CN104561307A - Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer - Google Patents

Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer Download PDF

Info

Publication number
CN104561307A
CN104561307A CN201510001950.0A CN201510001950A CN104561307A CN 104561307 A CN104561307 A CN 104561307A CN 201510001950 A CN201510001950 A CN 201510001950A CN 104561307 A CN104561307 A CN 104561307A
Authority
CN
China
Prior art keywords
primer
deoxynivalenol
pcr
ethanoyl
nivalenol
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510001950.0A
Other languages
Chinese (zh)
Other versions
CN104561307B (en
Inventor
仇剑波
董飞
徐剑宏
史建荣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nanjing Microdetection Biological Technology Co ltd
Original Assignee
Jiangsu Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jiangsu Academy of Agricultural Sciences filed Critical Jiangsu Academy of Agricultural Sciences
Priority to CN201510001950.0A priority Critical patent/CN104561307B/en
Publication of CN104561307A publication Critical patent/CN104561307A/en
Application granted granted Critical
Publication of CN104561307B publication Critical patent/CN104561307B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a set of primer for detecting trichothecene group B-class toxin of fusaria through PCR (polymerase chain reaction). The primer comprises a share sense primer F shown in SEQID NO.1, 3-acetyl deoxygenation nivalenol reverse primer R1 shown in SEQID NO.2, 15-acetyl deoxygenation nivalenol reverse primer R2 shown in SEQID NO.3 and nivalenol reverse primer R3 shown in SEQID NO.4; the set of the primers can be applied to the PCR for directly detecting 3-acetyl deoxygenation nivalenol, 15-acetyl deoxygenation nivalenol and nivalenol. The primer is low in cost, simple in operation, short in consumption time, accurate in testing result and easy for large-scale popularization and application.

Description

Sickle-like bacteria Trichothecenes category-B toxin PCR detects primer and application thereof
Technical field
The invention belongs to field of detection of food safety, particularly sickle-like bacteria Trichothecenes category-B toxin PCR detects primer and application thereof.
Background technology
Be a kind of important popular disease in world wide by the microbial head blight of reaping hook (Fusarium head blight or scab), it can endanger multiple cereal crops such as comprising barley, wheat, corn, paddy rice.Along with global climate warms and the abnormality of regional climate and the change of cropping system, the occurrence frequency of disease increases, and generation area constantly expands.Head blight not only causes the output heavy losses of cereal, and sickle-like bacteria can produce multiple mycotoxins, and reduce the quality of Fodder and food, the health of serious threat humans and animals, carrys out major hidden danger to food securing band.
Trichothecenes toxin is the most important mycotoxins that sickle-like bacteria produces, and is mainly divided into A, B two class.It can suppress the synthesis of eukaryotic cell protein, destroy the cotton dress system of people and animals, poisoner is made to occur vomiting, diarrhoea, the multiple symptoms such as dizziness, also have certain teratogenesis and carinogenicity simultaneously, according to the difference of chemical structure, category-B Trichothecenes toxin can be divided into 3-ethanoyl deoxynivalenol (3-acetyldeoxynivalenol, be called for short 3ADON), 15-ethanoyl deoxynivalenol (15-acetyldeoxynivalenol, be called for short 15ADON) and nivalenol (nivalenol, be called for short NIV), at the main Mai Qu of China, Fusarium graminearum is that (Fusarium graminearum Schwabe) causes the topmost pathogen of head blight, also be the main pathogenic fungi of synthesis category-B Trichothecenes toxin simultaneously, have a strong impact on the safety of humans and animals.
At present, the detection method of mycotoxin levels has biology detection usually, Physico-chemical tests method, immunochemistry detection method etc., bioassay method analyzes the reasons such as inaccurate owing to lacking unified standardizing standard and detecting, and fails to be used widely in actual Fusarium toxin detects; Chemical assay is at present for the main method of Fusarium toxin assay, and be characterized in accurate, reproducible, but the sample cleanup that the method requires is more loaded down with trivial details, technology content requires higher, can not meet the requirement of rapid detection; Immunoassay, simple to operate, expense is lower, but because normal containing some other derivatives in the toxin detected, so the result measured is often inaccurate, easily occurs false positive; These three kinds of detection methods are all unsuitable for quick, sensitive and accurate detection category-B Trichothecenes endotoxin contamination.
In recent years, along with the genomic announcement of multiple sickle-like bacteria, developing rapidly of molecular biology research, researchist both domestic and external is in the synthesis of Trichothecenes toxin, toxin synthetic gene expression regulation and control aspect achieves important achievement, confirm the vital role of some genes in toxin pathways metabolism, based on the sequence information of these results of study and genes involved, set up a kind of simple and quick, cheap toxins checking method becomes the focus that country variant researchist explores, Kim etc. utilize Tri5, the gene order of Tri7 and Tri13, have detected production (the Kim et al.Polymorphism of trichothecene biosynthesis genes in deoxynivalenol-andnivalenol-producing Fusarium graminearum isolates.Mycol Res.2003 from the Fusarium graminearum DON in multiple host and NIV toxin, 107:190-197), but the authentication method complex operation of Tri5, and costly, be difficult in practice be used widely, Chandler etc. utilize the gene order of Tri7 and Tri13, design 10 pairs of primers and have detected three kinds of toxigenic situations of sickle-like bacteria, but there is phenomenon (the Chandler et al.Development of PCR assays to Tri7 and Tri13 trichothecenebiosynthetic genes that between multipair primer, detected result is inconsistent, and characterisation of chemotypes of Fusarium graminearum, Fusarium culmorum and Fusarium cerealis.Physiol.Mol.Plant Pathol.2003, 62:355-367), Li etc. (2005) are by analyzing Fusarium graminearum Tri5 ~ Tri6 gene interstitial area sequence, devise the primer distinguishing DON and NIV chemotype, by the detection to China's 364 bacterial strains, prove that this is fine to the stability of primer, be applicable to the extensive detection of Fusarium graminearum chemotype, but this technology can not distinguish two kinds of derivatives (Li et al.Development of a generic PCR detectionof deoxynivalenol-and nivalenol-chemotypes of Fusarium graminearum.FEMSMicrobiol.Lett.2005 of DON toxin, 243:505-511), Wang etc. compare to Tri13 gene order, devise Auele Specific Primer, synthesis NIV can be distinguished simultaneously, bacterial strain (the Wang et al.Development of a Generic PCR Detection of 3-Acetyldeoxynivalenol-of 3ADON and 15ADON, 15-Acetyldeoxynivalenol-and Nivalenol-Chemotypes of Fusarium graminearumClade.Int.J.Mol.Sci.2008, 9:2495-2504), but up-to-date research shows that this has occurred the problem that detected result misfits (Wang et al.A multiplex PCR assay for geneticchemotyping of toxigenic Fusarium graminearum and wheat grains for3-acetyldeoxynivalenol equally to primer, 15-acetyldeoxynivalenol and nivalenol mycotoxin.J.FoodAgric.Environ.2012, 10:505-511), due to some above defects, constrain the practical application of these methods toxin in grain and food safety.
Summary of the invention
For the problems referred to above, provide one group of sickle-like bacteria Trichothecenes category-B toxin PCR to detect primer, this group primer can by a PCR reaction, and detect the type of three kinds of Trichothecenes race category-B toxin, the present invention is achieved in that simultaneously
One group of sickle-like bacteria Trichothecenes category-B toxin PCR detects primer; comprise the shared upstream primer F as shown in SEQ ID NO.1; 3-ethanoyl deoxynivalenol downstream primer R1 as shown in SEQ ID NO.2; 15-ethanoyl deoxynivalenol downstream primer R2 as shown in SEQ ID NO.3, the nivalenol downstream primer R3 as shown in SEQ ID NO.4.
The Trichothecenes of sickle-like bacteria described in the present invention category-B toxin PCR detects the application of primer in PCR detection 3-ethanoyl deoxynivalenol, 15-ethanoyl deoxynivalenol and nivalenol.
In application of the present invention, described PCR detects and refers to: with detected material DNA for template, carry out PCR reaction, carry out gel electrophoresis to PCR reaction product, if there is 376bp specific band in electrophoresis product, then contain 3-ethanoyl deoxynivalenol in test material; If there is 443bp specific band in electrophoresis product, then contain 15-ethanoyl deoxynivalenol in test material; If there is 246bp specific band in electrophoresis product, then contain nivalenol in test material.
In application of the present invention; the reaction system of PCR reaction is: 50ng template DNA; 2.5 μ L 10 × PCR Buffer damping fluids; the dNTPs 1 μ L of 1.25mM; Taq archaeal dna polymerase 0.3 μ L; the shared upstream primer F 0.6 μ L of 10 μMs, the 3-ethanoyl deoxynivalenol downstream primer R1 of 10 μMs, the 15-ethanoyl deoxynivalenol downstream primer R2 of 10 μMs, nivalenol downstream primer R3 each 0.2 μ L, the ddH of 10 μMs 20 complements to 20 μ L; PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 30 circulations; 72 DEG C of 10min.
The present invention utilizes the Mycotoxin Produced By Fusarium Graminearum synthetic gene Tri5 sequences Design Auele Specific Primer announced in NCBI, carry out PCR detection, whether 376bp is contained according in reaction product, 443bp, the specific band of 246bp, judge in test material right containing 3-ethanoyl deoxynivalenol (3ADON), 15-ethanoyl deoxynivalenol (15ADON) and nivalenol (NIV), the present invention is by a PCR electrophoresis reaction, get final product the type of direct-detection sickle-like bacteria Trichothecenes category-B toxin, cost is low, simple to operate, short (about 1.5h) consuming time, detected result is accurate, be easy to large-scale promotion application.
Accompanying drawing explanation
Fig. 1 is the PCR-electrophoresis detection result of sickle-like bacteria bacterial strain;
Fig. 2 is the PCR-electrophoresis detection result of wheat and maize seed.
Embodiment
The primer sequence related in embodiment:
Share upstream primer F:TGCATGGCGGATCTATCTATTCACT;
3-ethanoyl deoxynivalenol downstream primer R1:ATGACCCAAGCCATTCATGCGT;
15-ethanoyl deoxynivalenol downstream primer R2:
GACGTGATTTCAAGGAAATGCTTC；
Nivalenol downstream primer R3:CAGGTAAATAATACAATCGG;
Substratum/reagent designed by embodiment:
PDA substratum: potato 200g, glucose 20g, agar powder 15g, distilled water is settled to 1000ml; Contain in the extracting solution that embodiment relates to: 100mmolL -1tris-HCl (pH 8.0), 20mmolL -1eDTA (pH 8.0), 1.5molL -1naCl, and the CTAB accounting for extracting solution quality 2%.
Embodiment 1 sickle-like bacteria bacterial strain detects
This example sickle-like bacteria bacterial strain used gathers in different this areas of China, and its toxin producing type is determined (table 1) through LC/MS.
Strain number Host Type of toxin PCR primer length
76-25 Wheat 3ADON 376
76-139 Wheat 3ADON 376
98-59 Wheat 15ADON 443
98-121 Wheat NIV 246
98-156 Wheat NIV 246
R15 Paddy rice 3ADON 376
R21 Paddy rice 3ADON 376
R26 Paddy rice 3ADON 376
R39 Paddy rice 15ADON 443
R45 Paddy rice NIV 246
JS05 Corn 3ADON 376
JS16 Corn 15ADON 443
AH13 Corn 15ADON 443
AH37 Corn NIV 246
(1) template DNA extracts: by the sickle-like bacteria bacterial strain that collects 25 DEG C of activation culture three days in PDA substratum respectively, the a small amount of mycelia of picking, to 1.5ml centrifuge tube, adds 500 μ L extracting solutions, 37 DEG C of shaking table vibration 30min, the centrifugal 1min of 12000rpm, get supernatant and add 400 μ L dehydrated alcohols, mix and place 30min, the then centrifugal 1min of 12000rpm at-20 DEG C of refrigerators, abandon supernatant, get precipitation 200 μ L 70% ethanol purge, room temperature is placed dry rear 100 μ L aqua sterilisas and is dissolved, for subsequent use.
(2) PCR reaction: the DNA obtained with step 1, for template, carries out PCR reaction,
Reaction system is: 50ng template DNA; 2.5 μ L 10 × PCR Buffer damping fluids; the dNTPs1 μ L of 1.25mM; Taq archaeal dna polymerase 0.3 μ L; the shared upstream primer F 0.6 μ L of 10 μMs; the 3-ethanoyl deoxynivalenol downstream primer R1 of 10 μMs, the 15-ethanoyl deoxynivalenol downstream primer R2 of 10 μMs, nivalenol downstream primer R3 each 0.2 μ L, the ddH of 10 μMs 20 complements to 20 μ L.
PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 30 circulations; 72 DEG C of 10min.
(3) electrophoresis detection: after step 2 reaction terminates, get 5 μ LPCR products electrophoresis in 2.0% sepharose, take a picture under gel imaging system medium ultraviolet lamp, size result of determination according to amplified production: if there is 376bp specific band in electrophoresis product, then contain 3-ethanoyl deoxynivalenol in test material; If there is 443bp specific band in electrophoresis product, then contain 15-ethanoyl deoxynivalenol in test material; If there is 246bp specific band in electrophoresis product, then contain nivalenol in test material.
As shown in Figure 1, wherein M swimming lane is standard value to the present embodiment electrophoresis result, and wherein 1-4 swimming lane is respectively 98-121,98-156, R45, AH37, amplifies 246bp specific band; 5-10 swimming lane is respectively the specific band that 76-25,76-139, R15, R21, R26, JS05 amplify 376bp; 11-14 swimming lane is respectively 98-59, R39, JS16, AH13, amplifies the specific band of 443bp, conforms to LC/MS.
Embodiment 2 wheat and maize seed sickle-like bacteria Trichothecenes category-B Mycotoxin identification
The wheat and maize sample getting field natural occurrence is some, grinds, and carries out template DNA extraction, and extracting method embodiment 1 is identical, and the Type of toxin that sample contains and content are in table 2.
PCR reaction is identical with embodiment 1 with electrophoretic detection, detected result as shown in Figure 2, wherein M swimming lane is standard value, its swimming lane numbering and sample number into spectrum one_to_one corresponding, wherein, the wheat samples of swimming lane 1,2, amplify two specific bands of 443bp and 376bp, the wheat samples of swimming lane 3,4, amplify three specific bands of 443bp, 376bp and 246bp, the corn sample of swimming lane 5,6, amplifies two specific bands of 443bp and 376bp.
Sample 1-6 toxin producing type is verified through LC/MS the same period, and result is identical.
SEQUENCE LISTING
 
<110> Jiangsu Province Agriculture Science Institute
 
<120> sickle-like bacteria Trichothecenes category-B toxin PCR detects primer and application thereof
 
<130> 4
 
<160> 4
 
<170> PatentIn version 3.3
 
<210> 1
<211> 25
<212> DNA
<213> artificial sequence
 
<400> 1
tgcatggcgg atctatctat tcact 25
 
 
<210> 2
<211> 22
<212> DNA
<213> artificial sequence
 
<400> 2
atgacccaag ccattcatgc gt 22
 
 
<210> 3
<211> 24
<212> DNA
<213> artificial sequence
 
<400> 3
gacgtgattt caaggaaatg cttc 24
 
 
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
 
<400> 4
caggtaaata atacaatcgg 20
 
 

Claims (4)

1. one group of sickle-like bacteria Trichothecenes category-B toxin PCR detects primer; comprise the shared upstream primer F as shown in SEQ ID NO.1; 3-ethanoyl deoxynivalenol downstream primer R1 as shown in SEQ ID NO.2; 15-ethanoyl deoxynivalenol downstream primer R2 as shown in SEQ ID NO.3, the nivalenol downstream primer R3 as shown in SEQ ID NO.4.
2. sickle-like bacteria Trichothecenes category-B toxin PCR detects the application of primer in PCR detection 3-ethanoyl deoxynivalenol, 15-ethanoyl deoxynivalenol and nivalenol as claimed in claim 1.
3. application according to claim 2, it is characterized in that, described PCR detects and refers to: with detected material DNA for template, carry out PCR reaction, gel electrophoresis is carried out to PCR reaction product, if there is 376bp specific band in electrophoresis product, then contain 3-ethanoyl deoxynivalenol in test material; If there is 443bp specific band in electrophoresis product, then contain 15-ethanoyl deoxynivalenol in test material; If there is 246bp specific band in electrophoresis product, then contain nivalenol in test material.
4. require the application described in 3 according to power; it is characterized in that; the reaction system of described PCR reaction is: 50ng template DNA; 2.5 μ L 10 × PCR Buffer damping fluids; the dNTPs 1 μ L of 1.25mM; Taq archaeal dna polymerase 0.3 μ L; the shared upstream primer F 0.6 μ L of 10 μMs; the 3-ethanoyl deoxynivalenol downstream primer R1 of 10 μMs, the 15-ethanoyl deoxynivalenol downstream primer R2 of 10 μMs, nivalenol downstream primer R3 each 0.2 μ L, the ddH of 10 μMs 20 complements to 20 μ L;
PCR reaction conditions: 94 DEG C of 5min; 94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s, 30 circulations; 72 DEG C of 10min.
CN201510001950.0A 2015-01-05 2015-01-05 Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer Active CN104561307B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510001950.0A CN104561307B (en) 2015-01-05 2015-01-05 Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510001950.0A CN104561307B (en) 2015-01-05 2015-01-05 Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer

Publications (2)

Publication Number Publication Date
CN104561307A true CN104561307A (en) 2015-04-29
CN104561307B CN104561307B (en) 2017-01-18

Family

ID=53078381

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510001950.0A Active CN104561307B (en) 2015-01-05 2015-01-05 Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer

Country Status (1)

Country Link
CN (1) CN104561307B (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101816560B1 (en) 2015-10-22 2018-01-09 대한민국 Primer set for detecting Gibberella zeae and allied species producing type B trichothecenes and detecting method using the same
CN110172526A (en) * 2019-06-17 2019-08-27 上海市农业科学院 A kind of Rapid identification Fusarium graminearum produces kit and its application of virus gene type
CN110616155A (en) * 2019-10-15 2019-12-27 江苏省农业科学院 Wild strain for high yield of nivalenol and construction method of mutant thereof
CN110951846A (en) * 2019-12-26 2020-04-03 南通科技职业学院 Method for detecting vomitoxin in beer
CN111363836A (en) * 2019-12-26 2020-07-03 南京农业大学 Application of SDHC subunit genetically differentiated by fusarium as drug target resource in drug research and development

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102443589A (en) * 2010-10-09 2012-05-09 华中农业大学 Molecular identification method of trichothecene type-B toxins of fusarium

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102443589A (en) * 2010-10-09 2012-05-09 华中农业大学 Molecular identification method of trichothecene type-B toxins of fusarium

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JIANBO QIU ETAL: "Genetic Relationships，Carbendazim Sensitivity and Mycotoxin Production of the Fusarium Graminearum Populations from Maize, Wheat and Rice in Eastern China", 《TOXINS》 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101816560B1 (en) 2015-10-22 2018-01-09 대한민국 Primer set for detecting Gibberella zeae and allied species producing type B trichothecenes and detecting method using the same
CN110172526A (en) * 2019-06-17 2019-08-27 上海市农业科学院 A kind of Rapid identification Fusarium graminearum produces kit and its application of virus gene type
CN110172526B (en) * 2019-06-17 2022-05-13 上海市农业科学院 Kit for rapidly identifying toxigenic genotype of fusarium graminearum and application thereof
CN110616155A (en) * 2019-10-15 2019-12-27 江苏省农业科学院 Wild strain for high yield of nivalenol and construction method of mutant thereof
CN110951846A (en) * 2019-12-26 2020-04-03 南通科技职业学院 Method for detecting vomitoxin in beer
CN111363836A (en) * 2019-12-26 2020-07-03 南京农业大学 Application of SDHC subunit genetically differentiated by fusarium as drug target resource in drug research and development
CN111363836B (en) * 2019-12-26 2022-11-22 南京农业大学 Application of SDHC subunit genetically differentiated by fusarium as drug target resource in drug research and development

Also Published As

Publication number Publication date
CN104561307B (en) 2017-01-18

Similar Documents

Publication Publication Date Title
CN104561307A (en) Primer for detecting trichothecene group B-class toxin of fusaria through PCR and application of primer
Herrera et al. Strain-dependent variation in 18S ribosomal DNA copy numbers in Aspergillus fumigatus
CN101812512B (en) Compound gene chip for detecting transgenic foods
Bevitori et al. Selection of optimized candidate reference genes for qRT-PCR normalization in rice (Oryza sativa L.) during Magnaporthe oryzae infection and drought.
Kulik et al. Quantification of Alternaria, Cladosporium, Fusarium and Penicillium verrucosum in conventional and organic grains by qPCR
Yörük et al. Characterization of high-level deoxynivalenol producer Fusarium graminearum and F. culmorum isolates caused head blight and crown rot diseases in Turkey
CN102094080B (en) Quick molecular detection method for simultaneously detecting three kinds of fusarium toxins and application thereof
Ramachandran et al. Improved multiplex TaqMan qPCR assay with universal internal control offers reliable and accurate detection of Clavibacter michiganensis
CN104263833A (en) Nucleic acid film strip and kit for identification of candida species and detection of gene mutation
CN1312475C (en) Molecular detection method for fusarium toxin
CN102154278A (en) Rapid detection method for Tilletia controversa Kuhn and specific SCAR (sequence characterized amplified region) marker thereof
CN106701909A (en) Primer probe for detecting sweet potato-derived components as well as method and kit
CN102443590B (en) Molecular identification method of trichothecene type-A toxins of fusarium
CN100392103C (en) Molecular detection method for Fusarium circinatum
CN102443589B (en) Molecular identification method of trichothecene type-B toxins of fusarium
CN112126709A (en) Method for detecting corn transgenic components by quadruple real-time fluorescent PCR
CN102533981B (en) Primer and detection method as well as kit for rapidly detecting bacillus subtilis
CN101591704B (en) Detection kit for detecting three spore production bacteria in food and detection method thereof
CN103882109B (en) The molecular detecting method of sugarcane toppers maize ear rot pathogenic bacteria microspecies gx1
Zhang et al. Identification of tps2 used as an endogenous reference gene in qualitative and real-time quantitative pcr detection of flammulina velutipes
Deepa et al. Molecular technologies for the early detection of fungal phytopathogens associated with cereal crops
CN101701258A (en) Primer for PCR identification of kidney bean and PCR identification method
CN105420372A (en) PCR primer for detecting alternaria kikuchiana and detection method using same
CN102952851B (en) Primer for detecting kind and/or purity of malting barley, and kit and method thereof
Kuzdraliński et al. Development and application of a new PCR method for detection of Blumeria graminis f. sp. tritici

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20220701

Address after: 210061 5th floor, building 02, accelerator phase II, No. 11, Yaogu Avenue, Jiangbei new district, Nanjing City, Jiangsu Province

Patentee after: NANJING MICRODETECTION BIOLOGICAL TECHNOLOGY CO.,LTD.

Address before: Zhong Ling Jie Nanjing Xuanwu District of Jiangsu Province, No. 50 210014

Patentee before: JIANGSU ACADEMY OF AGRICULTURAL SCIENCES