CN104561003A - Micromolecule RNA of interference MCM7 gene for inhibiting glioma proliferation as well as preparation method and application thereof - Google Patents

Abstract

The invention discloses a micromolecule RNA of an interference MCM7 gene for inhibiting glioma proliferation and application thereof. The micromolecule RNA of the interference MCM7 gene is base sequences represented by the SEQ ID NO.1 and SEQ ID NO.2. The micromolecule RNA of the interference MCM7 gene with the effect of promoting the glioma proliferation is designed by the invention, the inhibition effect on the glioma proliferation is researched by using a glioma cell (U373 cell) model, and a new molecule medicine is provided for genetically treating the glioma.

Description

MicroRNA of a kind of interference MCM7 gene for suppressing glioma to be bred and its preparation method and application

Technical field

The present invention relates to biological technical field, be specifically related to a kind of small molecules interference RNA (i.e. shRNA), particularly relating to a kind of microRNA of the interference MCM7 gene for suppressing glioma to be bred; In addition, the invention still further relates to the preparation method and application of the microRNA of this interference MCM7 gene.

Background technology

MCM7 albumen is one of moiety of MCM (minichromosome maintenance) mixture, there is DNA helicase activity, participation DNA replication dna is initial, on cell proliferation, DNA damage reparation and cell cycle play important regulating and controlling effect, there is research display, MCM7 is high expression level (comprising cerebral glioma) in kinds of tumors, can as the diagnosis and prognosis index of Several Kinds of Malignancy.

Glioma betides neuroectodermal tumour, therefore also known as neuroectodermal tumors or neurotic triad.Tumor originates in neural mesenchymal cell, i.e. neuroglia, ependyma, choroid epithelium and neural parenchyma, i.e. neurone.Most of tumor originates in dissimilar neuroglia, but according to tissue generation source and biological property similar, to betiding neuroectodermal various check neoplastic disease, be generally all called neurospongioma.

The sorting technique of glioma is a lot, and what clinical workers often adopted is fairly simple Kernohan classification of classifying.In various glioma, maximum with astrocytoma, secondly be glioblastoma multiforme, be followed successively by thereafter medulloblastoma, ependymoma, oligodendroglioma, pinealoma, Mixed Gliomas, papilloma of choroid plexus, unfiled glioma and neuronal tumour.The predilection site of various glioma is different, and as astrocytoma, adult is more common in hemicerebrum, and children are then multiple at cerebellum; Glioblastoma multiforme almost all betides hemicerebrum; Medulloblastoma betides vermis of cerebellum; Ependymoma is more common in the 4th ventricles of the brain; Oligodendroglioma betides hemicerebrum mostly.

Glioma is more common with the male sex, and especially at glioblastoma multiforme, medulloblastoma, the male sex is obviously more than women.Various glioblastoma multiforme is more common in the middle age, and ependymoma is more common in children and youth, and medulloblastoma nearly all occurs in children.Also there are certain relation at the position of glioma and age, and as cerebral astrocytoma and glioblastoma multiforme are more common in adult, little cerebral glioma (astrocytoma, medulloblastoma, ependymoma) is more common in children.

Glioma is slowly fallen ill mostly, and certainly occur that symptom to consultation time is generally several weeks to the several months, minority can reach the several years.High shorter with PFT medical history of grade malignancy, tumour medical history that is more optimum or that be positioned at dead zone is longer.If tumour has hemorrhage or capsule change, symptom can increase the weight of suddenly, even has the pathogenic process of similar cerebro-vascular diseases.The clinical symptom of glioma can divide two aspects, and one is symptoms of intracranial hypertension, as headache, vomiting, visual deterioration, diplopia, mental symptom etc.; The focal symptom that another is oncothlipsis, infiltration, destruction cerebral tissue produce, can show as irritation in early days as localized epilepsy, and the later stage shows as neurological deficit symptom as paralysis.

The diagnosis of glioma, analyze according to its biological property, age, sex, predilection site and clinical course, in medical history and sign basis, adopt the auxiliary examinations such as electro physiology, ultrasonic wave, radionuclide, radiology and nucleus magnetic resonance, correct localization is almost 100%, and etiologic diagnosis accuracy can more than 90%.

RNA interference (RNA interference, RNAi) refers in the cell by double chain RNA mediate, with the mRNA of its sequence homology, selective degradation occurs, thus causes the phenomenon of silenced gene expression, and this is a kind of gene silencing mechanism of post-transcriptional level.The ultimate principle of RNA interference (RNAi) is the expression activity utilizing the double-stranded RNA (dsRNA) with homology to block rapidly sequence-specific target gene, is the instrument that in laboratory, a kind of effective blocking gene is expressed.

At present, there is not yet the report of the identical sequence small molecules interference RNA about the MCM7 gene for suppressing glioma to be bred.

Summary of the invention

One of the technical problem to be solved in the present invention is to provide a kind of microRNA of the interference MCM7 gene for suppressing glioma to be bred.

Two of the technical problem to be solved in the present invention is to provide the preparation method of the microRNA of this interference MCM7 gene.

Three of the technical problem to be solved in the present invention is to provide the application of the microRNA of this interference MCM7 gene.

For solving the problems of the technologies described above, the present invention adopts following technical scheme:

In one aspect of the invention, provide a kind of microRNA of the interference MCM7 gene for suppressing glioma to be bred, the sequence of its correspondence is:

Positive-sense strand: 5 '-CTAGAGCATTGATGAGTTCGACAAGACTCGAGTCTTGTCGAACTCATCAATGCG-3 ', as shown in SEQ ID NO.1;

Antisense strand: 5 '-GATCCGCATTGATGAGTTCGACAAGACTCGAGTCTTGTCGAACTCATCAATGCT-3 ', as shown in SEQ ID NO.2.

Described RNA interference (RNA interference, RNAi) refer to high conservative during evolution, brought out by double-stranded RNA (double-stranded RNA, dsRNA), the phenomenon of the efficient selective degradation of homologous mRNA.Host cell immediately produces reaction to these dsRNA, and dsRNA is cut into multiple small fragment RNA (about 21 ~ 23bp) with length-specific and structure by the endonuclease Dicer in its kytoplasm, i.e. siRNA.SiRNA unwinds into positive-sense strand and antisense strand under the effect of intracellular rna helicase, then combine with some enzymes in body (comprising restriction endonuclease, excision enzyme, helicase etc.) silencing complex (RNA-induced silencing complex, RISC) forming RNA and induce again by antisense siRNA.Specific binding is carried out in the homologous region of the mRNA of RISC and expression of exogenous genes, and RISC has the function of nuclease, and at combining site cutting mRNA, namely cleavage site is the two ends combined with antisense strand complementation in siRNA.Fracture mRNA after cut degrades immediately, thus brings out the DeR of host cell for these mRNA.

In another aspect of this invention, provide a kind of method preparing the microRNA of the above-mentioned interference MCM7 gene for suppressing glioma to be bred, the concrete steps of the method are:

Step one, specific requirement according to PMT98 carrier design, design corresponds to MCM7 gene 1974-1994 position, that is: GCATTGATGAGTTCGACAAGA shRNA oligonucleotide sequence and synthesize, the oligonucleotide sequence sequence of described shRNA is the base sequence as shown in SEQ ID NO.1 and SEQ ID NO.2;

The requirement of step 2, foundation PMT98 carrier design, being connected the shRNA sequence of design with PMT98 plasmid, obtaining a kind of small molecules interference RNA of the MCM7 gene for suppressing glioma to be bred.

In another aspect of this invention, a kind of microRNA of above-mentioned interference MCM7 gene is provided to suppress the application in the medicine of glioma propagation in preparation.

The present invention's design is to the RNAi of the MCM7 gene of glioma propagation association, and apply glioma cell model (U373 cell model) and study its restraining effect to glioma proliferation resistant, for RNAi provides a kind of novel drugs molecule at the treatment use of glioma.Through experimental verification, the tumor growth in transfection MCM7 RNA interference group is suppressed, and this experimental result shows, small molecules interference RNA of the present invention can lower the MCM7 genetic expression in glioma, obviously can suppress the growth of glioma.

Accompanying drawing explanation

Fig. 1 is the oligonucleotide sequence of shRNA in the embodiment of the present invention 1 and the connection diagram of PMT98 plasmid.

Fig. 2 is that in the embodiment of the present invention 1, MCM7 RNAi is to the interference effect schematic diagram of MCM7 in brain glioblastoma cell, and wherein, blank represents ghost group, and empty vector represents transfection empty carrier group; MCM7 RNAi represents transfection MCM7 RNA interference group.

Fig. 3 be in the embodiment of the present invention 1 MCM7 RNAi brain glioblastoma cell is bred affect schematic diagram, wherein, blank represents ghost group, and empty vector represents transfection empty carrier group; MCM7 RNAi represents transfection MCM7 RNA interference group.

Fig. 4 is that in the embodiment of the present invention 2, three microRNAs are to the interference effect contrast schematic diagram of MCM7 in brain glioblastoma cell, and wherein, blank represents ghost group, and empty vector represents transfection empty carrier group.

Embodiment

Following examples are only not used in for illustration of the present invention and limit the scope of the invention.The experimental technique of unreceipted actual conditions in embodiment, usual conveniently condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.

Embodiment 1

One, the cultivation of glioma cell:

Glioma cell U373 clone (buying from school of life and health sciences cellular resources center, Chinese Academy of Sciences Shanghai) is incubated at 37 DEG C, 5%CO ₂constant incubator.The cell trysinization of logarithmic phase takes off wall, adds appropriate nutrient solution afterwards and repeatedly blows and beats to mix cell; The cell suspension obtained is moved in 15ml centrifuge tube, the centrifugal 3min of 1500rpm; Remove supernatant; With 5ml aseptic 1 × PBS, cell is hanged, piping and druming mixing; Add about 1ml cell suspension in the new culturing bottle that 5ml fresh culture is housed, put into 37 DEG C, 5%CO ₂cultivate in incubator, within about about 2 days, go down to posterity 1 time (mainly checking that cell is with or without confluent culture bottle).

Two, the design of MCM7-RNAi plasmid and transfection:

1.MCM7-RNAi the design of plasmid:

According to the specific requirement of PMT98 carrier design, design corresponds to MCM7 gene 1974-1994 position, that is:

The shRNA oligonucleotide sequence of GCATTGATGAGTTCGACAAGA also synthesizes, and send Shanghai Jierui Biology Engineering Co., Ltd to synthesize.

The sequence that MCM7-RNAi is corresponding is:

Sense (positive-sense strand): 5 '-CTAGAGCATTGATGAGTTCGACAAGACTCGAGTC TTGTCGAACTCATCAATGCG-3 ', as shown in SEQ ID NO.1;

Antisense (antisense strand): 5 '-GATCCGCATTGATGAGTTCGACAAGACTCGAG TCTTGTCGAACTCATCAATGCT-3 ', as shown in SEQ ID NO.2.

According to the specific requirement of PMT98 carrier design, be connected with PMT98 plasmid by the interference fragment of the MCM7-RNAi of design, see Fig. 1, then glioma cell is entered in transfection.Fig. 1 is the diagram of PMT98 plasmid construction principle, and it uses based on the CMV polymerase Il promoters of RNA and the loop-stem structure of optimization, thus accurately can form small molecules interference RNA (shRNA) in target cell.PMT98 is a carrier cut in advance, by the selection markers that carrier carries, carries out the cotransfection of mammalian cell, sets up the stable cell lines that shRNA expresses.PMT98 carrier (element orders: pLVX-PGK-PURO-CMV-EGFP-mir30 arm-polyA) transforms on pLVX-PURO carrier (element orders: the pLVX-CMV-MSC-PGK-PURO-polyA) basis of clontech company.PMT98 carrier complete sequence is as shown in SEQ ID NO.7.

2.MCM7-RNAi the transfection of plasmid:

Day before transfection, plants upper 2 × 10 in the 60mm culture dish of the DMEM growth medium (DMEM growth medium a kind ofly to develop on the basis of MEM substratum, the cell culture medium containing each seed amino acid and glucose) containing 5ml antibiotic-free ⁶individual glioma cell (glioma cell by above-mentioned one, cultivate obtain).Within after bed board second day, prepare transfection: first use the substratum (DMEM) of 500 μ l serum-frees to dissolve the MCM7-RNAi expression vector of 8.0 μ g, dissolve cationic-liposome Lipofectamine with 500 μ l substratum (DMEM or RPMI1640) ^tM2000 (20 μ l), mix, incubated at room 5 minutes lightly.After hatching, for impelling shRNA expression vector and Lipofectamine ^tM2000 fully combine, and they are mixed gently, and incubated at room 20 minutes, to form DNA-Lipofectamine ^tMthe mixture of 2000.By DNA-Lipofectamine ^tM2000 mixtures join 60mm culture dish, afterwards will containing DNA-Lipofectamine ^tMthe Tissue Culture Dish of 2000 mixtures puts into 37 DEG C, 5%CO ₂cultivate 6 hours in incubator, change normal cell nutrient solution.

Three, experiment grouping and Testing index

Blank group (ghost group): glioma cell, nutrient solution is glioma cell nutrient solution;

Empty vector group (transfection empty carrier group); The glioma cell of empty vector is crossed in transfection, and nutrient solution is glioma cell nutrient solution;

MCM7 RNAi group (transfection MCM7 RNA interference group): the glioma cell of MCM7-RNAi is crossed in transfection, and nutrient solution is glioma cell nutrient solution.

Fig. 2 represents the interference effect of MCM7 RNAi to MCM7 in brain glioblastoma cell, and Fig. 2 is that in U373 cell, MCM7 interference effect QPCR detects.In Fig. 2, MCM7 RNAi group is compared with empty vector group, and MCM7 gene is obviously suppressed (* * p<0.01).

Fig. 3 represents the impact that MCM7-RNAi breeds brain glioblastoma cell.As shown in Figure 3, MCM7 RNAi group is compared with emptyvector group, and the cell proliferation of transfection MCM7 RNAi interference group (MCM7 RNAi group) is significantly lower than the cell proliferation rate (* * p<0.01) of transfection empty carrier group (empty vector group).

Four, experimental result:

Above-mentioned experiment shows, the MCM7 gene in transfection MCM7 RNAi interference group is significantly struck to be subtracted, and tumor growth is also subject to obvious suppression.This experimental result shows, small molecules interference RNA of the present invention can lower the MCM7 genetic expression in glioma, obviously can suppress the growth of glioma.

Embodiment 2 contrast experiment

Select the microRNA that 3 score values are higher, carrier construction also disturbs sieve target, and experimental procedure, with embodiment 1, is below relevant comparative's experimental data.

MCM7-si1456:CGTCAGCGTCACTGGTATTTT (corresponding to MCM7 gene 1456-1476 position); The sequence that MCM7-si1456 is corresponding is:

Positive-sense strand: 5 '-CTAGACGTCAGCGTCACTGGTATTTTCTCGAGAAAATACCAGTGACGCTGACGG-3 ', as shown in SEQID NO.3;

Antisense strand: 5 '-GATCCCGTCAGCGTCACTGGTATTTTCTCGAGAAAATACCAGTGACGCTGACGT-3 ', as shown in SEQID NO.4.

MCM7-si1644:CGAAAAGCTGGCAGCTTCA (corresponding to MCM7 gene 1644-1664 position); The sequence that MCM7-si1644 is corresponding is:

Positive-sense strand: 5 '-CTAGA CGAAAAGCTGGCAGCTTCACTCGAGTGAAGCTGCCAGCTTTCGG-3 ', as shown in SEQ IDNO.5;

Antisense strand: 5 '-GATCC CGAAAAGCTGGCAGCTTCACTCGAGTGAAGCTGCCAGCTTTCGT-3 ', as shown in SEQ IDNO.6.

MCM7-si1974:GCATTGATGAGTTCGACAAGA (corresponding to MCM7 gene 1974-1994 position, the ordered sequence namely in embodiment 1), the sequence that MCM7-si1974 is corresponding is:

Sense (positive-sense strand): 5 '-CTAGAGCATTGATGAGTTCGACAAGACTCGAGTC TTGTCGAACTCATCAATGCG-3 ", as shown in SEQ ID NO.1;

Antisense (antisense strand): 5 '-GATCCGCATTGATGAGTTCGACAAGACTCGAGTCTTGTCGAACTCATCAATGCT-3 ', as shown in SEQ ID NO.2.

As shown in Figure 4, as can be seen from Figure 4, MCM7-si1974 (i.e. the microRNA of the embodiment of the present invention 1) is compared with MCM7-si1456, MCM7-si1644, and in U373 cell, MCM7 interference effect is the most remarkable for contrast and experiment.

Claims (3)

1., for a microRNA for the interference MCM7 gene that suppresses glioma to be bred, the sequence of its correspondence is:

Positive-sense strand: 5 '-CTAGAGCATTGATGAGTTCGACAAGACTCGAGTCTTGTCGAACTCATCAATGCG-3 ', as shown in SEQ ID NO.1;

Antisense strand: 5 '-GATCCGCATTGATGAGTTCGACAAGACTCGAGTCTTGTCGAACTCATCAATGCT-3 ', as shown in SEQID NO.2.

2. a preparation method for the microRNA of interference MCM7 gene according to claim 1, it is characterized in that, the concrete steps of the method are:

Step one, specific requirement according to PMT98 carrier design, design corresponds to MCM7 gene 1974-1994 position, that is: GCATTGATGAGTTCGACAAGA shRNA oligonucleotide sequence and synthesize, described shRNA oligonucleotide sequence sequence is the base sequence as shown in SEQ ID NO.1 and SEQ ID NO.2;

The requirement of step 2, foundation PMT98 carrier design, being connected the shRNA sequence of design with PMT98 plasmid, obtaining the rna interference vector for disturbing MCM7 genetic expression.

3. the microRNA of interference MCM7 gene according to claim 1 suppresses the application in the medicine of glioma propagation in preparation.