CN101701258A - Primer for PCR identification of kidney bean and PCR identification method - Google Patents
Primer for PCR identification of kidney bean and PCR identification method Download PDFInfo
- Publication number
- CN101701258A CN101701258A CN200910238021A CN200910238021A CN101701258A CN 101701258 A CN101701258 A CN 101701258A CN 200910238021 A CN200910238021 A CN 200910238021A CN 200910238021 A CN200910238021 A CN 200910238021A CN 101701258 A CN101701258 A CN 101701258A
- Authority
- CN
- China
- Prior art keywords
- kidney bean
- pcr
- primers
- primer
- combination
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer for PCR identification of kidney beans and a PCR identification method, wherein the primer can amplify chloroplast trnL genes of the kidney beans to generate specific amplified fragments of the kidney beans, and concrete nucleotide sequences are shown as sequence tables SEQ ID No. 1&2 and No. 3&4. The PCR identification method of the kidney beans comprises the following steps: utilizing the primer for PCR amplification by taking the total DNA of a sample as a template, and judging results according to agarose electrophoresis after reaction is finished. The primer has good specificity, high accuracy and good sensitivity, and a rapid and simple detection method is provided for identifying the species resource of the kidney beans.
Description
Technical field
The present invention relates to the biological detection authenticate technology, relate in particular to and the Kidney bean Biological resources are carried out PCR identify with primer and use the PCR authentication method of this primer.
Background technology
Kidney bean Phaseolus vulgaris, calling string bean, kidney bean, beautiful beans etc., belong to the crop of high protein, lower fat, medium starch content, is crucial vegetable-protein source, have higher edibleness, it still is the very high feed of nutritive value in addition.The pharmaceutical use of Kidney bean is also very high, and its seed can be used as medicine, and nature and flavor are sweet flat, and nourishing, analgesic, diuretic actions are arranged, and treatment oedema, vitamin B1 deficiency are had extraordinary curative effect.Also contain phytohemagglutinin in tender pod of Kidney bean and the seed, be a kind of glycoprotein, the aggegation human body cell is arranged, stimulate lymphocyte embryo shape to transform, suppress effects such as white corpuscle, lymphocyte transfer, and in cooperating oncotherapy, can improve chemotherapy and radiotherapeutic curative effect.Along with China joined WTO, agricultural-food international competition pressure is bigger, and crop mix must be adjusted, and Kidney bean can play an important role in the crop mix adjustment, and Kidney bean still is the traditional exported product of China in addition.For preventing the loss of China's Germplasm Resources on Phaseolus Vulgaris, the social productive forces of China are caused loss difficult to the appraisal, should strengthen protection and research work to China's Kidney bean resource.
In the past, the beans kind distinguished and identified all be that difference according to the varietal characteristic in the cultivation process is carried out.That is, by beans is carried out secular cultivation, the feature in its developmental process of tracing study, thus identify.This cultivar identification method needs 1 year at least.Especially, for the beans of approximate kind,, be difficult for by visual discriminating because of its no significant difference on features such as shape and color.In addition, appearance along with modern biotechnology, making genetic resources more is to carry departure with the genetic material form of non-living body, makes the port examination difficult more, thereby studies and set up effective genetic resources departure and check authentication method and relevant capacity building just to seem very necessary.
On the other hand, utilize the gene amplification method of PCR (polymerase chain reaction) to be widely used in every field.The PCR method is that the DNA with denier is a template, in the short period of time target DNA zone is expanded to hundreds thousand of times method, extensively is used in medical science and microorganism field because of its precision is high.In the agricultural-food field, the existing method of utilizing RAPD (randomly amplified polymorphic DNA) method that the rice veriety is differentiated.And as the Kidney bean of the important plant germplasm resource of China, it is detected identification both at home and abroad at present to only limit on the form, do not see the research of relevant its molecular assay method.
Above-mentionedly be used to differentiate that the RAPD method of rice veriety is to be template with the genomic dna, short polymorphic at random nucleotide sequence (being generally 10 base pairs) with single synthetic is a primer, under thermostable DNA polymerases (Taq enzyme) effect, carry out pcr amplification.Amplified production separates, behind the ethidium bromide staining, detects polymorphism on the ultraviolet scenograph through agarose or polyacrylamide gel electrophoresis.The polymorphism of amplified production has reflected genomic polymorphism.Because this method is to select the RAPD mark from primer at random, therefore, also can identify even without the genomic information of want identification of species.But this method has following shortcoming: owing to used the short primer of 10 the base pair degree of respectively doing for oneself, so annealing temperature is lower, cause non-specific amplification because of the annealing mishandle easily.And, comprise among the PCR of use RAPD mark and identify required specific amplified fragment and unnecessary amplified fragments, produce a plurality of PCR products, therefore repeatability is relatively poor, and identifying needs masterful technique.
In sum; in order to protect Germplasm Resources on Phaseolus Vulgaris; need set up a kind of can distinguishing from the Kidney bean that form is judged to being difficult to; and suitable port examination is used; simple and accurate biological assay method prevents that with this Kidney bean can not be carried departure with non-traditional forms such as non-living body genetic material forms.
Summary of the invention
Problem to be solved by this invention is that the PCR evaluation that a kind of Kidney bean is provided is carried out simple and accurate identify to being difficult to from the Kidney bean that form is judged with primer and PCR authentication method.
Problem to be solved by this invention is, provides a kind of PCR of Kidney bean to identify with primer and PCR authentication method, can contain detection/evaluation Kidney bean the processed goods of Kidney bean and the germ plasm resource from raw material.
The present invention is in order to solve above-mentioned problem, using PCR method studies the molecular detecting method of Kidney bean, by trnL sequences Design special primer, thereby set up stable to Kidney bean, authentication method, cost are low efficiently, can judge whether have Kidney bean nucleic acid to exist according to the plain agar sugar electrophoresis to amplified production.
The dna sequencing technology is one of the widest technology of using in the present species Study on Identification.And main research chloroplast DNA (the chloroplast DNA that concentrates in the research of plant pedigree geography, cpDNA) fragment: characteristics such as this genome has that molecular weight is little, monolepsis, multiple copied, simple in structure and base sequence reorganization are few help carrying out genetic analysis.In addition, some zone of plant chloroplast gene, particularly there is higher relatively nucleotide subsitution rate in some non-coding regions, not only are suitable for the sibship between definite species, equally also are suitable for the species Study on Identification.
The intron non-coding area sequence of trnL gene of plant chloroplast genome, coding tRNA is subjected to that extraneous selective pressure is little, evolutionary rate fast, the more information site with systematics meaning can be provided, be used for more low taxonomic category and in the recent period between the differentiation monoid phylogeny and plant between, the Study on Identification of kind.For this reason, the inventor measures the trnL sequence (the trnL sequence of Kidney bean is with reference to SEQ ID No.5) of Kidney bean and sibling species platymiscium thereof and compares, and provides effective molecule marker system in the hope of the discriminating for Kidney bean.
The invention provides Kidney bean PCR evaluation and use combination of primers, it is characterized in that, can the DNA of Kidney bean be increased, generate Kidney bean specific amplified fragment.
The invention provides Kidney bean PCR evaluation and use combination of primers I, its nucleotides sequence is classified as:
Forward: 5 '-GAATCCTTTCACCAAAATTCCA-3 '
Oppositely: 5 '-TTTCAACTTCGAGTTGGTTTGA-3 '.
The present invention also provides a kind of Kidney bean PCR to identify and uses combination of primers II, and its nucleotides sequence is classified as:
Forward: 5 '-TAACAAACGAAATTGACG-3 '
Oppositely: 5 '-TCCGATTATGATAAAGTGAA-3 '.
The present invention is by on the basis of analyzing leguminous plants chloroplast(id) trnL gene orders such as Kidney bean and its sibling species, and the design special primer can carry out qualitative detection to Kidney bean quickly and accurately.Primer of the present invention can well known to a person skilled in the art that the DNA synthetic technology that chemical synthesis process carries out obtains by utilization.The inventor has designed primer according to the special base site on the Kidney bean trnL sequence on the basis of the trnL sequence of corresponding plants being measured and being compared, therefore only Kidney bean is had amplified signal, and other control materials do not have the purpose amplified signal.
In addition, the invention provides a kind of Kidney bean PCR authentication method, this method is a template with the sample total DNA, utilizes above-mentioned combination of primers I to carry out pcr amplification, reaction finishes the back and judges positive findings according to the specific amplification band of agarose gel electrophoresis 164bp.
The present invention also provides a kind of Kidney bean PCR authentication method, and this method is a template with the sample total DNA, utilizes above-mentioned combination of primers II to carry out pcr amplification, and reaction finishes the back and judges positive findings according to the specific amplification band of agarose gel electrophoresis 255bp.
PCR25 μ L reaction system: sample DNA 1 μ L (10-50ng), 10 * PCR buffer (Mg
2+Free) 2.5 μ L, 25mM MgCL
22 μ L, 10mM dNTPs 2 μ L, 10 μ MPrimers, 2 μ L, 5U/ μ L Taq DNA polymerase 0.1 μ L, ddH
2O 15.4 μ L.
The reaction conditions of combination of primers I: 94 ℃ of pre-sex change, 3min, again through 94 ℃ of sex change 30sec, 66 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min.
The reaction conditions of combination of primers II: 94 ℃ of pre-sex change, 3min, again through 94 ℃ of sex change 30sec, 48 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min.
The present invention also provides a kind of Kidney bean PCR identification kit, comprises that above-mentioned combination of primers I is or/and II.
Primer of the present invention and related reagent can be assembled into test kit, use with convenient.Test kit of the present invention is formed by a plurality of partition, to hold fixing one or more container as pipe or bottle.One of these containers or a plurality of primer of the present invention can be housed, this primer can be lyophilized form or be dissolved in state in the damping fluid as required.In addition, can also comprise one or more enzyme/reagent that are used for the PCR reaction in the test kit of the present invention, and implement other composition and the apparatus of wanting required for the present invention.
The sample source that uses primer of the present invention and method to identify comprises, the seed of Kidney bean, leaflet, Kidney bean processed goods and Germplasm Resources on Phaseolus Vulgaris, but be not limited thereto.
The primer of the application of the invention increases to the DNA of survey Kidney bean, generates Kidney bean specific amplified fragment, thereby can simply and accurately identify Kidney bean.And primer of the present invention is only to purpose fragment specific amplified, and therefore other zone of can not increasing also can be used among a PCR and import in the multiplex PCR of two or more primers, thereby can shorten test period effectively.And, the easy detection method that use at suitable port has been set up in this research, promptly directly detect Kidney bean from pulse family class material into and out of the border, swift to operate, the result is accurate, avoided having complied with the characteristics of current port testing with expending time in and easy defective of slipping that traditional typoiogical classification and cytology method are produced.
Description of drawings
Fig. 1 is a Kidney bean specific detection experimental result of utilizing combination of primers I of the present invention;
Fig. 2 is a Kidney bean specific detection experimental result of utilizing combination of primers II of the present invention;
Among the figure, 1: root of Szemao crotalaria, 2: broad bean, 3: Kidney bean, 4: pea,
5: Zi Gong winter beans, 6: Jilin granule, 7: Shanxi beans 21,8: Ji beans 12,
9: wild soybean 236,10: agree farming 18,11: Japan is fine, 12: corn,
13: China spring, CK: the water contrast.
Embodiment
Following embodiment is used for further specifying of the present invention, but is not used for limiting the scope of the invention.
According to dish trnL sequence, utilize software and Primer 3 design combination of primers I, primer sequence is:
Forward: 5 '-GAATCCTTTCACCAAAATTCCA-3 '
Oppositely: 5 '-TTTCAACTTCGAGTTGGTTTGA-3 '.
According to Kidney bean trnL sequence, utilize software and premier 5 design combination of primers II, primer sequence is:
Forward: 5 '-TAACAAACGAAATTGACG-3 '
Oppositely: 5 '-TCCGATTATGATAAAGTGAA-3 '.
The extraction of embodiment 2 total DNA
(1) gets 0.2~0.3g plant tissue, preserve, shred and add the liquid nitrogen grind into fine powder in the rearmounted mortar, move to sterilized 1.5mL centrifuge tube, generally be added to 1/3 volume of centrifuge tube with silica gel.
(2) in centrifuge tube, add at 65 ℃ of preheatings, 500 μ LCTAB extracting solutions (0.1M Tris-HCl, 20mM EDTA, pH 8.0 for 20g/LCTAB, 1.4M NaCl) mixing, place 65 ℃ of water-baths insulations 30 minutes.
(3) sample is taken out from water-bath, add and the isopyknic chloroform/primary isoamyl alcohol of extracting solution (24: 1), the abundant mixing of the centrifuge tube that turns upside down, 12000 rev/mins are centrifugal 15 minutes.
(4) draw supernatant liquor and place another sterilized 1.5mL centrifuge tube.
(5) add isopyknic chloroform/primary isoamyl alcohol (24: 1) again, repeating step (3), (4).
(6) dehydrated alcohol (-20 ℃ of precoolings) of adding equal-volume or two volumes is put upside down the centrifuge tube mixing gently, places-20 ℃ of refrigerators, places 30 minutes.
(7) 10000 rev/mins centrifugal 10 minutes, remove supernatant liquor, keep precipitation. the throw out of this moment is mainly DNA.
(8) add 400 μ L70% ethanol, 10000 rev/mins centrifugal 5 minutes, collecting precipitation.Place 37 ℃ or 50 ℃ of oven for drying.(9) add 100 μ L TE (perhaps aqua sterilisa) dissolving DNAs, add 2 μ L RNA enzyme A (10mg/ml) again, 37 ℃ are incubated 30 minutes.
(10) 1.0% agarose electrophoresiss detect DNA concentration and quality.
The foundation of embodiment 3PCR amplification method
1, PCR reaction system
With total DNA is template, carries out the PCR reaction, sample is arranged: sample DNA 1 μ L (10-50ng), 10 * PCR buffer (Mg in the 25 μ L reaction systems
2+Free) 2.5 μ L, 25mMMgCL
22 μ L, 10mM dNTPs 2 μ L, 10 μ M Primers, 2 μ L, 5U/ μ L Taq DNApolymerase 0.1 μ L, ddH
2O 15.4 μ L.
2, PCR reaction conditions
After sample hose put into ABI PCR instrument, according to combination of primers I following condition is set and reacts: 94 ℃ of pre-sex change, 3min, again through 94 ℃ of sex change 30sec, 66 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min; According to combination of primers II following condition being set reacts: 94 ℃ of pre-sex change, 3min, and again through 94 ℃ of sex change 30sec, 48 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min.Reaction finishes the back amplified production through the agarose gel electrophoresis result of determination.
The specificity of embodiment 4 Kidney bean PCR method is determined
With 13 total DNA of leguminous plants such as Kidney bean and its sibling specieses is template, with the water belongs with yin contrast, finishes the specific amplification band of back agarose gel electrophoresis 164bp or 255bp by the PCR reaction and judges positive findings.
Test-results:
Have only the pcr amplification product of Kidney bean positive amplification to occur, and other pulse family material and negative control all do not have the purpose amplified signal, the results are shown in Figure 1 (combination of primers I) and Fig. 2 (combination of primers II).
Sequence table
<110〉China Inst. of Quarantine Inspection Sciences
<120〉PCR of Kidney bean identifies with primer and PCR authentication method
<160>5
<170>PatentIn?version?3.3
<210>1
<211>22
<212>DNA
<213〉artificial sequence
<400>1
gaatcctttcaccaaaattcca 22
<210>2
<211>22
<212>DNA
<213〉artificial sequence
<400>2
tttcaacttcgagttggtttga 22
<210>3
<211>18
<212>DNA
<213〉artificial sequence
<400>3
taacaaacgaaattgacg 18
<210>4
<211>20
<212>DNA
<213〉artificial sequence
<400>4
tccgattatgataaagtgaa 20
<210>5
<211>500
<212>DNA
<213〉Kidney bean (Phaseolus vulgaris)
<400>5
aaattcagag?aaaccctgga?attcacaatg?ggcaatcctg?agccaaatcc?cgttttctga 60
aaaaaagaaa?aattcagaaa?gtgataataa?aaaagggata?ggtgcagaga?ctctatggaa 120
gctgttctaa?caaacgaaat?tgacgacttt?ttttcttgca?ttagtaaaag?aatcctttca 180
ccaaaattcc?aggaatggat?caaaaataaa?catttagaga?catatatata?ctgaaatact 240
ctttcaattt?attactattt?attaatgaag?atcgatttgt?gataaaaata?ttcacaaatg 300
aaagatgtga?atcaaaccaa?ctcgaagttg?aaaaaaagat?ggaatatttc?ttgatgaaat 360
tattcacttt?atcataatcg?gataaaaccc?ttgaagaact?gatcaatcag?atgagaataa 420
agatagagtc?ctattctaca?tgtcaatacc?gacaacaatg?aaattgaaag?taagaggaaa 480
atccgtcgac?ttaataaatc 500
Claims (10)
1. Kidney bean PCR identifies and uses combination of primers, it is characterized in that it can increase to the chloroplast(id) trnL gene of Kidney bean, generates Kidney bean specific amplification fragment.
2. Kidney bean PCR as claimed in claim 1 identifies and uses combination of primers that its nucleotides sequence is classified as:
Forward: 5 '-GAATCCTTTCACCAAAATTCCA-3 '
Oppositely: 5 '-TTTCAACTTCGAGTTGGTTTGA-3 '.
3. Kidney bean PCR authentication method, this method is a template with the sample total DNA, utilizes the described combination of primers of claim 2 to carry out pcr amplification, reaction finishes the back according to the agarose gel electrophoresis result of determination.
4. method as claimed in claim 3 is characterized in that, the response procedures of PCR is: 94 ℃ of pre-sex change, 3min, and again through 94 ℃ of sex change 30sec, 66 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min.
5. as the described method of claim 3 to 4, it is characterized in that sample total DNA is from seed, leaflet, Kidney bean processed goods and the Germplasm Resources on Phaseolus Vulgaris of Kidney bean.
6. Kidney bean PCR as claimed in claim 1 identifies and uses combination of primers that its nucleotides sequence is classified as:
Forward: 5 '-TAACAAACGAAATTGACG-3 '
Oppositely: 5 '-TCCGATTATGATAAAGTGAA-3 '.
7. Kidney bean PCR authentication method, this method is a template with the sample total DNA, utilizes the described combination of primers of claim 6 to carry out pcr amplification, reaction finishes the back according to the agarose gel electrophoresis result of determination.
8. method as claimed in claim 7 is characterized in that, the response procedures of PCR is: 94 ℃ of pre-sex change, 3min, and again through 94 ℃ of sex change 30sec, 48 ℃ of annealing 30sec, 72 ℃ are extended 1min, 35 circulations, last 72 ℃ are extended 5min.
9. as the described method of claim 7 to 8, it is characterized in that sample total DNA is from seed, leaflet, Kidney bean processed goods and the Germplasm Resources on Phaseolus Vulgaris of Kidney bean.
10. Kidney bean PCR identifier box, it comprises, claim 1 or 2 or 6 described combination of primers.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009102380216A CN101701258B (en) | 2009-11-13 | 2009-11-13 | Primer for PCR identification of kidney bean and PCR identification method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009102380216A CN101701258B (en) | 2009-11-13 | 2009-11-13 | Primer for PCR identification of kidney bean and PCR identification method |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101701258A true CN101701258A (en) | 2010-05-05 |
CN101701258B CN101701258B (en) | 2011-10-26 |
Family
ID=42156185
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009102380216A Expired - Fee Related CN101701258B (en) | 2009-11-13 | 2009-11-13 | Primer for PCR identification of kidney bean and PCR identification method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101701258B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102559908A (en) * | 2012-02-03 | 2012-07-11 | 中国检验检疫科学研究院 | Primer for PCR identification of Davidia involucrata Baill and PCR identification method |
CN106350518A (en) * | 2016-11-25 | 2017-01-25 | 无限极(中国)有限公司 | Primer pairs and application thereof in germplasm identification of morinda officinalis |
CN108018339A (en) * | 2018-02-05 | 2018-05-11 | 中国科学院昆明植物研究所 | The detection primer of vegetalitas DNA highly in degraded sample |
CN110564890A (en) * | 2019-10-16 | 2019-12-13 | 烟台新时代健康产业有限公司 | Multiple PCR identification method for pollen pini adulteration and special primer group and kit thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20070015192A1 (en) * | 2005-07-11 | 2007-01-18 | Hong Kong Jockey Club Institute Of Chinese Medicine Limited | Method of herbal authentication based on 5S rRNA spacer sequences |
-
2009
- 2009-11-13 CN CN2009102380216A patent/CN101701258B/en not_active Expired - Fee Related
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102559908A (en) * | 2012-02-03 | 2012-07-11 | 中国检验检疫科学研究院 | Primer for PCR identification of Davidia involucrata Baill and PCR identification method |
CN102559908B (en) * | 2012-02-03 | 2013-08-28 | 中国检验检疫科学研究院 | Primer for PCR identification of Davidia involucrata Baill and PCR identification method |
CN106350518A (en) * | 2016-11-25 | 2017-01-25 | 无限极(中国)有限公司 | Primer pairs and application thereof in germplasm identification of morinda officinalis |
CN108018339A (en) * | 2018-02-05 | 2018-05-11 | 中国科学院昆明植物研究所 | The detection primer of vegetalitas DNA highly in degraded sample |
CN108018339B (en) * | 2018-02-05 | 2021-03-19 | 中国科学院昆明植物研究所 | Detection primer for highly degrading plant DNA in sample |
CN110564890A (en) * | 2019-10-16 | 2019-12-13 | 烟台新时代健康产业有限公司 | Multiple PCR identification method for pollen pini adulteration and special primer group and kit thereof |
CN110564890B (en) * | 2019-10-16 | 2022-09-13 | 烟台新时代健康产业有限公司 | Multiple PCR identification method for pollen pini adulteration and special primer group and kit thereof |
Also Published As
Publication number | Publication date |
---|---|
CN101701258B (en) | 2011-10-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112980999B (en) | SSR molecular marker of mulberry variety Yuehei 74 and core primer group, kit and application thereof | |
CN101701258B (en) | Primer for PCR identification of kidney bean and PCR identification method | |
RS et al. | A comparative analysis of ISSR and RAPD markers for studying genetic diversity in Trigonella foenum-graecum genotypes | |
CN105063229B (en) | For detecting quantitative fluorescent PCR specific primer, probe and its kit of sheep derived material in meat products | |
CN104946758A (en) | LAMP detection primer set, detection kit and detection method for candida albicans | |
KR101073000B1 (en) | Method of discriminating ginseng cultivars using STS primers | |
CN102776286A (en) | Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation | |
CN102344953B (en) | Primer for detecting peach-derived component in sample, method and kit | |
CN102344951B (en) | Primer, method and kit for detecting pear-derived components in sample | |
CN104830984B (en) | The fluorescence PCR detecting method and the primer and probe of melon anthrax bacteria | |
CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
CN101712982A (en) | Primer pairs for detecting germs of paddy bacterial glume blight and detection method | |
CN110846433B (en) | KASP marker related to drug resistance of wheat powdery mildew and application thereof | |
CN101724707B (en) | Primer, probe and kit of detecting real-time fluorescence PCR of four allergen gluten components in foods and detection method | |
CN110592079A (en) | Rice long and thin granule gene SLG7 molecular marker primer and application thereof | |
CN113584207B (en) | Sesame fertility molecular marker, primer, kit, application and Gao Mufen element new sesame variety breeding method | |
CN101701255B (en) | Primer for PCR identification of kidney bean and identification method | |
CN101701256B (en) | Primer and method for PCR identification of maize | |
CN102776268A (en) | Kit and method for detection of transgenic maize Mon89034 and derivative varieties thereof through gene amplification at constant temperature | |
CN101701254B (en) | Primer used for pea PCR identification and PCR identification method | |
CN102344952B (en) | Primer, method and kit for detecting apple-derived materials in sample | |
CN102559908B (en) | Primer for PCR identification of Davidia involucrata Baill and PCR identification method | |
CN102296124A (en) | Method for quickly differentiating Chinese date varieties by using random amplified polymorphic DNA (RAPD) | |
CN103060436A (en) | Real-time fluorescent PCR (polymerase chain reaction) detection kit for Phomopsis helianthi M.Muntanola-Cvetkovic et al. | |
CN102876800A (en) | Quantitative detection method of phytase gene in transfer phytase gene corn or feed |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111026 Termination date: 20171113 |