening.

Picking positive colony carries out bacterium colony PCR qualification and EcoRI and NotI double digestion qualification (it is as follows that enzyme cuts identification system), identifies that correct bacterial strain extracts plasmid and to check order further qualification, checks order to be completed by Jin Weizhi (Beijing) bio tech ltd.

Sequencing result shows that gained is red woods ant acetylcholinesterase (AChE) gene coding region full length sequence, is 91% further after Blast contrast with the AchE sequence similarity of Polyhachis vicina Roger (Polyrhachis vicina).

EcoRI and NotI double digestion identification system is as follows:

EcoRI，0.5 μL；

NotI，0.5 μL；

0.1%BSA，0.2 μL；

10×H Buffer，2 μL；

Positive recombinant plasmid, 5 μ L

DdH ₂o adds to 20 μ L.

37 DEG C of enzymes cut 3.5 h.

, utilize red woods ant acetylcholinesterasegene gene (AChE) complete sequence constructed by step 1 to build recombinant eukaryotic expression plasmid

Carrier for expression of eukaryon of the present invention is pPICZ α A, this carrier is the efficient expression vector of expression 6 × His label, this carrier has many restriction enzyme sites simultaneously, is easy to insert exogenous genetic fragment as red woods ant acetylcholinesterase (AChE) gene coded sequence.Briefly introduce process as follows:

enzyme is cut, and connects: red woods ant acetylcholinesterasegene gene (AChE) complete sequence step 1 being reclaimed acquisition carries out EcoRI and NotI double digestion (enzyme is cut system and cut identification system with enzyme in step 1), pPICZ α A carrier is carried out EcoRI and NotI double digestion (enzyme is cut system and cut identification system with enzyme in step 1) simultaneously, enzyme is cut after product and is connected, and linked system is as follows:

T4 DNA ligase, 1 μ L;

T4 DNA connects enzyme buffer liquid, 5 μ L;

Enzyme cuts rear PCR primer, 2 μ L;

Enzyme cuts pPICZ α A product, 2 μ L.

16 DEG C of connections are spent the night.

transform, screen:linked system heat shock method after above-mentioned spending the night is converted in 100 μ L escherichia coli jm109 competent cells, adds 890 μ L LB ^-liquid nutrient medium, is then spread evenly across containing Zeocin(100 μ g/mL by 37 DEG C, 200 rpm shaking tables cultivate and hatch 1h) LB flat board screens positive recombinant plasmid expression vector.

bacterium colony PCR and double digestion qualification:single positive bacterium colony enlarged culturing on picking LB flat board, bacterium colony PCR identifies, extract the qualification of plasmid EcoRI, NotI double digestion (enzyme cuts the same step 1) of identification system, for increasing the reliability of result, can increase and choose 5` end coding region primers F F augmentation detection (primer is with (3) in step 1) simultaneously.

Jin Weizhi (Beijing) bio tech ltd is sent by positive monoclonal bacterial strain correct for preliminary evaluation to check order further qualification.

Recombinant plasmid dna sequencing result shows, in recombinant plasmid, the sequence of Insert Fragment is consistent with red woods ant acetylcholinesterase (AChE) mRNA, prove thus successfully the encoding sequence of red woods ant acetylcholinesterase (AChE) to be inserted carrier for expression of eukaryon, and direction of insertion is correct.Namely through red woods ant acetylcholinesterase (AChE) the gene complete sequence that pcr amplification goes out, successfully insert in carrier for expression of eukaryon pPICZ α A, successfully construct eukaryon recombinant plasmid expression vector.

, by constructed by step 2 eukaryon recombinant plasmid expression vector transform enter pichia spp host cell, cultivate, abduction delivering red woods ant acetylcholinesterase (AChE)

Eukaryon recombinant plasmid expression vector constructed by step 2 transforms and enters pichia spp X33 competence bacterial strain by electric shocking method, screening positive strain, amplification cultivation, and methanol induction red woods ant acetylcholinesterase (AChE) is expressed, and concrete steps are as follows:

(1) preparation of pichia spp X33 competence bacterial strain:

Pichia spp X33 bacterial classification is drawn dull and stereotyped 29 DEG C of YPD and cultivate 3 days until thalline grows to suitable size, choose single bacterium colony and cultivate (29 DEG C, 220 rpm) to OD to the concussion of 3mL YPD liquid culture ₆₀₀=0.6.

1% volume is forwarded to 20.0 mL YPD and continues enlarged culturing (29 DEG C, 220 rpm) to OD ₆₀₀=0.6.

4 DEG C, the centrifugal 5min of 1500 × g, abandon supernatant.With 8.0 mL X liquid (100 mM LiAC, 10 mM DTT, 0.6 M sorbyl alcohol and 10mM Tris-Hcl, PH=7.5) resuspended thalline under room temperature, normal temperature effect 30 min.

4 DEG C, centrifugal 5 min of 1500 × g, abandon supernatant.Resuspended with the sorbyl alcohol (1 M) of 1 mL precooling on ice; Go in 1.5 mL EP pipes, 4 DEG C, centrifugal 5 min of 1500 × g, abandon supernatant, wash in triplicate.

Finally use sorbyl alcohol (1 M) the resuspended thalline of 80 μ L precoolings on ice, be pichia spp X33 competence thalline, put stand-by on ice.

(2) enzyme is cut, is concentrated eukaryon recombinant plasmid expression vector:

Restriction enzyme SacI linearization for enzyme restriction step 2 gained eukaryon recombinant plasmid expression vector, it is as follows that enzyme cuts system:

The eukaryon recombinant plasmid expression vector of step 2,30 μ L;

10×CutSmart Buffer，10 μL；

SacI，5 μL；

DdH ₂o adds to 100 μ L.

37 DEG C of reaction 4 h.

After running glue qualification correctly, concentrated digestion products, concrete steps are as follows:

SacI enzyme is cut rear system 80 DEG C and keep 10 min, then add the NaAc (1M) of 1/10 volume successively, the dehydrated alcohol of 2.5 times of volumes ,-20 DEG C of reaction 2.5 h.

Centrifugal 7 min of 12000 rpm, abandon supernatant.

Add the 75% ethanol fine laundering of 500 μ L, 4 DEG C, centrifugal 7 min of 12000 rpm, abandon supernatant, repeat once.

EP tube opening is placed in 37 DEG C of incubators until without after ethanol smell, adds 12 μ L ddH ₂the heavy molten digestion products of O (heavy molten after get wherein 2 μ L and detect concentrated effect for running glue, remain 10 μ L-20 DEG C and save backup).

(3) electric shocking method transforms pichia spp X33 competence bacterial strain

Eukaryon recombinant plasmid expression vector 10 μ L after being cut by the enzyme that step (2) is concentrated joins in the pichia spp X33 competence bacteria liquid of 80 μ L prepared by step (1), proceed to after mixing gently (electric revolving cup is precooling on ice 30 min in advance) in electric revolving cup, place 5 min on ice.

Electroporated (2 KV, 25 μ F, 186 Ω), act on 5 ms.Add rapidly the sorbyl alcohol (1 M) of 1 mL precooling on ice after electric shock, go in 1.5 new mL EP pipes after mixing gently, hatch 1 h for 30 DEG C.

Then electricity is turned liquid and is spread evenly across Zeocin(100 μ g/mL) on the YPD flat board of resistance, be inverted cultivation three days, until thalline grows to suitable size for 29 DEG C.

(4) amplification cultivation, methanol induction red woods ant acetylcholinesterase (AChE) is expressed

The positives single bacterium colony of picking step (3) to liquid YPD(Zeocin, 100 μ g/mL) substratum, shaking culture 12 h.Then be transferred to BMMY culture medium culturing 24 h, 4 DEG C, centrifugal 5 min of 1500 × g, abandon supernatant.

The resuspended thalline of BMGY substratum also continues to cultivate, and adds the abduction delivering that methyl alcohol carries out red woods ant acetylcholinesterase (AChE) by the volume of 1% simultaneously.

Take out nutrient solution supernatant detection enzyme every 24h to live, enzyme is lived when reaching climax and is stopped cultivating.

Stop cultivating rear bacterium liquid 4 DEG C, centrifugal 10 min of 10000 r/min, get supernatant, the crude enzyme liquid of the red woods ant acetylcholinesterase (AChE) after restructuring can be obtained.

4, the purifying of red woods ant acetylcholinesterase (AChE)

Due to the specific expressed 6 × His label of carrier for expression of eukaryon pPICZ α A of the present invention, the C-end band of the red woods ant acetylcholinesterase (AChE) after the restructuring in the crude enzyme liquid of the thus red woods ant acetylcholinesterase (AChE) of step 3 gained has histidine-tagged, can obtain the red woods ant acetylcholinesterase (AChE) of purifying further by Ni-NTA His-Bind Resins post (TAKARA company), purge process briefly introduces as follows:

Appropriate Ni-NTA His-Bind Resins is loaded, with the binding buffer liquid balance resin of 5 times of volumes in chromatography column.

With the crude enzyme liquid of the red woods ant acetylcholinesterase (AChE) after the restructuring of ammonium sulfate precipitation step 3 gained of 48% saturation ratio, 4 DEG C, centrifugal 10 min of 12000rpm, abandon supernatant, collecting precipitation.

Appropriate binding buffer liquid dissolution precipitation, allows restructuring red woods ant acetylcholinesterase (AChE) after dissolving flow through chromatography column, abandoned stream fluid.With the binding buffer liquid washing chromatography column of 5 times of volumes, abandoned stream fluid.

With the elution buffer wash-out of 3 times of volumes, collect elutriant.

Repeatedly dialysed by the physiological saline (pH=7.0) of the elutriant collected with 10 times of volumes, removing imidazoles can obtain the red woods ant acetylcholinesterase (AChE) of purifying.

Red woods ant acetylcholinesterase (AChE) after bacterium liquid, methanol induction terminate rear unpurified bacterium liquid, methanol induction alcoholization after cultivating 24h to pichia spp X33 thalline fermented liquid methanol induction front bacterium liquid in step 3, methanol induction respectively carries out SDS-PAGE electrophoresis, and result as shown in Figure 2.

As can be seen from Figure 2, restructuring after methanol induction red woods ant acetylcholinesterase (AChE) has obvious AchE band in the position of about 64 KD sizes, thus can confirm that red woods ant acetylcholinesterase (AChE) obtains high-caliber expression in pichia spp; Restructuring after purifying red woods ant acetylcholinesterase band is single and size correct, shows purifying success.

embodiment 2

For the red woods ant acetylcholinesterase (AChE) obtained by embodiment 1, contriver has carried out Activity determination further and inhibiting rate detects, and briefly introduces as follows.

the Activity determination of gained red woods ant acetylcholinesterase (AChE) after embodiment 1 purifying

Detection reagent is prepared according to GB/T 5009.199-2003:

PH=8.0 damping fluid: get 11.9 g anhydrous di-potassium hydrogen phosphate and 3.2 g potassium primary phosphates respectively, dissolves with 1000 mL distilled water;

Developer: get 160 mg dithiobis-nitrobenzoic acid (DTNB) and 15.6 mg sodium bicarbonates respectively, with the PH=8.0 buffer solution of the above-mentioned preparation of 20 mL, 4 DEG C of preservations.

Substrate: get 25 mg S-Acetylthio vagusstoffs, adds 3.0 mL distilled water and dissolves, 4 DEG C of preservations.

According to the method for Ellman, red woods ant acetylcholinesterase (AChE) enzyme liquid 100 μ L after Example 1 purifying, adds 2.5 mL potassium phosphate buffers (1M, PH=8.0), 37 DEG C of water-bath 15 min, then add after 100 μ L developers mix rapidly and add 100 μ L substrates; At 412 nm(cuvettes, 712 type spectrophotometers) detect the variable quantity of the light absorption value (A) of 3 min under condition, variable quantity is larger just shows that protease activity is higher.

Live according to enzyme formulae discovery enzyme alive, formula is as follows:

，

Wherein Δ A is the changing value of 3 min absorbancys, and V is the volume (μ L) of enzyme liquid, and ρ is the mass concentration (mg/mL) of albumen, and gained enzyme specific activity is U/mg.

After recording purifying, enzyme specific activity is 1865 U/mg.

Woods ant acetylcholinesterase red after gained purifying and acetylcholine esterase of housefly (middle Sheng Ruitai Science and Technology Ltd.) are adjusted to equal in quality concentration, and carry out Enzyme activity assay, Enzyme assay result is as shown in the table simultaneously.

As can be seen from upper table data, present invention obtains more excellent, active higher acetylcholinesterase, can be used for the residual detection kit application of industrial production agriculture.

the detection of the agricultural chemicals inhibiting rate of gained red woods ant acetylcholinesterase (AChE) after embodiment 1 purifying

With reference to CL-B eight passage remains of pesticide determinator (Shanghai Bona New Technology Research Institute) operation instructions are carried out, and briefly introduce as follows.

Contrast test: add 2.5 mL phosphoric acid buffer (0.1M in reaction flask, PH=8.0), add 100 μ LAChE enzyme liquid (recombinate red woods ant AChE enzyme liquid or acetylcholine esterase of housefly) and developer more respectively, mixing, 100 μ L substrates are added after standing and reacting 10 min, shake up and pour into immediately in cuvette, put into measuring chamber the 1st passage of instrument in time, close lid.Press < B > key, after postponing 10s below display screen, Measuring Time starts countdown 180 s, and timing is complete, display screen display absorbance increase and inhibiting rate.When carrying out contrast test, 2 ~ 8 passages can carry out sample test simultaneously.

Sample test: add 2.5 mL sample liquid to be measured (2.4 mL phosphoric acid buffer (0.1M in reaction flask, PH=8.0) and 100 μ L agricultural chemicals diluents), the 100 μ L added respectively again obtained by embodiment 1 recombinate red woods ant AChE enzyme liquid and developer, mixing, 100 μ L substrates are added after standing and reacting 10 min, shake up and pour into immediately in cuvette, putting into the measuring chamber passage of instrument in time, close lid.Press < M > key, after postponing 10 s below display screen, Measuring Time starts countdown 180 s, and timing is complete, and display screen display absorbance increase and inhibiting rate, data are preserved automatically.

During with spectrophotometer test (412 nm wavelength), be calculated as follows inhibiting rate:

Enzyme inhibiting rate (%)=[(A alive ₀-At)/A ₀] × 100

Wherein: A ₀for the changing value of contrast solution reaction 3min absorbancy;

At is the changing value of sample solution reaction 3min absorbancy.

In the present embodiment, the CL-B adopted eight passage remains of pesticide determinators can calculate inhibiting rate when detecting automatically.If sample inhibiting rate >=50%, represent that sample middle peasant is residual and exceed standard.

Agricultural chemicals Malathion, methidathion, Volaton and acephate is diluted respectively, as sample liquid to be measured with phosphoric acid buffer.Restructuring red woods ant acetylcholinesterase (AChE) when measuring corresponding pesticide concentration prepared by embodiment 1 and the inhibiting rate of acetylcholine esterase of housefly, enzyme inhibiting rate (%) measurement result of living is as shown in the table.

As can be known from the table data, gained of the present invention red woods ant acetylcholinesterase (AChE) has higher agricultural chemicals inhibiting rate, and namely the light absorption value variable quantity of 3 min is comparatively large, and correspondence has higher enzyme and lives, so more responsive to agricultural chemicals, be more suitable for the detection of pesticide residue.

SEQUENCE LISTING

 

<110> Zhengzhou University

 

<120> red woods ant AChE gene, red woods ant AChE and preparation method thereof

 

<130> none

 

<160> 2

 

<170> PatentIn version 3.5

 

<210> 1

<211> 1620

<212> DNA

<213> Formica cinae

 

<400> 1

atgagttttt ggatgaattg tccgtcctcg ttgttgctgt tgctgttagg cctgagcctg 60

 

catagcgcgt gcatcacgcg agcgaacgtc gccggccagc atggtggcca ggacaatgat 120

 

cacgatgatc ctctgttggt agagactacg agcggcttga tgcgcggttt ctcccgtaca 180

 

gtgcttgaac gcgaggtcca cgtattctac ggagtgccgt tcgcgaaacc ccccgtcggt 240

 

ccgttgcggt ttcgcaagcc gctgccgatc gaaccctggc acggaatcct gaatgctacc 300

 

acattgccca acagttgcta ccaggagcgt tacgagtatt ttcctggttt cgagggtgag 360

 

gagatgtgga acccaaacac caacatctct gaggattgtc tctatctaaa catctgggtg 420

 

ccacagaagc tacgtctacg tcacaaacct gagtcacagg acaatgccgg taataatggc 480

 

atggcgatat tagtatggat ctacggcggc ggcttcatga gtggtactgc cactttggac 540

 

gtttatgacg ccgaccttat ggcagcggcc ggcaatgcaa taatcgcatc gatgcagtac 600

 

cgagtcggtg ctttcggctt tctgcacctc aatcagcact ttaccaacag tgaggaggca 660

 

ccgggcaata tgggcctttg ggatcaagct ttggctctca ggtggctgcg cgaaaatgcg 720

 

cgcgctttcg gcggcgatcc cgatttgatt acaattttcg gcgaatccgc aggcggcagt 780

 

tcggtatctc tacacctgat ctcaccagtt acacagggtc tagtacgccg ggggattctt 840

 

caaagtggca ctctgaacgc cccatggagt tacatgaccg gcgaaaaggc gaatgaggtg 900

 

gcccgagtat tggtagacga ttgtggatgt aattcgacga tgctgcaggg aaacccggcg 960

 

cgagttatgg cctgtatgag gtcggtggat gcaaaaaccc tctccgtgca gcagtggagc 1020

 

agttattggg gcatcctcgg ctttccgtcg gcgcccacta ttgacggcgt ctttctacct 1080

 

aaggatccgt tggacttggt cagggaggcg gacttcaaag acaccgagat cctgattgga 1140

 

aataacgaaa acgaaggaac gtactttatt ctgtacgatt ttattgactt cttcgagaaa 1200

 

gatcaagcca gttttctcga acgagacaag tttctcaaca tcattaatac cattttcaag 1260

 

aatatgtcac aaatcgagcg agaagccatc attttccaat ataccgattg ggatcagata 1320

 

aatgacggct ataagaatca gaaagcggta gcggatgtcg tgggcgatta tctcttcatc 1380

 

tgcccatcca cgcatttcgc tcagttgttt gcagatcgtg gcatgaaggt ctactattac 1440

 

ttcttcacgc agaggacgag taccaacgta tggggcgaat ggatgggagt gatgcacggt 1500

 

gatgaggtag aatatgtctt cgggcatcct ttgaaccaat ctctggtata caacgccaaa 1560

 

gagcgagatc tggcttccag aataattcgc tatttctcgc aattcgcata cacagggtag 1620

 

 

<210> 2

<211> 539

<212> PRT

<213> Formica cinae

 

<400> 2

 

Met Ser Phe Trp Met Asn Cys Pro Ser Ser Leu Leu Leu Leu Leu Leu

1 5 10 15

 

 

Gly Leu Ser Leu His Ser Ala Cys Ile Thr Arg Ala Asn Val Ala Gly

20 25 30

 

 

Gln His Gly Gly Gln Asp Asn Asp His Asp Asp Pro Leu Leu Val Glu

35 40 45

 

 

Thr Thr Ser Gly Leu Met Arg Gly Phe Ser Arg Thr Val Leu Glu Arg

50 55 60

 

 

Glu Val His Val Phe Tyr Gly Val Pro Phe Ala Lys Pro Pro Val Gly

65 70 75 80

 

 

Pro Leu Arg Phe Arg Lys Pro Leu Pro Ile Glu Pro Trp His Gly Ile

85 90 95

 

 

Leu Asn Ala Thr Thr Leu Pro Asn Ser Cys Tyr Gln Glu Arg Tyr Glu

100 105 110

 

 

Tyr Phe Pro Gly Phe Glu Gly Glu Glu Met Trp Asn Pro Asn Thr Asn

115 120 125

 

 

Ile Ser Glu Asp Cys Leu Tyr Leu Asn Ile Trp Val Pro Gln Lys Leu

130 135 140

 

 

Arg Leu Arg His Lys Pro Glu Ser Gln Asp Asn Ala Gly Asn Asn Gly

145 150 155 160

 

 

Met Ala Ile Leu Val Trp Ile Tyr Gly Gly Gly Phe Met Ser Gly Thr

165 170 175

 

 

Ala Thr Leu Asp Val Tyr Asp Ala Asp Leu Met Ala Ala Ala Gly Asn

180 185 190

 

 

Ala Ile Ile Ala Ser Met Gln Tyr Arg Val Gly Ala Phe Gly Phe Leu

195 200 205

 

 

His Leu Asn Gln His Phe Thr Asn Ser Glu Glu Ala Pro Gly Asn Met

210 215 220

 

 

Gly Leu Trp Asp Gln Ala Leu Ala Leu Arg Trp Leu Arg Glu Asn Ala

225 230 235 240

 

 

Arg Ala Phe Gly Gly Asp Pro Asp Leu Ile Thr Ile Phe Gly Glu Ser

245 250 255

 

 

Ala Gly Gly Ser Ser Val Ser Leu His Leu Ile Ser Pro Val Thr Gln

260 265 270

 

 

Gly Leu Val Arg Arg Gly Ile Leu Gln Ser Gly Thr Leu Asn Ala Pro

275 280 285

 

 

Trp Ser Tyr Met Thr Gly Glu Lys Ala Asn Glu Val Ala Arg Val Leu

290 295 300

 

 

Val Asp Asp Cys Gly Cys Asn Ser Thr Met Leu Gln Gly Asn Pro Ala

305 310 315 320

 

 

Arg Val Met Ala Cys Met Arg Ser Val Asp Ala Lys Thr Leu Ser Val

325 330 335

 

 

Gln Gln Trp Ser Ser Tyr Trp Gly Ile Leu Gly Phe Pro Ser Ala Pro

340 345 350

 

 

Thr Ile Asp Gly Val Phe Leu Pro Lys Asp Pro Leu Asp Leu Val Arg

355 360 365

 

 

Glu Ala Asp Phe Lys Asp Thr Glu Ile Leu Ile Gly Asn Asn Glu Asn

370 375 380

 

 

Glu Gly Thr Tyr Phe Ile Leu Tyr Asp Phe Ile Asp Phe Phe Glu Lys

385 390 395 400

 

 

Asp Gln Ala Ser Phe Leu Glu Arg Asp Lys Phe Leu Asn Ile Ile Asn

405 410 415

 

 

Thr Ile Phe Lys Asn Met Ser Gln Ile Glu Arg Glu Ala Ile Ile Phe

420 425 430

 

 

Gln Tyr Thr Asp Trp Asp Gln Ile Asn Asp Gly Tyr Lys Asn Gln Lys

435 440 445

 

 

Ala Val Ala Asp Val Val Gly Asp Tyr Leu Phe Ile Cys Pro Ser Thr

450 455 460

 

 

His Phe Ala Gln Leu Phe Ala Asp Arg Gly Met Lys Val Tyr Tyr Tyr

465 470 475 480

 

 

Phe Phe Thr Gln Arg Thr Ser Thr Asn Val Trp Gly Glu Trp Met Gly

485 490 495

 

 

Val Met His Gly Asp Glu Val Glu Tyr Val Phe Gly His Pro Leu Asn

500 505 510

 

 

Gln Ser Leu Val Tyr Asn Ala Lys Glu Arg Asp Leu Ala Ser Arg Ile

515 520 525

 

 

Ile Arg Tyr Phe Ser Gln Phe Ala Tyr Thr Gly

530 535

Claims (6)

1. red woods ant acetylcholinesterasegene gene, it is characterized in that, base sequence is as shown in sequence 1.

2. the red woods ant acetylcholinesterase described in claim 1 coded by red woods ant acetylcholinesterasegene gene, it is characterized in that, aminoacid sequence is as shown in sequence 2.

3. the preparation method of red woods ant acetylcholinesterase described in claim 2, it is characterized in that, the method comprises the following steps:

(1) also pcr amplification red woods ant acetylcholinesterasegene gene complete sequence is built;

(2) the red woods ant acetylcholinesterasegene gene complete sequence constructed by step (1) is utilized to build eukaryon recombinant plasmid expression vector;

(3) the eukaryon recombinant plasmid expression vector conversion constructed by step (2) is entered pichia spp host cell, cultivate, abduction delivering red woods ant acetylcholinesterase;

(4) the red woods ant acetylcholine ester enzyme purification after step (3) being expressed.

4. the preparation method of red woods ant acetylcholinesterase as claimed in claim 3, it is characterized in that, carrier for expression of eukaryon described in step (2) is pPICZ α A plasmid.

5. the preparation method of red woods ant acetylcholinesterase as claimed in claim 3, is characterized in that, pichia spp described in step (3) adopts pichia spp X33 bacterial strain.

6. the preparation method of red woods ant acetylcholinesterase as claimed in claim 3, is characterized in that, purifying described in step (4) adopts Ni-NTA His-Bind Resins post to carry out purifying.