CN104593389A - Recombinant syncytial virus protein and application thereof - Google Patents
Recombinant syncytial virus protein and application thereof Download PDFInfo
- Publication number
- CN104593389A CN104593389A CN201510039394.6A CN201510039394A CN104593389A CN 104593389 A CN104593389 A CN 104593389A CN 201510039394 A CN201510039394 A CN 201510039394A CN 104593389 A CN104593389 A CN 104593389A
- Authority
- CN
- China
- Prior art keywords
- syncytial virus
- rrsv
- albumen
- recombinant
- fragments
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a recombinant syncytial virus protein rRSV-58 and genes rRSV-58 for expressing the protein. The preparation method comprises the following steps: by taking a syncytial virus culture as a template, amplifying nucleotide fragments from the 628th site to the 999th site in the syncytial virus genome by virtue of primers P1 and P2, and amplifying nucleotide fragments from the 1140th site to the 2312th site by virtue of primers P3 and P4; by taking two fragments obtained in the first round of PCR amplification as a template, adding the primers P1 and P4, and amplifying the rRSV-58 fragments, thereby obtaining the series target gene recombinant fragments; inserting the recombinant fragments into pET-28a, performing transfection to Escherichia coli BL21(DE3), and inducing the expression, thereby obtaining the recombinant syncytial virus protein. A colloidal gold kit prepared by taking the recombinant syncytial virus protein as an antigen is used for detecting the syncytial virus infection and is high in specificity and high in sensitivity. Compared with the test of abroad exported kits, the kit disclosed by the invention has the advantage that the total detection coincidence rate (49+206)/260 is equal to 98.1 percent.
Description
Technical field
The present invention relates to the fields such as genetically engineered, vaccine development and diagnostic reagent, relate to a kind of re-constituted cellular virus albumen, the gene of expressing this albumen and application thereof particularly.
Background technology
Respiratory syncytial virus (respiratory syncytial virus, RSV) is called for short syncytial virus, also known as fusion virus, is a kind of RNA viruses, belongs to paramyxovirus section pneumonia and belongs to.Virion is rounded, not of uniform size, and diameter is 100 ~ 300nm.Core is single-stranded RNA, has nucleocapsid outward, and outermost one deck is the coating with thorn-like projection.Because not containing hemagglutinin, therefore without hemagglutinative function.Virus can grow in human respiratory tract's cell and the cell cultures such as people's kidney, monkey kidney, and produces pathology.Only have a serotype, 4 hypotypes can be divided.Vulnerable, not ether-resistant, acid, heat and freeze thawing, below pH3 gets final product deactivation in five minutes with 55 DEG C.
Epidemiology
RSV is respiratory tract infection of infants, especially the main pathogens of capillary bronchitis (being called for short hair to prop up).After infecting, main manifestations is capillary bronchitis and pneumonia, account for 2 years old Infants Below be in hospital in 45%.Increasing epidemiologic data display, the capillary bronchitis of infantile period is the high risk factor of childhood asthma in the future.
Rsv infection is worldwide distribution, and the grownup of up-to-date research discovery immunodeficiency and the elderly are also the Susceptible population of RSV.
There is not protective immunity after rsv infection, then the incidence infected is very high, about has 1,000,000 people to die from rsv infection every year, the U.S. about spends 22.5 hundred million dollars every year and is used for the treatment of rsv infection.
The albumen composition of RSV:
RSV belongs to Paramyxoviridae pneumonitis virus and belongs to, and its genome is ameristic linear strand RNA, about containing 15 000 Nucleotide, has 10 different genes, 1O viral protein of encoding.From 3 ' one 5 ', putting in order as being NS1 mono-NS2 mono-N-P-M-SH-G-F-M2 mono-L of its gene.Seeming all albumen is by a common open reading frame translation.In 1O albumen, 8 is structural protein, i.e. large Glycoprotein G, fusion glycoprotein F, the matrix protein be connected with coating and M2 (also known as 22*103 albumen), nucleoprotein N, phosphorylated protein P, large protein L and little hydrophobin SH (being called 1A in the past), an another l2 albumen is Nonstructural Protein NSl and NS2 (the front 1C of being called and 11B). except F, G and SH. and it asks all not glycosylation .SH to have 4 kinds of forms, molecular weight is respectively 4.8 × 103,7.5 × 103,15 × 103 and 21 × 103 ~ 30 × 103, the glycosylation of latter two form.All separately have an open reading frame in M gene and M2 gene, encode respectively 75 amino acid and 990 amino acid whose protein, thus may there is l1 and the 12nd kind of viral protein in imagination, but be not separated so far successfully.
Relevant clinical or laboratory diagnostic method:
Detect respiratory syncytial virus infection, adopt Viral isolation method, indirect immunofluorescence (IF), direct immunofluorescence, alkaline phosphatase alkali-resistivity Phosphoric acid esterase bridging enzyme linked immunosorbent assay (APAAP), biotinstreptatin peroxidase method, enzyme linked immunosorbent assay (EusA), viral fast detection method, molecular biology method, as multiple detection meanss such as multiple reverse transcription polymerase chain reaction (mRT-PCR), nest-type PRC and nucleic acid hybridization, Multiplex real-time PCR, biochip technology, suspension array technology both at home and abroad at present more.
Summary of the invention
The object of this invention is to provide a kind of re-constituted cellular virus albumen and the application of this re-constituted cellular virus albumen in preparation detection kit.
A kind of re-constituted cellular virus protein gene
rRSV-58, its nucleotide sequence is as shown in sequence table SEQ ID NO.1.
A kind of re-constituted cellular virus protein gene
rRSV-58preparation method:
With syncytial virus culture for template, to increase the 628th to the 999th nucleotide fragments in syncytial virus genome with primer P1 and P2, to increase the 1140th to the 2312nd nucleotide fragments with primer P3 and P4; Two fragments obtained with first round pcr amplification again, for template, add primer P1 and P4, amplification rRSV-58 fragment; Obtain the goal gene recombinant fragment of connecting
rRSV-58;
P1：CGCGGATCCATGGACACACACAATGACACC；
P2： CTTGACTTTGCTAAGAGCCATTGGATTGAGATCATACTTGTATATTATGG；
P3：CCATAATATACAAGTATGATCTCAATCCAATGGCTCTTAGCAAAGTCAAG；
P4: CCGCTCGAGAAGCTCTACATCATTATCTTTTGG。
A kind of re-constituted cellular virus albumen rRSV-58, its aminoacid sequence is as shown in sequence table SEQ ID NO.2.
An expression vector for re-constituted cellular virus albumen, it is in expression vector, insert the gene as shown in sequence table SEQ ID NO.1
rRSV-58;
Described carrier is pET-28a.
An engineering bacteria for re-constituted cellular virus albumen, the intestinal bacteria of the expression vector of its a kind of syncytial virus albumen that to be transfection above-mentioned;
Described intestinal bacteria are BL21(DE3).
A kind of expression vector transfection to intestinal bacteria of re-constituted cellular virus albumen are BL21(DE3 by a preparation method for re-constituted cellular virus albumen) in, abduction delivering, recovery, purification.
In a kind of re-constituted cellular virus albumen, preparation detects the application in the test kit of syncytial virus infection;
Described test kit is colloidal gold kit;
Described colloidal gold kit comprises: a kind of re-constituted cellular virus albumen line bag is 1.0 mg/mL by concentration, and colloidal gold conjugate specking amount is 60.0 μ L/cm
2, rabbit anti-syncytial virus antibody package amount is 1.0 μ L/cm, and wrapping by concentration is 5.0 mg/mL.
Below will describe in more detail technical scheme of the present invention:
The invention provides a kind of nucleotide sequence as shown in SEQ ID NO.1 of syncytial virus albumen of encoding, this nucleotide sequence is utilized to prepare the method for syncytial virus albumen, the syncytial virus albumen comprising aminoacid sequence shown in SEQ ID NO.2 prepared by the method, and comprise composition and the test kit of this albumen, also disclose them in the application detecting syncytial virus infection simultaneously.
Nucleotide sequence shown in SEQ ID NO.1 can be prepared by the method for this area routine, DNA sequence dna in its strong antigen epi-position and syncytial virus RSV genome (GenBank:U39661.1) is selected to be template, design two pairs of PCR primer (P1, P2) and (P3, P4).P1 and p2 is for the 628th to the 999th Nucleotide in the syncytial virus genome that increases, p3 and p4 is for the 1140th to the 2312nd Nucleotide that increases; Primer p1 and p4 is respectively with the restriction enzyme site of BamH I and Xho I, and primer p2 and p3 order is complementary; Utilize the connection primer in P2 hydrophobic for middle portion segment to be removed, and according to colibacillary expressor preferences, part point mutation has been carried out to gene order.
Primer sequence is as follows:
P1：CGCGGATCCATGGACACACACAATGACACC
P2： CTTGACTTTGCTAAGAGCCATTGGATTGAGATCATACTTGTATATTATGG
P3：CCATAATATACAAGTATGATCTCAATCCAATGGCTCTTAGCAAAGTCAAG
P4: CCGCTCGAGAAGCTCTACATCATTATCTTTTGG
With syncytial virus culture for template, to increase the 628th to the 999th nucleotide fragments in syncytial virus genome with primer P1 and P2, to increase the 1140th to the 2312nd nucleotide fragments with primer P3 and P4; Two fragments obtained with first round pcr amplification again, for template, add primer P1 and P4, amplification rRSV-58 fragment; Obtain the goal gene recombinant fragment rRSV-58 connected.
The nucleic acid molecule of the present invention to above-mentioned nucleotide sequence adopts when suitable carrier and host cell expression can improve expression productive rate greatly.
The present invention also provides the nucleotide sequence of application as shown in SEQ ID NO.1 to prepare the method for syncytial virus albumen.According to conventional methods, can the nucleic acid molecule of nucleotide sequence as shown in SEQ ID NO.1 containing coding syncytial virus albumen be connected in an expression vector, then by ordinary method transformant.Usually, preferred prokaryotic organism are for the initial clone of DNA sequence dna with for vector construction of the present invention.Such as, intestinal bacteria Deng Chang section bacillus.
The hybrid plasmid that the nucleic acid of code book invention albumen and pET-28a are formed has the stability of height, is conducive to the expression of albumen of the present invention.
In one embodiment of the invention, this construct containing the nucleic acid molecule of nucleotide sequence and the expression construct of pET-28a plasmid shown in SEQ ID NO.1, and is transformed BL21(DE3 by preparation), after IPTG inducing culture, collect thalline.The albumen that conventional purification process purifying obtains can be adopted.
The present invention also provides the syncytial virus albumen with aforesaid method preparation, purifying, and this albumen has aminoacid sequence shown in SEQ ID NO.2.
The present invention goes back composition and the test kit that providing package contains syncytial virus albumen of the present invention.Described composition or test kit can be prepared into the reagent or kit form that detect human foamy spumavirus's infection, clinically for detecting syncytial virus infection easily and fast and accurately.Any biological sample, as long as they contain syncytial virus antibody, just available albumen of the present invention, the composition or the test kit that comprise this albumen detect.
" test kit " described herein refers to that utilizing albumen of the present invention to complete syncytial virus infection detects and reagent set that assembly is made.This test kit is for diagnosing syncytial virus infection.In the test kit detected for syncytial virus infection, syncytial virus albumen of the present invention also can be through mark.Specifically can use the mark such as enzyme, metallo-chelate.Preferred markup enzyme such as, horseradish peroxidase, peroxidase, alkaline phosphatase etc.Preferred metallics has Radioactive colloidal gold etc.
" the people's anti respiratory syncitial virus antibodies detection kit (ELISA method) " that have Canadian HCB (Hermes Criterion Biotechnology) company to produce in the market detects syncytial virus antibody.
And adopt diagnostic kit prepared by re-constituted cellular virus albumen provided by the invention, compared with this test kit, there is high specificity, the advantage such as highly sensitive, easy and simple to handle, well meet the needs of syncytial virus infection clinical diagnosis.
Accompanying drawing explanation
The gel electrophoresis figure of Fig. 1 pcr amplification product, wherein M represents Marker, and 1 represents amplified production;
Fig. 2 is thalline 12%SDS-PAGE electrophorogram after induction, and wherein M represents Marker, and 1 represents target protein.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
the preparation of embodiment 1 syncytial virus albumen
1.1
the screening of syncytial virus Protein Epitopes and goal gene clone
The strong antigen epi-position of syncytial virus albumen is filtered out by whole aminoacid sequences of Computer Analysis syncytial virus, described recombinant protein contains from N-end the 628th to the 999th Nucleotide RSV genome from N-end successively to C-end, and the 1140th 515 amino acid to the 2312nd Nucleotide.Wherein the DNA sequence dna of above-mentioned recombinant protein is as shown in SEQ ID No.2.
According to the restriction enzyme site in the cDNA sequence of object peptide section in syncytial virus RSV genome and plasmid, design two pairs of PCR primer (P1, P2) and (P3, P4).P1 and p2 is for the 628th to the 999th Nucleotide in the RSV that increases, p3 and p4 is for RSV the 1140th to the 2312nd Nucleotide that increases; Primer p1 and p4 is respectively with the restriction enzyme site of BamH I and Xho I, and primer p2 and p3 partial nucleotide sequence are complementary.
Primer sequence is as follows:
P1：CGCGGATCCATGGACACACACAATGACACC
P2：CTTGACTTTGCTAAGAGCCATTGGATTGAGATCATACTTGTATATTATGG
P3：CCATAATATACAAGTATGATCTCAATCCAATGGCTCTTAGCAAAGTCAAG
P4: CCGCTCGAGAAGCTCTACATCATTATCTTTTGG
Above-mentioned primer is synthesized by (magnificent Bioisystech Co., Ltd).
With syncytial virus culture, (Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences gives, be separated from clinical patient in Shenyang City, Liaoning Province, Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences, address: No. 20, Dongdajie, Fengtai District, Beijing City contact person: take charge of bright silver) be template, with primer P1 and P2 amplification RSV the 628th to the 999th nucleotide fragments, with primer P3 and P4 amplification RSV the 1140th to the 2312nd nucleotide fragments; Two fragments obtained with first round pcr amplification again, for template, add primer P1 and P4, amplification rRSV-58 fragment; Obtain the goal gene recombinant fragment rRSV-58 connected; Amplified production detects through agarose gel electrophoresis, and result as shown in Figure 1.Cutting is containing the blob of viscose of target DNA band, (-Beijing TAKARA company is led to purchased from the six directions with DNA fast purifying test kit, name of product: TAKARA MiniBEST Plasmid purification) reclaim target DNA, operate and undertaken by product description.Its base sequence of rRSV-58 is as shown in sequence table SEQ ID NO.1.
1.2
the structure of expression vector pET-28a-rRSV-58 and qualification
PET-28a carrier (purchased from magnificent Bioisystech Co., Ltd) and pcr amplification product target DNA fragment are through BamH I and Xho I double digestion, product purification (adopt TAKARA MiniBEST Plasmid purification test kit, lead to-Beijing TAKARA company purchased from the six directions) is by T
4dNA ligase is connected with carrier, connect product conversion and enter e. coli bl21 (DE3) competence (purchased from magnificent Bioisystech Co., Ltd), dull and stereotyped upper 37 DEG C of the LB coated containing kantlex is inverted overnight incubation, select the bacterium colony of grow on plates next day, alkaline lysis extracting plasmid, agarose gel electrophoresis selects suspicious recombinant plasmid to carry out pcr amplification as template, to having the recon plasmid of amplified production through restriction endonuclease BamH I and Xho I double digestion, qualification, 3 recons are wherein had to be positive recombinant.From 3 positive recombinants, select a positive recombinant Song Sai Bai Sheng company order-checking qualification, result shows this plasmid inserts goal gene really, and direction of insertion is correct, by this recombinant plasmid called after expression plasmid pET-28a-rRSV-58.
1.3
express the structure of the engineering bacteria of mycoplasma pneumoniae albumen
By expression plasmid pET-28a-rRSV-58 chemical transformation ((U.S.) J. Pehanorm Brooker (JosephSambrook), (U.S.) D.W. Russell (DavidW.Russell) work, Huang Peitang etc. translate. Molecular Cloning: A Laboratory guide. and Science Press, 2002.) colon bacillus BL21(DE3 is proceeded to) bacterial strain (purchased from magnificent Bioisystech Co., Ltd), dull and stereotyped upper 37 DEG C of the LB coated containing kantlex is inverted overnight incubation, select the LB culture medium culturing of bacterium colony containing kantlex of grow on plates next day, with IPTG abduction delivering 5 hours, thalline 12%SDS-PAGE after induction analyzes (the same document), result as shown in Figure 2, determine that the bacterial strain of expressing syncytial virus albumen is required engineering strain, preserve with Freezing Glycerine.
1.4
the expression preparation of re-constituted cellular virus albumen and purifying
The colon bacillus of the expression syncytial virus albumen that inducing culture has built, with IPTG abduction delivering 5 hours, collected by centrifugation thalline, with 1:10(W/V) add cellular lysate liquid (50 mm pH 8.0 Tris-Cl, 50 mm NaCl, 50% glycerine), add magnetic agitation rotor and stir 30 minutes, through carrying out ultrasonic bacteria breaking (ice bath, power 200W, ultrasonic 3 seconds, 5 seconds, interval, ultrasonic 80 times), the Histidine affinity column (NiCl of 300 mL 200 mm
2cross post, flow velocity 5 mL/min; 500 mL level pads wash note, flow velocity 10 mL/min; Ultrasonic centrifugal after precipitation with 200 mL level pads dilution after loading, flow velocity 3 mL/min, 500 mL level pads wash note, flow velocity 5 mLmin; With the elution buffer wash-out containing imidazoles 20 mm, 50 mm, each 100 mL of 100 mm, 200 mm respectively, Ultraviolet Detector 280 nm detects absorption value, collects elution peak; SDS-PAGE electrophoresis detection purified components) obtain the recombinant protein of purifying.
1.5 syncytial virus recombination fusion protein qualifications
1.5.1 the mensuration of purity and molecular weight:through SDS-PAGE electrophoresis detection (albumen applied sample amount 10 μ g), be single zone, thin layer scanning identifies that purity is 95.8%.Molecular weight is about 58.2 kDa.
1.4.2 concentration determination:measure through Folin-phenol method, using bovine serum albumin as standard reference product, antigen protein concentration is 5.0 ± 0.5 mg/mL.
1.4.3 recombinant protein Western-blot verifies
Express for verifying that restructuring rRSV-58 type protein and anti-RSV antiserum(antisera) reactivity and goal gene of recombinating obtain and there is antigenicity, testing by Western-blot method.Positive serum is: 10 parts of rabbit anti-rsv antibodies positive serums (pacifying world Pharmaceutical Technology Co., Ltd purchased from Beijing hundred) and 30 parts of people's anti-rsv antibodies positive serums (detect through ELISA method and confirm).Negative serum is: 10 parts of contrast normal rabbit serums and 30 parts of people's anti-rsv antibodies negative serums (detect through ELISA method and confirm).Result is as table 1.
Result shows, all produce positive reaction with antigen expressed with 10 parts of rabbit anti-rsv antibodies positive serums of syncytial virus culture immune rabbit gained and 30 parts of people's anti-rsv antibodies positive serums, 10 parts of contrast normal rabbit serums and 30 parts of people's anti-rsv antibodies negative serums and antigen expressed all produce negative reaction.Result prompting restructuring goal gene obtains expresses, and restructuring rRSV-58 protein and totivirus protein have obvious cross reactivity, and have very strong specificity, and tool has significant practical applications.
the preparation of embodiment 2 syncytial virus antibody colloidal gold detection kit and performance detecting
the preparation of 2.1 syncytial virus antibody colloidal gold detection kit
Restructuring rRSV-58 albumen obtained is above used as test kit labelled antigen, measures RSV antibody with colloidal gold method.The development and application of this test kit is as follows:
(1) test kit principle: the present invention is according to dual-antigen sandwich method principle, and with rRSV-58 recombinant antigen bag by nitrocellulose filter, colloid gold label genetically engineered re-constituted cellular virus (rRSV-58) antigen is tracer.Add serum to be checked during use, as contained anti-RSV specific antibody in sample, then can be combined with the rRSV-58 recombinant antigen on film surface and form mixture, this mixture is combined with the rRSV-58 antigen of colloid gold label and presents red-purple band.
(2) test kit performance optimization: (collect the anti-syncytial virus antibody positive of Duo Jia hospital through clinical verification with positive and negative quality control product, negative serum, reinspection screening is carried out with " people's anti respiratory syncitial virus antibodies detection kit (ELISA method) " that Canadian HCB (Hermes Criterion Biotechnology) company produces, the anti-syncytial virus obtained is positive, negative serum is established as positive and negative quality control product) be test sample, intersection matching method is adopted to determine the best effort concentration of rRSV-58 recombinant antigen and rRSV-58 antigen colloidal gold (rRSV-58-Ag.G) binding substances, result is as table 2, drawn by result, if line bag higher than 2.0 mg/mL, may be caused false positive results by concentration, then false negative result may be caused lower than 2.0 mg/mL, if be diluted to more than one times, false negative result may be caused.So considering rear selection rRSV-58 recombinant antigen line bag by concentration is that 2.0 mg/mL, rRSV-58-Ag.G mixtures wrap by a year gold pad between concentration stock solution to dilution one times.
-: negative reaction (without detection line); ±: probable positive (detection line mays be seen indistinctly); +: positive reaction (occurring detection line); ++: comparatively strong positive reaction (detection line is clear); +++ strong positive reaction (detection line color is dark) (following explanation is same)
Determining that rRSV-58 recombinant antigen line bag is that 2.0 mg/mL, rRSV-58-Ag.G mixtures wrap and carried on the basis of gold pad between concentration stock solution to dilution one times by concentration, be test sample with positive and negative quality control product (source and standard the same), select best rRSV-58 recombinant antigen line amount.As can be seen from Table 3, when line amount then can cause nonspecific reaction (false positive) higher than 1.5 μ L/cm, then false negative result can be caused lower than 1.0 μ L/cm.So in conjunction with the consideration of production cost, finally select best rRSV-58 recombinant antigen line amount (metal spraying amount is 60.0 μ L/cm
2) be 1.0 μ L/cm.The results are shown in Table 3.
-: negative reaction; ±: probable positive; +: positive reaction; ++: comparatively strong positive reaction; +++ strong positive reaction
Determining that rRSV-58 recombinant antigen line concentration is 2.0 mg/mL, line amount is 1.0 μ L/cm and syncytial viral antigens colloidal gold composite specking concentration is on the basis between concentration stock solution to dilution one times, with positive and negative quality control product (source and standard the same), for testing sample, best colloidal gold conjugate specking amount is selected in the titration of employing square formation.As can be seen from Table 4, if specking amount is lower than 60.0 μ L/cm
2then false negative result can be caused, higher than 70.0 μ L/cm
2then cause false positive results, so in conjunction with the consideration of production cost, finally select best colloidal gold conjugate specking amount to be 60.0 μ L/cm
2.The results are shown in Table 4.
-: negative reaction; ±: probable positive; +: positive reaction; ++: comparatively strong positive reaction; +++ strong positive reaction
The basis determining antigen colloidal gold mixture package amount is selected the bag of the anti-syncytial virus antibody of nature controlling line rabbit by concentration.Rabbit anti-syncytial virus antibody package amount is 1.0 μ L/cm, and wrapping by concentration is 5.0 mg/mL.The results are shown in Table 5.
±: nature controlling line mays be seen indistinctly; +: there is nature controlling line; ++: nature controlling line is clear; +++: nature controlling line is clear thick
More than show, in rabbit anti-syncytial virus antibody and this test, syncytial viral antigens colloidal gold composite used has good reactivity.Rabbit anti-syncytial virus antibody bag is low by concentration, and response intensity is relatively weak.4.0-5.0 mg/mL concentration bag can be shown Quality Control effect substantially preferably.Thus 5.0 mg/mL concentration are selected as nature controlling line bag by concentration.
RRSV-58 recombinant antigen line bag is rear, closes respectively, compare sealing effect by following buffering system, and result shows containing PEG
20000closed system close after sensitivity and specificity decline all to some extent, other results closed and do not close are as broad as long, so select not close nitrocellulose filter.The results are shown in Table 6.
-: negative reaction; ±: probable positive; +: positive reaction; ++: comparatively strong positive reaction; +++ strong positive reaction
(3) preparation of test kit
1) HAuCl of 1.0g is got
4.H
2o is dissolved in 100 mL purified water, is made into 1% chlorauric acid solution; 1% chlorauric acid solution getting 1 mL enters in 100 mL boiling water, add 2 mL, 1% trisodium citrate, continue to boil 30 min, synthesis Radioactive colloidal gold; Get the colloidal gold solution of 6 mL synthesis, carry out scanning inspection at 400-700 nm place; Get about 30 nm Radioactive colloidal gold 406 mL of synthesis, with 0.1 M K
2cO
3adjust PH to 7, the 20 mM Tris-Cl measuring 5 mg/mL 2.65 mL rRSV-58 antigen PH8.2 are diluted to 40 mL, add colloidal gold solution while stirring, continue stirring 10 min, measure 1% BSA 40mL, add previous solu while stirring, continue stirring 10 min, the centrifugal 10Lmin of 3000 r/min 4 DEG C, go precipitation, after supernatant rebalancing, the centrifugal 45Lmin of 12000 r/min 4 DEG C, remove supernatant, repeat 2 times; With inner quality control serum, colloidal gold composite is tested, after the assay was approved, by afore mentioned concentration specking envelope antigen colloidal gold composite, then 37 DEG C, relative humidity less than 30% air seasoning 16-22 hour (spending the night) cuts afterwards.
2) precut NC film, adhesive back, was coated on NC film by the concentration determined and line amount bag by rRSV-58 recombinant antigen and the anti-syncytial virus antibody line of rabbit above, at 37 DEG C, under the condition of relative humidity less than 30% dry 1.0 hours.
3) the NC film (band backboard) tearing the tested survey line of bag and nature controlling line detects the paper film of line end, antigen colloidal gold binding substances pad is pasted onto the Quality Control line end of NC film, intersection about 1 mm, compacting, the load sample pad cut out is pasted onto the lower end of antigen colloidal gold binding substances pad, compacting, the absorbent pad cut out is pasted onto the Quality Control line end of NC film, the check-out console two ends posted are cut and removes 1 cm, be cut into 4 mm with slitting shear machine wide.Extract 18, by inner quality control Virus monitory work in-process test card.
4) each test card encapsulated separately, each independent packaging is 1 person-portion, and 20 person-portions are packaged into 1 box.Sampling inspection.
Each buffer formulation is as follows:
1) rRSV-58 recombinant antigen bag is buffered liquid formula: 20 mM Tris-Cl damping fluids (pH8.2) are in table 7.
2) rabbit anti-syncytial virus antibody bag is buffered liquid formula: 20 mM Tris-Cl damping fluids (pH8.2) are in table 8.
3) antigen colloidal gold mixture bag is buffered liquid formula: 20 mM TBS damping fluids (pH8.2) are in table 9.
(4) test kit uses working method:
1) open the packaging of aluminium foil bag of test card, take out test card.
2) test card is inclined to application of sample nose end and is no less than 1.0 cm lower than the other end.
3) getting 100 μ L serum to be checked joins in circular sample hole, and room temperature (15 DEG C ~ 30 DEG C) is placed and observed and record result for 25 minutes.
4) assay judges:
Positive: two red-purple lines bands appear in interpretation window.
Negative: a red-purple lines band appears in interpretation window only nature controlling line position.
Invalid: interpretation window nature controlling line position is without red-purple lines band.
2.2 test kit Performance Detection experiments
(1) specificity (accuracy) measures: the Radioactive colloidal gold measuring method determined by previous experiments, detects other serum substances several, observing response specificity.Result shows, and use test kit of the present invention to detect 15 parts of negative serums (clinical determine), coincidence rate is 100%; Detect 50 parts of rheumatoid factor positive serum specimens, 50 parts of syncytial virus positive serum samples, 50 parts of chlamydia trachomatis positive serum samples etc., none is positive, and show that Rheumatoid factors, polyclonal etc. can not cause the false positive of test kit substantially, specificity is fine.
(2) sensitivity determination: the Radioactive colloidal gold measuring method determined by previous experiments, detects the susceptibility of this test kit.Use test kit of the present invention to detect 15 parts of positive serums (clinical determine), coincidence rate is 100%.
(3) with the comparison test of similar products at home and abroad: " people's anti respiratory syncitial virus antibodies detection kit (ELISA method) " that test kit of the present invention and Canadian HCB (Hermes Criterion Biotechnology) company produce detects the comparative experiments result of 260 parts of serum samples as table 10.
The compare test result of table 10 and Canadian HCB company man preventing respiratory RSV antibody assay kit
Detect total coincidence rate: (49+206)/260=98.1%, tentatively show that this test kit reaches the standard of import reagent box.
<110> Jilin University
<120> re-constituted cellular virus albumen and application thereof
<160> 2
<210> 1
<211> 1545
<212> DNA
<213> is artificial
<400> 1
atggacacaa cacacaatga caccacacca caaagactga tgatcacaga catgagacca 60
ttgtcacttg agactataat aatatcacta accagagaca tcataacaca cagatttata 120
tacttgataa atcatgaatg tatagtgaga aaacttgatg aaagacaggc cacatttaca 180
ttcctggtca actatgaaat gaaactattg cacaaagtgg gaagcactaa atacaaaaaa 240
tatactgaat acaacacaaa atatggcact tttcctatgc caatatttat caatcatgat 300
gggttcttag aatgcattgg cattaagcct acaaagcaca ctcccataat atacaagtat 360
gatctcaatc caatggctct tagcaaagtc aagttgaatg atacactcaa caaagatcaa 420
cttctgtcat ccagcaaata caccatccaa cggagcacag gagatagtat tgatactcct 480
aattatgatg tgcagaaaca catcaataag ttatgtggca tgttattaat cacagaagat 540
gctaatcata aattcactgg gttaataggt atgttatatg ctatgtctag attaggaaga 600
gaagacacca taaaaatact cagagatgcg ggatatcatg taaaagcaaa tggagtggat 660
gtaacaacac atcgtcaaga tattaatggg aaagaaatga aatttgaagt gttaacattg 720
tcaagcttaa caactgaaat tcaaatcaac attgagatag aatctagaaa atcctacaaa 780
aaaatgctaa aagaaatggg agaggtagct ccagaataca ggcatgactc tcctgattgt 840
gggatgataa tattatgtat agcggcatta gtaataacca aattagcagc aggggataga 900
tctggtctta cagctgtgat taggagggct aataatgtcc taaaaaatga aatgaaacgt 960
tataaaggct tactacccaa ggatatagcc aacagcttct atgaagtgtt tgaaaaatat 1020
cctcacttta tagatgtttt tgttcatttt ggtatagcac aatcttctac cagaggtggc 1080
agtagagttg aagggatttt tgctggattg tttatgaatg cctatggtgc agggcaagtg 1140
atgttacggt ggggggtctt agcaaaatca gttaaaaata ttatgctagg acacgctagt 1200
gtgcaagcag aaatggaaca agttgtggag gtttatgaat atgcccaaaa attgggtgga 1260
gaagcagggt tctaccatat attgaacaac ccaaaagcat cattattgtc tttgactcaa 1320
tttcctcact tctccagtgt agtattaggc aatgctgctg gcctaggcat aatgggagaa 1380
tacagaggta caccaaggaa tcaagatcta tatgatgctg caaaagcata tgctgaacaa 1440
ctcaaagaaa atggtgtgat taactacagt gtattagact tgacagcaga agaactagag 1500
gctatcaaac atcagcttaa tccaaaagat aatgatgtag agctt 1545
<210> 2
<211> 515
<212> PRT
<213> is artificial
<400> 2
Met Asp Thr Thr His Asn Asp Thr Thr Pro Gln Arg Leu Met Ile Thr
5 10 15
Asp Met Arg Pro Leu Ser Leu Glu Thr Ile Ile Ile Ser Leu Thr Arg
20 25 30
Asp Ile Ile Thr His Arg Phe Ile Tyr Leu Ile Asn His Glu Cys Ile
35 40 45
Val Arg Lys Leu Asp Glu Arg Gln Ala Thr Phe Thr Phe Leu Val Asn
50 55 60
Tyr Glu Met Lys Leu Leu His Lys Val Gly Ser Thr Lys Tyr Lys Lys
65 70 75 80
Tyr Thr Glu Tyr Asn Thr Lys Tyr Gly Thr Phe Pro Met Pro Ile Phe
85 90 95
Ile Asn His Asp Gly Phe Leu Glu Cys Ile Gly Ile Lys Pro Thr Lys
100 105 110
His Thr Pro Ile Ile Tyr Lys Tyr Asp Leu Asn Pro Met Ala Leu Ser
115 120 125
Lys Val Lys Leu Asn Asp Thr Leu Asn Lys Asp Gln Leu Leu Ser Ser
130 135 140
Ser Lys Tyr Thr Ile Gln Arg Ser Thr Gly Asp Ser Ile Asp Thr Pro
145 150 155 160
Asn Tyr Asp Val Gln Lys His Ile Asn Lys Leu Cys Gly Met Leu Leu
165 170 175
Ile Thr Glu Asp Ala Asn His Lys Phe Thr Gly Leu Ile Gly Met Leu
180 185 190
Tyr Ala Met Ser Arg Leu Gly Arg Glu Asp Thr Ile Lys Ile Leu Arg
195 200 205
Asp Ala Gly Tyr His Val Lys Ala Asn Gly Val Asp Val Thr Thr His
210 215 220
Arg Gln Asp Ile Asn Gly Lys Glu Met Lys Phe Glu Val Leu Thr Leu
225 230 235 240
Ser Ser Leu Thr Thr Glu Ile Gln Ile Asn Ile Glu Ile Glu Ser Arg
245 250 255
Lys Ser Tyr Lys Lys Met Leu Lys Glu Met Gly Glu Val Ala Pro Glu
260 265 270
Tyr Arg His Asp Ser Pro Asp Cys Gly Met Ile Ile Leu Cys Ile Ala
275 280 285
Ala Leu Val Ile Thr Lys Leu Ala Ala Gly Asp Arg Ser Gly Leu Thr
290 295 300
Ala Val Ile Arg Arg Ala Asn Asn Val Leu Lys Asn Glu Met Lys Arg
305 310 315 320
Tyr Lys Gly Leu Leu Pro Lys Asp Ile Ala Asn Ser Phe Tyr Glu Val
325 330 335
Phe Glu Lys Tyr Pro His Phe Ile Asp Val Phe Val His Phe Gly Ile
340 345 350
Ala Gln Ser Ser Thr Arg Gly Gly Ser Arg Val Glu Gly Ile Phe Ala
355 360 365
Gly Leu Phe Met Asn Ala Tyr Gly Ala Gly Gln Val Met Leu Arg Trp
370 375 380
Gly Val Leu Ala Lys Ser Val Lys Asn Ile Met Leu Gly His Ala Ser
385 390 395 400
Val Gln Ala Glu Met Glu Gln Val Val Glu Val Tyr Glu Tyr Ala Gln
405 410 415
Lys Leu Gly Gly Glu Ala Gly Phe Tyr His Ile Leu Asn Asn Pro Lys
420 425 430
Ala Ser Leu Leu Ser Leu Thr Gln Phe Pro His Phe Ser Ser Val Val
435 440 445
Leu Gly Asn Ala Ala Gly Leu Gly Ile Met Gly Glu Tyr Arg Gly Thr
450 455 460
Pro Arg Asn Gln Asp Leu Tyr Asp Ala Ala Lys Ala Tyr Ala Glu Gln
465 470 475 480
Leu Lys Glu Asn Gly Val Ile Asn Tyr Ser Val Leu Asp Leu Thr Ala
485 490 495
Glu Glu Leu Glu Ala Ile Lys His Gln Leu Asn Pro Lys Asp Asn Asp
500 505 510
Val Glu Leu
515
Claims (10)
1. a re-constituted cellular virus protein gene
rRSV-58, its nucleotide sequence is as shown in sequence table SEQ ID NO.1.
2. a kind of re-constituted cellular virus protein gene according to claim 1
rRSV-58preparation method:
With syncytial virus culture for template, to increase the 628th to the 999th nucleotide fragments in syncytial virus genome with primer P1 and P2, to increase the 1140th to the 2312nd nucleotide fragments with primer P3 and P4; Two fragments obtained with first round pcr amplification again, for template, add primer P1 and P4, amplification rRSV-58 fragment; Obtain the goal gene recombinant fragment of connecting
rRSV-58;
P1：CGCGGATCCATGGACACACACAATGACACC；
P2： CTTGACTTTGCTAAGAGCCATTGGATTGAGATCATACTTGTATATTATGG；
P3：CCATAATATACAAGTATGATCTCAATCCAATGGCTCTTAGCAAAGTCAAG；
P4: CCGCTCGAGAAGCTCTACATCATTATCTTTTGG。
3. a re-constituted cellular virus albumen rRSV-58, its aminoacid sequence is as shown in sequence table SEQ ID NO.2.
4. an expression vector for re-constituted cellular virus albumen, it is in expression vector, insert the gene as shown in sequence table SEQ ID NO.1
rRSV-58.
5. the expression vector of a kind of re-constituted cellular virus albumen according to claim 4, is characterized in that: described carrier is pET-28a.
6. an engineering bacteria for re-constituted cellular virus albumen, the intestinal bacteria of the expression vector of its a kind of syncytial virus albumen according to claim 4 that has been transfection.
7. the engineering bacteria of a kind of re-constituted cellular virus albumen according to claim 6, is characterized in that: described intestinal bacteria are BL21(DE3).
8. in a kind of re-constituted cellular virus albumen according to claim 3, preparation detects the application in the test kit of syncytial virus infection.
9. application according to claim 8, is characterized in that: described test kit is colloidal gold kit.
10. application according to claim 9, is characterized in that, described colloidal gold kit comprises: a kind of re-constituted cellular virus albumen line bag is 1.0 mg/mL by concentration, and colloidal gold conjugate specking amount is 60.0 μ L/cm
2, rabbit anti-syncytial virus antibody package amount is 1.0 μ L/cm, and wrapping by concentration is 5.0 mg/mL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510039394.6A CN104593389A (en) | 2015-01-27 | 2015-01-27 | Recombinant syncytial virus protein and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510039394.6A CN104593389A (en) | 2015-01-27 | 2015-01-27 | Recombinant syncytial virus protein and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104593389A true CN104593389A (en) | 2015-05-06 |
Family
ID=53119443
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510039394.6A Pending CN104593389A (en) | 2015-01-27 | 2015-01-27 | Recombinant syncytial virus protein and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593389A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781360A (en) * | 2010-02-05 | 2010-07-21 | 吉林大学 | Recombinant rubella virus protein and application |
| CN101918029A (en) * | 2007-09-20 | 2010-12-15 | 智利天主教教皇大学 | Immunogenic formulation |
-
2015
- 2015-01-27 CN CN201510039394.6A patent/CN104593389A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101918029A (en) * | 2007-09-20 | 2010-12-15 | 智利天主教教皇大学 | Immunogenic formulation |
| CN101781360A (en) * | 2010-02-05 | 2010-07-21 | 吉林大学 | Recombinant rubella virus protein and application |
Non-Patent Citations (1)
| Title |
|---|
| TOLLEY K.P. ET AL.: "Respiratory Syncytial Virus,Complete Genome", 《GENBANK:U39661.1》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111220803B (en) | Novel coronavirus antibody detection reagent, preparation method thereof and novel coronavirus antibody detection card | |
| CN102636641B (en) | Detection kit of helicobacter pylori emulsion method and preparation process thereof | |
| EP1778880A2 (en) | Methods and reagents for diagnosing hantavirus infection | |
| CN112505330B (en) | Kit for detecting novel coronavirus based on fusion protein of nucleocapsid protein | |
| CN111647055B (en) | N protein for detecting novel coronavirus, preparation and application thereof | |
| CN108314710B (en) | Mycoplasma pneumoniae recombinant antigen and application thereof | |
| CN114736290B (en) | Nanometer antibody capable of recognizing porcine pseudorabies virus with high accuracy and sensitivity, preparation method and application | |
| CN107304231B (en) | Mycobacterium tuberculosis fusion protein and application thereof | |
| CN101100673A (en) | Mycobacterium tuberculosis recombination fusion protein and application thereof | |
| CN103834668B (en) | A kind of restructuring mycoplasma pneumoniae albumen and application thereof | |
| CN102533795B (en) | Recombinant human cytomegalovirus protein and applications thereof | |
| CN103820471A (en) | Recombined chlamydia trachomatis protein and application thereof | |
| CN101914563A (en) | Mycobacterium tuberculosis 38Kd-16Kd-CFP10 recombinant fusion protein and application thereof | |
| CN111875677A (en) | Canine parvovirus VP2 protein recombinant antigen, encoding gene thereof, expression and application thereof | |
| CN101508999B (en) | Recombinant toxoplasma protein and uses thereof | |
| CN109679970A (en) | The preparation method that feline herpesvirus I type virus quickly detects | |
| CN101781360B (en) | Recombinant rubella virus protein and application | |
| CN104593389A (en) | Recombinant syncytial virus protein and application thereof | |
| CN101509002B (en) | Recombinant rubella virus protein and uses thereof | |
| CN111471112B (en) | Rabies virus recombinant antigen and preparation method and application thereof | |
| CN107098980A (en) | A kind of fusion protein for detecting Detecting Rubella Virus Antibodies In Human Sera and preparation method thereof | |
| CN102492699B (en) | Recombination human herpes simplex virus II protein and application thereof | |
| CN101705233B (en) | Recombinant human herpes simplex virus I protein HSV I gG and application thereof | |
| CN110426517B (en) | Recombinant antigen protein for detecting dengue-2 virus antibody, kit and application thereof | |
| CN106290862B (en) | Mumps virus HN antigens and its purposes in detection material for anti parotitis antiviral antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150506 |
|
| WD01 | Invention patent application deemed withdrawn after publication |