CN104587459B - Express PCV2 Cap recombinant swinepox virus carrier bacterin - Google Patents
Express PCV2 Cap recombinant swinepox virus carrier bacterin Download PDFInfo
- Publication number
- CN104587459B CN104587459B CN201410626534.5A CN201410626534A CN104587459B CN 104587459 B CN104587459 B CN 104587459B CN 201410626534 A CN201410626534 A CN 201410626534A CN 104587459 B CN104587459 B CN 104587459B
- Authority
- CN
- China
- Prior art keywords
- virus
- recombinant
- recombinant swinepox
- orf2
- pig
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides the porcine circovirus 2 type recombinant vaccine using pig pox virus as expression vector, the recombinant vaccine includes pig pox virus carrier and porcine circovirus 2 type ORF2 genes.Recombinant vaccine of the present invention is, using pig pox virus genome SPV017~SPV020 genes as insertion point, to be that exogenous gene cloning enters carrier pSWE11 by porcine circovirus 2 type ORF2 genes, obtain transfer vector pSWE11/P28C；By pig pox virus and transfer vector infection, transfection PK15 cells, the recombinant swinepox virus for expressing PCV2 Cap is obtained by homologous recombination.Other sites that recombinant swinepox virus of the present invention has been reported relatively have virus titer high; the advantages of more efficient, stable expressing PCV2 Cap; and can produce strong immune response after immune animal; the immune animal of induction produces the antibody of high-titer, and produces good immanoprotection action.
Description
Technical field
The invention belongs to field of biological product, it is related to a kind of recombinant swinepox virus carrier bacterin.
Background technology
Porcine circovirus 2 type（Porcine circovirus type 2, PCV2）Pig can be caused to occur Porcine circovirus desease
（PCVD）, Porcine circovirus desease clinically has a many forms, the scorching kidney of such as pmws, pigskin
The diseases such as sick syndrome, piglet congenital tremors and sow breeding difficulty.At present, PCVD is very extensive in China's Epidemic Scope, gives
Pig industry causes larger economic loss.Porcine circovirus 2 type（PCV2）Genome Size is 1767bp or 1768bp.To its base
Because group analysis show that the ORF of more than 200bp sizes has 11, encoding proteins molecular weight is between 2~36KDa；ORF1 is
Reading frame maximum PCV2, has 945 bases, on the underlying stock DNA of virus, encodes virus replication GAP-associated protein GAP（Rep eggs
In vain）With the Rep ' albumen of truncation：Rep albumen has 312aa, and molecular weight is about 35.8KDa, is had with virus genomic rolling-circle replication
Close；Rep ' albumen has 168aa, and molecular weight is about 19KDa.The normal expression of Rep albumen and Rep ' albumen, virus could start just
Often replicate.ORF2 is the second largest reading frame of PCV2 viruses, has 702 or 705 bases, encodes the nucleocapsid protein of virus.Clothing
Glutelin molecular weight is about 27.8KDa, is PCV2 main immunogenic albumen, so being played in medical diagnosis on disease and vaccine research
Important function, the research currently for PCV2 vaccines is concentrated mainly on capsid protein.At present, existing a variety of utilization PCV2 capsid
Protein coding gene builds the vaccine for preventing pig circular ring virus, such as baculoviral, prokaryotic expression plasmid, streptococcus lactis
Deng.
Poxvirus vector is as the important tool in genetic engineering, and its application is extremely extensive, and source is successfully expressed
In many genes of plant, animal, or even the mankind.As Viral vaccine vectors, poxvirus has advantages below：（1）It is easy to behaviour
Make and use；（2）The genome of poxvirus is big, and easily assembling, can accommodate the exogenous DNA more than 25 kb；（3）Poxvirus carries
The exogenous gene expression product of body can induce antibody and the cytotoxic T cell reaction of anti-exotic antigen, be inoculated with once with regard to that can obtain
Obtain immune effect for a long time；（4）Poxvirus has strict host specificity, and virus itself will not be made to the animal of immunity inoculation
Into disease；（5）Being capable of correct express express target protein, it is ensured that the authenticity of albumen.Therefore there are poxvirus potentiality to turn into safety
Effective vaccine carrier.At present, conventional recombinant poxvirus expression vector mainly has：Vaccinia virus（VV）, fowlpox virus, goat
Poxvirus etc..Have no so far using pig pox virus SPV017~SPV020 as deletion segment construction expression porcine circovirus 2 type capsid
The report of Protein reconstitution pig pox virus.
Report on pig pox virus there are 3 as the insertion point of expression vector expression alien gene at present, be respectively
SPV063（TK genes）, noncoding region between SPV043 and SPV020~SPV021.For example with pig pox virus（SWPV）For carrier, with
SPV063（TK genes）As foreign gene insertion and deletion segment, CSFV E 2 protein is expressed；With pig pox virus SPV043
Feline leukaemia virus Gag and Env gene is expressed as insertion point；Using noncoding region between pig pox virus SPV020~SPV021 as
Insertion point expresses circovurus type 2 ORF2 genes.But built using pig pox virus SPV017~SPV020 as deletion segment
Recombinant swinepox virus carrier bacterin is the present inventor's original creation.
The present inventor successfully constructs by deletion segment of pig pox virus SPV017~SPV020 by many experiments and expressed
The recombinant swinepox virus carrier bacterin of PCV2 Cap.In experimentation find, due to SPV017~
SPV020 missings do not influence virus multiplication, and the recombinant virus titre of generation is than other deletion segments（Such as SPV020~SPV021
Between noncoding region, SPV043, SPV063）It is significantly high, it can effectively be bred in immune animal body, be produced after being immunized
Antibody titer is apparently higher than other deletion segments.Thus vaccine using it as vector construction relative to other carriers or other lack
Unsceptered point achieves more preferable immune effect.
The content of the invention
It can effectively prevent the recombinant swinepox virus carrier bacterin of Porcine circovirus desease it is an object of the invention to provide a kind of
And preparation method thereof.
The invention provides a kind of recombinant swinepox virus（rSWE11/P28C）, the recombinant swinepox virus is in pig pox virus
Carrier S PV017~SPV020 deletion segments insert ORF2 genetic recombination of the present invention and are prepared from.
In the inventive solutions, the nucleotide sequence of ORF2 genes of the present invention such as SEQ ID NO：1 institute
Show.
The present invention is had found by animal immune experiment：The recombinant swinepox virus that the present invention is provided can be in immune animal body
Express express target protein（PCV2 Cap）, the antibody of more efficient valency can be produced in induced animal body, and immune animal is produced
Raw good protective effect.
The invention provides the recombinant vaccine of an expression PCV2 Cap, the recombinant vaccine includes pig
The ORF2 genes that poxvirus vector and the present invention are provided.
In the inventive solutions, described pig pox virus carrier is pSWE11, and the carrier is with pig pox virus
SPV017~SPV020 inserts foreign gene as deletion segment.
The disease medicament that prevention and/or treatment pig circular ring virus trigger is being prepared the invention further relates to described recombinant vaccine
Purposes, be preferred for prepare prevention and/or treatment porcine circovirus 2 type trigger disease medicament purposes.Described pig circle
The type of circovirus virus 2 triggers disease to be pmws, the scorching nephrotic syndrome of pigskin and piglet congenital tremors
Deng.
Immune route of inoculation of the present invention includes but is not limited to intramuscular injection etc..
The invention provides a kind of technical scheme of Prepare restructuring pig pox virus, the program is realized in：
（1）Transfer vector pSWE11 is built using gene engineering method；
（2）Using specific primer to amplification porcine circovirus 2 type（PCV2）The encoding gene ORF2 of capsid protein；
（3）ORF2 gene clonings are entered in transfer vector pSWE11, identify that acquisition contains ORF2 by PCR and double digestion
The transfer vector pSWE11/P28C of gene；
（4）Allow the transfer vector pSWE11/P28C containing ORF2 genes and pig pox virus parental virus homologous recombination, obtain
Recombinant swinepox virus rSWE11/P28C；
（5）Purification of Recombinant pig pox virus rSWE11/P28C.
The nucleotide sequence of described specific primer is respectively such as SEQ ID NO：2 and SEQ ID NO：Shown in 3.
In the optimal technical scheme of the present invention, the transfer vector pSWE11 and swine pox allowed containing ORF2 genes
The concrete operations of viral homologous recombination are：Use pig pox virus parental virus（SWPV）PK15 cell monolayers are infected, after adsorbing 2 hours
Transfer vector pSWE11/P28C is added with lipofection, the two occurs homologous recombination.PK15 cells are trained under normal conditions
After supporting 4 days, multigelation 3 times obtains initial recombinant swinepox virus rSWE11/P28C.
In the optimal technical scheme of the present invention, the specific behaviour of the purification of Recombinant pig pox virus rSWE11/P28C
As：Continue to cultivate after the recombinant swinepox virus rSWE11/P28C is carried out into 10 times of doubling dilutions, inoculation PK15 cell monolayers
4 days, single band green fluorescence plaque, the single virus plaques of sterile working picking, multigelation are marked under fluorescence microscope
PK15 cell monolayers are inoculated with again after appropriate dilution afterwards, are repeated 8 times, until last obtain can stablize the restructuring swine pox disease of heredity
Poison.
On the other hand, the invention provides a kind of method that above-mentioned recombinant swinepox virus is made to vaccine, this method includes：
（1）By the recombinant swinepox virus rSWE11/P28C of purifying, continuous passage 35 times on PK15 cells, detect its ORF2
The expression of gene, is expressed to ORF2 genes are stable, and the malicious valency of recombinant swinepox virus is stable 108.5PFU/mL。
When expanding culture, individual layer PK15 cells, culture 3~4 are inoculated with by 5MOI with recombinant swinepox virus rSWE11/P28C
My god, poison, multigelation 3 times are received when cytopathy reaches 80% or so, you can obtain the restructuring swine pox disease of expression ORF2 genes
Poisonous carrier vaccine.
Beneficial effect of the present invention
1st, the present invention successfully constructs the recombinant vaccine of expression circovurus type 2 ORF2 genes, due to restructuring swine pox disease
Poison is easier to be replicated in pig body, PCV2 Cap is constantly expressed in pig body, during stimulation body is produced
There is provided lasting protection with antibody.Accordingly, with respect to other types porcine circovirus type 2 vaccines（Such as other vector constructions
Recombinant vaccine or porcine circovirus 2 type totivirus inactivated vaccine etc.）With stronger more longlasting protection.
2nd, the recombinant swinepox virus for the expression porcine circovirus 2 type ORF2 genes that the present invention is built is with pig pox virus
SPV017~SPV020 inserts ORF2 genes as deletion segment, and experiment is proved, the restructuring swine pox disease built with the deletion segment
Poison can efficient to foreign protein, stable expression；Plant toxic effect valency high, do not influence virus multiplication, the titer plateaus for planting poison exists
108.5PFU/mL, relatively other insertion points：Such as with noncoding region between SPV020~SPV021（107.8PFU/mL）、SPV043
（107.0PFU/mL）、SPV063（TK genes）（107.2PFU/mL）Will height for the malicious valency of kind poison of deletion segment.Animal immune experiment
Prove, recombinant swinepox virus carrier bacterin of the present invention can produce the high-titer for PCV2 Cap
Neutralizing antibody, and antibody level is than the recombinant vaccine that its baculovirus vector is built, totivirus inactivated vaccine or with SPV020
Noncoding region, SPV043, SPV063 between~SPV021（TK genes）The recombinant swinepox virus built as deletion segment is high, because
This, with good immanoprotection action.
3rd, the recombinant swinepox virus carrier bacterin that builds of the present invention has that stability is good, prepare relative to current similar vaccine
Simply, cost is low, good immune effect the advantages of, it is adaptable to mass produce.
4th, due to the strict host specificity of pig pox virus, pig is its unique reservoir host, and other animals are not broadcast to,
And there is no pathogenic to pig, therefore the recombinant swinepox virus carrier bacterin that the present invention is built has good security, is a kind of
Preferable biological engineering vaccine.
Brief description of the drawings
Fig. 1 is transfer vector pSWE11/P28C structural representations.Wherein, SPV017~SPV020-L and SPV017~
SPV020-R is respectively the left and right Homo~logous exchange arm of pig pox virus；P11 and P28 is poxvirus promoter, and EGFP is mark base
Cause；ORF2 is purpose GFP；
Fig. 2 is with SPV063（TK genes）（a）、SPV043（b）The noncoding region between SPV020~SPV021（c）Respectively
The recombinant transfer vector built for deletion segment；
Fig. 3 is the left and right homology arms of SPV017-SPV020 of pig pox virus and P11-EGFP PCR amplifications；
Fig. 4 is porcine circovirus 2 type ORF2 gene PCR amplifications；
Fig. 5 is transfer vector pSWE11/P28C digestion products electrophoresis detection results；
Fig. 6 is that western blot detect expression of the capsid protein in recombinant swinepox virus rSWE11/P28C, its
Middle swimming lane M：Pre-dyed albumen Marker, swimming lane 1：Infect rSWE11/P28C PK15 cells, swimming lane 2：Infection is with SPV063（TK
Gene）Deletion segment expresses the PK15 cells of ORF2 recombinant swinepox virus, swimming lane 3：Pig pox virus parental virus infection PK15 is thin
Born of the same parents, swimming lane 4：Normal virus-free infection PK15 cells；
Fig. 7 diagrams are expression feelings of the detection recombinant swinepox virus rSWE11/P28C in PK15 cells under the conditions of fluorescence
Condition, wherein（A）It is that transfer vector pSWE11-28C and pig pox virus parental virus transfect PK15 cells, it can be seen that obvious single
Individual green fluorescence spot；Figure（B）The recombinant swinepox virus rSWE11/P28C infection PK15 cells of purifying, it is seen that glimmering of green；
Fig. 8 diagrams are immune serum antibody titer measurement results；
Fig. 9 diagrams are Serum Antibody levels after the immune black pig in Yushan.
Embodiment
Providing for the following example is, in order to be better understood from and illustrate the present invention, and to be never interpreted as to the present invention's
Any limitation.
The Universal Transfer Vectors pSWE11 of embodiment 1 structure
The pig pox virus uniquely included according to NCBI（GenBank：AF410153.1）Gene order designs two pairs of specificity
Primer, expands SPV017-SPV020 or so homology arm respectively：
SPV017-020-L11（Position in genome：11134bp-11158bp）
5ˊ-CGAGCTC（SacⅠ）ACTTCTGTTTAGATTCACAGCATTT-3ˊ
SPV017-020-L12（Position in genome：12280bp-12300bp）
5ˊ-CGGGATCC（BamHⅠ）ACGATAGCAGCGTTGGTGTT-3
SPV017-020-R11（Position in genome：13365bp-13384bp）
5ˊ-GCTCTAGA（XbaⅠ）CTCGAG（XhoⅠ）GTCGAC（SalⅠ）
GTGGGTGGTGTAGACTGTGT-3ˊ
SPV017-020-R12（Position in genome：14416bp-14436bp）
5ˊ-CCAAGCTT（HindIII）TTCGATTTTTCACAGGTGGCT-3ˊ
Use Viral nucleic acid extraction reagent box（QIAGEN）Extract pig pox virus（ATCC：VR-363TM）Genome be used as mould
Plate, left and right the homology arm SPV017-020-L and SPV017- for obtaining transfer vector are expanded with above-mentioned primer respectively by PCR method
020-R（Amplification is shown in Fig. 3）.Through glue reclaim after purification, SPV017-020-R fragments are inserted into pUC19 matter to pcr amplification product
GrainHindIII andXbaI restriction enzyme site, while SPV017-020-L fragments are inserted into pUC19 plasmidsBamHI HeSacⅠ
Restriction enzyme site, constructs pSW-R-L.
Universal shuttle plasmid pSWE11 structure
Using plasmid EGFP-N1 as template, primer is used：
P11-EGFP1:
5ˊ- GCTCTAGA（XbaⅠ）TAGAATTTCATTTTGTTTTTTTCTATGCTATAAATG
GTGAGCAAGGGCGAG-3 ˊ
P11-EGFP2:
5 ˊ-CGGGATCC（BamHⅠ）TTACTTGTACAGCTCGTCCATGCCGAG-3 ˊ
Wherein sense primer（P11-EGFP1）In carry P11 promoter sequences, amplify green fluorescent protein EGFP base
Cause, by steps such as digestion, connections, is cloned into carrier pSW-R-LXbaI HeBamHI site, forms transfer vector
pSWE11。
Amplification, clone, identification and the sequencing analysis of the porcine circovirus 2 type ORF2 genes of embodiment 2
2.1 PCR primers are designed and synthesized
The porcine circovirus 2 type Chinese pathogenic strain reference gene sequence announced according to NCBI（GenBank：HQ693093）If
The specific primer of pair for amplification ORF2 genes has been counted, P28 promoter sequences are added at the 5' ends of sense primer, while containing limited
Property restriction endonuclease processedXhoI HeSalI restriction enzyme site.Primer is synthesized by Nanjing Genscript Biotechnology Co., Ltd..
P28-ORF2-1：
5' – gc CTCGAG（XhoⅠ）TTTTTTTTTTTTTTTTTTTTGGCATATAAATGACGTATCCAAGGAGGCG
- 3'
P28-ORF2-2：
5' – gc GTCGAC（SalⅠ）TTATCACTATTAAGGGTTAAGTGGGGGGT - 3'
2.2 PCR are expanded
10×EasyTaqBuffer 5 μ L, dNTPs（2.5mM/L）4 μ L, P28-ORF2-1（20μM/L）0.5 μ L, P28-
ORF2-2（20μM/L）0.5 μ L, Taq enzyme（5U/μL）0.5 μ L, the nucleic acid-templated 2 μ L of porcine circovirus 2 type of purifying, with sterilizing
Deionized water is mended to the μ L of cumulative volume 50.Expanded in PCR instrument, reaction condition is：95 DEG C of pre-degenerations 5min, 95 DEG C of denaturation 45s,
54 DEG C of renaturation 1min, 72 DEG C of extension 1min, totally 30 circulations；Last 72 DEG C of extensions 10mim, PCR primer carries out 1% agarose and coagulated
Gel electrophoresis.
2.3 PCR primers are reclaimed and purifying
PCR primer cuts complete, single purpose band after agarose gel electrophoresis under uviol lamp, is returned with DNA glue
Receive purification kit and reclaim purpose fragment.Concrete operation step presses Tiangeng biochemical technology（Beijing）Co., Ltd's glue reclaim kit
Specification is carried out.Fig. 4 is porcine circovirus 2 type ORF2 gene PCR amplifications.
2.4 PCR primer digestions and purifying
Endonuclease reaction cumulative volume is 50 μ L：PCR reclaims the μ L of 30 μ L, 10 × buffer Tango of fragment 5,SalI 2 μ L,XhoI 2 μ L, supply sterile deionized water to 50 μ L.37 DEG C of water-bath 2h, then enter row agarose gel electrophoresis and solidifying with agarose
Glue reclaim kit is reclaimed to the product after digestion, and method is ibid.
2.5 purpose fragment ORF2 and transfer vector pSWE11 connection
The μ L of ORF2 digestions recovery product 6, μ L, 10 × ligation the buffer1 μ L of carrier pSWE11 digestions recovery product 2,
The μ L of T4 DNA ligases 1,4 DEG C of connections are stayed overnight after mixing.Connection product pSWE11/P28C conversion Escherichia coli TOP10.
PSWE11/P28C concrete structures are shown in Fig. 1.Fig. 5 is transfer vector pSWE11/P28C digestion products electrophoresis detection results.
The preparation and conversion of 2.6 Escherichia coli TOP10 competent cells
The preparation of competent cell and the step of converting of connection product are referred to《Molecular Cloning:A Laboratory guide》.
The extraction and identification of 2.7 recombinant plasmids
Recombinant plasmid pSWE11/P28C is extracted with plasmid extraction kit（Concrete operation step is had by Tiangeng biochemical technology
Limit company plasmid extraction kit specification is carried out）, PCR and double digestion identification in it can be seen that purpose band.
2.8 target gene ORF2 gene sequencings
Examining order is assisted to complete by Nanjing Genscript Biotechnology Co., Ltd..Sequencing result such as SEQ ID NO：1 institute
Show, the target gene ORF2 of clone is 705bp, meet the requirement of carrier reading frame.
The preparation of recombinant swinepox virus of the embodiment 3 containing ORF2 genes and measure
3.1 PK15 cells prepare
PK-15 cells are passed on once every 20h or so, are kept for cell log growth period, and the transfection day before yesterday takes one bottle of cell, presses
One bottle of cell connects the boring ratio of six orifice plate six example, per hole nutrient solution containing 2mL, 37 DEG C, 5%CO2Cultivate 20h or so.
3.2 recombinant swinepox virus rSWE 11/P28C acquisition
Take pig pox virus strain VR-363TMVirus liquid, is diluted with 5%DMEM, and it is mono- to infect PK15 by 0.05MOI pig pox virus
Confluent monolayer cells, adsorb 2h, are during which rocked once every 20min.Viruses adsorption started dilution plasmid and liposome before last half an hour.
The kits of Lipofectamine 2000 are pressed in transfection（Invitrogen companies）Operational manual is operated.37 DEG C of incubators are incubated 6h
Afterwards（Transfixion）Supernatant is discarded, 10%DMEM 2mL is changed and continues to cultivate.Poison is received when having lesion after cell culture 4d, is frozen repeatedly
Melt 3 times, collect the original liquid of recombinant virus rSWE11/P28C.
The purifying of 3.3 recombinant swinepox virus
By original recombinant virus liquid by 50,500,5000 times of dilutions, meet malicious 900 μ L, viruses adsorption time 3-4h, phase per hole
Between light shake shake up 3 times.After the completion of viruses adsorption, infection liquid is discarded, plus containing the low melting-point agaroses of 10% calf serum DMEM 0.5%
3mL, room temperature places 30min or so rear 37 DEG C of 5%CO2Continue to cultivate after 4d, under fluorescence microscope, mark the list fluoresced
Individual plaque.It is dissolved in the autoclaved 200 μ L spots for going sharp pipette tips picking single in 200 μ L maintaining liquids, 2 conducts of multigelation
Next round is purified and rised in value.Whether it is purified to by PCR identifications, generally requires the wheel of purifying 7~8.Obtain recombinant swinepox virus of the present invention.
The measure and its noncoding region, SPV063 between SPV020~SPV021 of 3.4 recombinant swinepox virus titres（TK bases
Cause）Deletion segment virus titer compares
Take the recombinant swinepox virus of the present invention of 3.3 gained（I.e. insertion point is pig pox virus genome 12301-13364
Put, be specifically shown in Fig. 1）.
Control group 1 is：SPV063（TK genes）The recombinant virus of missing（I.e. insertion point is pig pox virus genome
55894 positions, are specifically shown in Fig. 2-a）.
Control group 2 is：The recombinant virus that non-coding region gene is lacked between SPV020~SPV021（I.e. insertion point is swine pox
Viral genome 13268-13457 positions, are specifically shown in Fig. 2-b）.
Position of the left arm primer in pig pox virus genome：
LF1：5’-GAATTCTAAATCTACTTCTTCAACGG-3’（12121-12140）
LF2：5’-GGTACCTATAACTACTAGGTCCACAC-3’（13249-13268）
Position of the right arm primer in pig pox virus genome：
RF1：5’-GTCGACAGGCGATTATTTATGTTATTA-3’（13457-13477）
RF2：5’-AAGCTTATTTTTATCCTATTGTTGTTC-3’（14811-14832）
Control group 3 is：The recombinant virus of SPV043 gene delections（I.e. insertion point is pig pox virus genome 39130-
39319 positions, are specifically shown in Fig. 2-c）.
Position of the left arm primer in pig pox virus genome：
LF1：5’- CGACAGAGCTCCTGGTCTTTTATCACCTCCCTG-3’（38155-38180）
LF2：5’- TACGCGGCCGCATCACGTTATACTCTGCCTATGTGAGG-3’（39103-39129）
Position of the right arm primer in pig pox virus genome：
RF1：5’- GTGAGATCTGTCATTTATATAAATTAATTCTAAATAATATAGG-3’（39320-39353）
RF2：5’- CCAAGCTTTTCTATAGACGATATTGCAAAATCCTGG-3’（40312-40339）
By virology operation manual method, respectively with containing dual anti-（Penicillin and streptomysin）DHanks buffer solutions by disease
Poison makees 10 times of gradient dilutions.
Then 96 porocyte culture plates for covering with individual layer PK15 cells are inoculated in respectively, and each dilution factor is inoculated with 8 holes, often
Hole is inoculated with 100 μ L.Concurrently set positive and negative control.After 37 DEG C of 5% CO2 incubator cultures 2.5h, change 5%DMEM and continue to train
Support.Observation cytopathy, and virus titer is calculated by Reed-Muench methods daily.This recombinant virus titre is 108.5 PFU/
ML, and SPV063（TK genes）The recombinant virus titre of missing is 107.2 Noncoding region weight between PFU/mL, SPV020~SPV021
Group virus titer is 107.8 The recombinant virus titre of PFU/mL, SPV043 missing is 107.0PFU/mL, shows this restructuring swine pox disease
Seed culture of viruses poison titre is significantly higher than the recombinant virus of control group 1, control group 2 and control group 3.
The PCR detections of 3.5 recombinant swinepox virus
Each one bottle of the PK15 cells of inoculation recombinant swinepox virus rSWE11/P28C and parent's pig pox virus respectively are taken, with disease
Malicious nucleic acid extraction kit（QIAGEN）Carried out respectively with primer pair P28-ORF2-1/ P28-ORF2-2 after extracting viral DNA
PCR is expanded.Amplified production electrophoresis detection result shows to contain ORF2 genetic fragments in recombinant swinepox virus, and the parent of control group
ORF2 genes can not be expanded in pig pox virus.
3.6 green fluorescent proteins are detected
It is can be found that under fluorescence microscope：The PK15 cells for being inoculated with recombinant swinepox virus rSWE11/P28C are aobvious in fluorescence
Green fluorescence spot is presented under micro mirror, and the PK15 cells for being inoculated with parent's pig pox virus then have no fluorescent spot.Fig. 7 diagrams are fluorescence
Under the conditions of expressions of the detection recombinant swinepox virus rSWE11/P28C in PK15 cells, wherein（A）For transfer vector
PSWE11-28C transfects PK15 cells with pig pox virus parental virus, it can be seen that obvious single green fluorescence spot；Figure（B）It is pure
The recombinant swinepox virus rSWE11/P28C infection PK15 cells of change, it is seen that glimmering of green.
3.7 testing goal albumen（ORF2）Expression and compared with other deletion segment expression quantity
Recombinant swinepox virus rSWE11/P28C the 4th generation virus liquids after purification are taken, PK15 cells are infected, culture 72h treats cell
Occur after lesion, collect supernatant, cell is scraped with cell scraper and cell is collected.Cannot be used up full DMEM 3500r/min from
After heart 10min washings cell 3 times, the incomplete DMEM suspension cells of 300 μ L, multigelation 2 times are eventually adding.Add 4 × loading
The μ L of buffer solution 75, boiling water, which boils, is used for SDS-PAGE electrophoresis after 10min, while setting with SPV063（TK genes）Deletion segment is built
Express ORF2 recombinant swinepox virus, pig pox virus parental virus and PK15 normal cell blank controls；SDS-PAGE electrophoresis knots
Shu Hou, takes out protein electrophoresis glue, pvdf membrane is placed on glue, 60V electricity turns 2h；Film is placed on decolorization swinging table after having turned and uses PBST
Washing 2 times；2h is closed by another plate of pvdf membrane dislocation, adding on the 5% underlying decolorization swinging table of defatted milk room temperature；His- will be used
ORF2 immunized mices serum is diluted to 500 times with PBST, and the pvdf membrane after closing is placed in primary antibody and is incubated after 2h, is decolourizing
Shaking table is washed 3 times, each 10min；Ibid method prepares sheep anti mouse secondary antibody, is contacted after being diluted by 1: 3000 times with film, at room temperature
1.5h is incubated, is washed in decolorization swinging table with PBST 3 times, each 10min；Finally the pvdf membrane immersion after washing has been configured
Lucifuge develops the color in DAB nitrite ions, until there is obvious band, uses ddH2O terminating reactions, take pictures.As a result（Fig. 6）Show purpose
Albumen has expression, but the expression of the recombinant swinepox virus of SPV017-SPV020 deletion segments structure in recombinant swinepox virus
Amount compares SPV063（TK genes）The recombinant swinepox virus expression quantity that deletion segment is built will height, and in pig pox virus parental virus and
Then occur in normal PK15 cells without destination protein.
The immunoprotection experiment of the recombinant vaccine of embodiment 4
Mouse and immune effect comparative test is immunized in 4.1 recombinant swinepox virus
The SPF level ICR mouse of 40 4 week old are taken to be randomly divided into 8 groups, every group of 5 mouse；First group is used 2*107.5PFU's
The recombinant swinepox virus rSWE11/P28C intramuscular injection that the present invention is built is immunized；Second group is used 2*107.5PFU is with SPV063（TK
Gene）It is immunized for the recombinant swinepox virus intramuscular injection that deletion segment is built；3rd group is used 2*107.5PFU with SPV020~
Noncoding region is that the recombinant swinepox virus intramuscular injection that deletion segment is built is immunized between SPV021；4th group is used 2*107.5PFU with
SPV043 is that the recombinant swinepox virus intramuscular injection that deletion segment is built is immunized；5th group with certain import porcine circovirus 2 type epidemic disease
Seedling（Baculovirus expression）Intramuscular injection is immunized；6th group immune with certain domestic porcine circovirus 2 type inactivated vaccine intramuscular injection；
7th group is used 2*107.5PFU pig pox virus parental virus intramuscular injection is immunized；8th group is used sterile saline intramuscular injection
It is immune to be used as blank control group；Every group of mouse immune three times, is distinguished for the 14th day and the 35th day after initial immunity by same procedure
Two are carried out to exempt to exempt from three；Observe daily and record immune mouse reaction；Before initial immunity and it is immune after the 1st, 2,3,4,5,6,
7th, 8,9,10,11, pass through tail vein blood within 12 weeks, separate serum, antibody titer is detected with indirect elisa method.
As a result show（Fig. 8）：With the recombinant swinepox virus immune serum antibody titer that builds of the present invention apparently higher than
Other control groups and experimental group.
4.2 recombinant swinepox virus rSWE11/P28C are immunized the black pig in Yushan and produce antibody test
Take 30 first 30 ages in days or so and porcine circovirus 2 type serum antibody be the negative black pig in Yushan, be randomly divided into six groups,
Every group 5.First group is used 5*107.5PFU recombinant swinepox virus rSWE11/P28C of the present invention is injected by musculi colli and carried out
It is immune；Second group is used 5*107.5PFU SPV063（TK genes）Lack recombinant poxvirus musculi colli injecting immune；3rd group of use
5*107.5Non-coding region gene lacks recombinant poxvirus musculi colli injecting immune between PFU SPV020~SPV021；4th group
Use 5*107.5PFU SPV043 pig pox virus parental virus are done in the same fashion immune；5th group is used 5*107.5PFU's
Pig pox virus parental virus are done in the same fashion immune；6th group is negative control group, and the sterilizing of intramuscular injection equivalent is given birth to
Manage salt solution.Be spaced after initial immunity and carry out within 14 days two exempting from by same procedure, before initial immunity and it is immune after the 1st, 2,3,4,5,
6th, 7,8,9,10,11, pass through tail vein blood within 12 weeks, separate serum, circovirus antibody potency is detected with indirect elisa method.
As a result show（Fig. 9）：Four groups of recombinant swinepox virus, which are immunized, can induce pig to produce specific antibody, but it is heavy that this is immunized
The antibody titer that group pig pox virus is produced is compared with SPV063（TK genes）, non-coding region gene between SPV043, SPV020~SPV021
Deletion segment significantly will height.
In summary, the recombinant vaccine built by deletion segment of SPV017~SPV020 involved by this patent can be induced
Immune animal produces the antibody for circovurus type 2 ORF2, and relative SPV063（TK genes）, SPV043, PV020~
Noncoding region is that the recombinant viral vaccine that deletion segment is built has advantages below between SPV021：（1）Plant toxic effect valency high.Do not influence
The duplication of virus, can largely breed in immune animal body；（2）Exogenous protein expression amount is high.Can be high in immune animal body
Effect expression target gene ORF2, and the antibody of immune animal generation more efficient valency can be induced；（3）Immune animal can be produced good
Good protective effect.Therefore this recombinant vaccine is a kind of preferable new generation vaccine.
SEQUENCE LISTING
<110>Deng Shunzhou
Jiang Xinhua
Chen Songchang
Zhang Wenbo
Wan Wenzhong
Wang Jianmin
Dai Yimin
Nanchang Jin Mu animal healths Services Co., Ltd
<120>Express PCV2 Cap recombinant swinepox virus carrier bacterin
<130> 2014
<160> 17
<170> PatentIn version 3.3
<210> 1
<211> 705
<212> DNA
<213> ORF2
<400> 1
atgacgtatc caaggaggcg tttccgcaga cgaagacacc gcccccgcag ccatcttggc 60
cagatcctcc gccgccgccc ctggctcgtc cacccccgcc accgttaccg ctggagaagg 120
aaaaatggca tcttcaacac ccgcctctcc cgcaccatcg gttatactgt caagaaaacc 180
acagtcagaa cgccctcctg gaatgtggac atgatgagat ttaatattaa tgattttctt 240
cccccaggag ggggctcaaa ccccctcact gtgccctgtg aatactacag aataaggaag 300
gttaaggttg aattctggcc ctgctcccca atcacccagg gtgacagggg agtgggctcc 360
actgctgtta ttctagatga taactttgta acaaaggcca atgccctaac ctatgacccc 420
tatgtaaact actcctcccg ccatacaata acccagccct tctcctacca ctcccggtac 480
tttaccccga aacctgtcct tgataggaca atcgattact tccaacccaa taacaaaaga 540
aatcaactct ggctgagact acaaactact ggaaatgtag accatgtagg cctcggcact 600
gcgttcgaaa acagtatata cgaccaggac tacaatatcc gtataaccat gtatgtacaa 660
ttcagagaat ttaatcttaa agacccccca cttaacccta agtga 705
<210> 2
<211> 32
<212> DNA
<213>Artificial sequence
<400> 2
cgagctcact tctgtttaga ttcacagcat tt 32
<210> 3
<211> 28
<212> DNA
<213>Artificial sequence
<400> 3
cgggatccac gatagcagcg ttggtgtt 28
<210> 4
<211> 40
<212> DNA
<213>Artificial sequence
<400> 4
gctctagact cgaggtcgac gtgggtggtg tagactgtgt 40
<210> 5
<211> 29
<212> DNA
<213>Artificial sequence
<400> 5
ccaagctttt cgatttttca caggtggct 29
<210> 6
<211> 59
<212> DNA
<213>Artificial sequence
<400> 6
gctctagata gaatttcatt ttgttttttt ctatgctata aatggtgagc aagggcgag 59
<210> 7
<211> 35
<212> DNA
<213>Artificial sequence
<400> 7
cgggatcctt acttgtacag ctcgtccatg ccgag 35
<210> 8
<211> 57
<212> DNA
<213>Artificial sequence
<400> 8
gcctcgagtt tttttttttt ttttttttgg catataaatg acgtatccaa ggaggcg 57
<210> 9
<211> 37
<212> DNA
<213>Artificial sequence
<400> 9
gcgtcgactt atcactatta agggttaagt ggggggt 37
<210> 10
<211> 26
<212> DNA
<213>Artificial sequence
<400> 10
gaattctaaa tctacttctt caacgg 26
<210> 11
<211> 26
<212> DNA
<213>Artificial sequence
<400> 11
ggtacctata actactaggt ccacac 26
<210> 12
<211> 27
<212> DNA
<213>Artificial sequence
<400> 12
gtcgacaggc gattatttat gttatta 27
<210> 13
<211> 27
<212> DNA
<213>Artificial sequence
<400> 13
aagcttattt ttatcctatt gttgttc 27
<210> 14
<211> 33
<212> DNA
<213>Artificial sequence
<400> 14
cgacagagct cctggtcttt tatcacctcc ctg 33
<210> 15
<211> 38
<212> DNA
<213>Artificial sequence
<400> 15
tacgcggccg catcacgtta tactctgcct atgtgagg 38
<210> 16
<211> 43
<212> DNA
<213>Artificial sequence
<400> 16
gtgagatctg tcatttatat aaattaattc taaataatat agg 43
<210> 17
<211> 36
<212> DNA
<213>Artificial sequence
<400> 17
ccaagctttt ctatagacga tattgcaaaa tcctgg 36
Claims (9)
1. a kind of recombinant vaccine for being used to prevent porcine circovirus 2 type associated diseases, including recombinant swinepox virus；The restructuring swine pox
ORF2 gene of the virus comprising pig pox virus carrier and coding PCV2 Cap, encodes porcine circovirus 2 type clothing
The ORF2 genes of glutelin are inserted by deletion segment of pig pox virus SPV017~SPV020.
2. a kind of recombinant swinepox virus, the ORF2 genes comprising pig pox virus carrier and coding PCV2 Cap,
The ORF2 genes of coding PCV2 Cap are on pig pox virus carrier using SPV017~SPV020 as deletion segment
Insertion.
3. the recombinant swinepox virus described in claim 2, wherein the ORF2 gene sequences of described PCV2 Cap
Row such as SEQ ID：Shown in 1.
4. the recombinant swinepox virus described in claim 2, wherein described recombinant swinepox virus carrier is pSWE11, the Recombinant Swine
Poxvirus vector is insertion heterogenous expression target gene by deletion segment of pig pox virus SPV017~SPV020.
5. the recombinant swinepox virus described in claim 2 is being prepared for preventing and/or treating porcine circovirus 2 type initiation disease
The purposes of medicine.
6. the purposes described in as requested 5, wherein described porcine circovirus 2 type triggers disease to be postweaning multisystemic exhaustion
The scorching nephrotic syndrome of syndrome, pigskin, piglet congenital tremors and sow breeding difficulty.
7. a kind of method of Prepare restructuring pig pox virus, this method includes：
Utilize the encoding gene ORF2 genes of specific primer pair amplifies PCV2 Cap；
ORF2 gene clonings are entered in transfer vector pSWE11, is then identified by PCR and double digestion, obtains the gene containing ORF2
Transfer vector pSWE11/P28C；
Allow the transfer vector pSWE11/P28C containing ORF2 genes to carry out homologous recombination in infection cell with pig pox virus, obtain
It is able to the recombinant swinepox virus rSWE11/P28C of SPV017~SPV020 missings；
Purification of Recombinant pig pox virus rSWE11/P28C.
8. the method described in claim 7, wherein the nucleotide sequence of described specific primer is respectively such as SEQ ID NO：2
With SEQ ID NO：Shown in 3.
9. the method described in claim 7, wherein described the transfer vector pSWE11/P28C and the swine pox that allow containing ORF2 genes
The concrete operations of viral homologous recombination are：Use pig pox virus（SWPV）PK15 cell monolayers are infected, absorption uses liposome after 2 hours
Infection protocol adds transfer vector pSWE11/P28C, and the two occurs homologous recombination；
PK15 cells were cultivated after 4 days under normal conditions, multigelation 3 times, obtained original recombinant swinepox virus rSWE11/
P28C；Purification of Recombinant pig pox virus rSWE11/P28C concrete operations are：The recombinant swinepox virus rSWE11/P28C is entered
Continue to cultivate 4 days after 10 times of gradient dilutions of row, inoculation PK15 cell monolayers, single band green fluorescence is marked under fluorescence microscope
PK15 cell monolayers are inoculated with again after appropriate dilution after plaque, the single virus plaques of picking, multigelation, are repeated 8 times purifying,
Until the recombinant swinepox virus of heredity can be stablized by obtaining.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410626534.5A CN104587459B (en) | 2014-11-10 | 2014-11-10 | Express PCV2 Cap recombinant swinepox virus carrier bacterin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410626534.5A CN104587459B (en) | 2014-11-10 | 2014-11-10 | Express PCV2 Cap recombinant swinepox virus carrier bacterin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104587459A CN104587459A (en) | 2015-05-06 |
| CN104587459B true CN104587459B (en) | 2017-08-25 |
Family
ID=53113730
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410626534.5A Active CN104587459B (en) | 2014-11-10 | 2014-11-10 | Express PCV2 Cap recombinant swinepox virus carrier bacterin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104587459B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112626036B (en) * | 2020-12-28 | 2022-04-22 | 南京农业大学 | Gene-deleted non-toxic suipoxvirus and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102824634B (en) * | 2012-09-14 | 2014-03-19 | 范红结 | Recombined Swinepox virus carrier vaccine capable of expressing porcine circovirus 2-type Cap protein and preparation method thereof |
-
2014
- 2014-11-10 CN CN201410626534.5A patent/CN104587459B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104587459A (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yao et al. | Induction of apoptosis in vitro by the 17-kDa nonstructural protein of infectious bursal disease virus: possible role in viral pathogenesis | |
| KR102132730B1 (en) | Foot-and-mouth disease virus-like particle vaccine and its manufacturing method | |
| AU2020277165B2 (en) | Feline calicivirus vaccine | |
| CN107815441A (en) | A kind of II type Pseudorabies virus attenuated strain and its preparation method and application | |
| CN108823231A (en) | A kind of 3 type genetic engineering subunit vaccine of pig circular ring virus and preparation method thereof | |
| CN101884787A (en) | Porcine circovirus type 2 subunit vaccine and preparation method thereof | |
| Gottschalck et al. | Nucleotide sequence analysis of Aleutian mink disease parvovirus shows that multiple virus types are present in infected mink | |
| Wang et al. | Cloning of the genome of a goose parvovirus vaccine strain SYG61v and rescue of infectious virions from recombinant plasmid in embryonated goose eggs | |
| CN107254451A (en) | The parvovirus of attenuation living | |
| CN100425291C (en) | O-type foot-and-mouth disease virus poly-gene duplication defect type adenovirus active carrier vaccine and process for preparing the same | |
| Wang et al. | Sequencing and generation of an infectious clone of the pathogenic goose parvovirus strain LH | |
| CN104292339A (en) | Recombinant protein containing SARS virus RBD antigen and baculovirus displaying RBD protein | |
| CN104873966A (en) | Method for purifying porcine circovirus type 2 virus-like particles and preparation method of vaccine of porcine circovirus type 2 virus-like particles | |
| CN101418314A (en) | Goat pox vaccine strain expression vector | |
| CN110452889B (en) | Construction method and primary application of recombinant bovine enterovirus expressing BVDV-E0 | |
| CN100489092C (en) | Type II genetic marker strain of porcine circovirus and its application | |
| AU2020103776A4 (en) | Koi herpesvirus (khv) orf-149-based carbon nanotube supported nucleic acid vaccine and application thereof | |
| CN104587459B (en) | Express PCV2 Cap recombinant swinepox virus carrier bacterin | |
| CN104436187A (en) | Vaccine for expressing rabbit hemorrhagic disease virus VP60 protein | |
| CN104292338B (en) | Recombinant protein containing SARS virus N antigen and baculovirus displaying N protein | |
| CN103014043B (en) | Safe carrier for seed viruses of inactivated vaccine for foot-and-mouth disease and application thereof | |
| CN104403006B (en) | Mink Parvovirus virus-like particle and preparation method and application | |
| CN104293740A (en) | Recombinant baculovirus with surface displaying SARS bivalent antigen, and preparation method and application thereof | |
| CN109136200A (en) | A kind of recombination infectious hematopoietic necrosis poison and its construction method and application | |
| CN109295095A (en) | A kind of Newcastle disease attenuated strain exogenous gene expression carrier of heat-staple gene VIII type |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220208 Address after: 330000 Room 501, unit 3, building 5, zone 2, No. 888, Lushan middle Avenue, Nanchang Economic and Technological Development Zone, Jiangxi Province Patentee after: Deng Shunzhou Patentee after: Jiang Xinhua Patentee after: Chen Songchang Patentee after: Zhang Wenbo Patentee after: Wan Wenzhong Patentee after: Wang Jianmin Patentee after: Dai Yimin Patentee after: Jiangxi jinyibo Biotechnology Co.,Ltd. Address before: 330000 Songhe Road, Yingshang intersection, Changbei Economic Development Zone, Nanchang City, Jiangxi Province Patentee before: Deng Shunzhou Patentee before: Jiang Xinhua Patentee before: Chen Songchang Patentee before: Zhang Wenbo Patentee before: Wan Wenzhong Patentee before: Wang Jianmin Patentee before: Dai Yimin Patentee before: NANCHANG JINMU ANIMAL HEALTH SERVICES Co.,Ltd. |