CN104560975A - Soybean flowering date QTL chromosome mapping interval as well as obtaining method and application thereof - Google Patents

Abstract

A chromosomal mapping interval of soybean flowering QTL and its obtaining method and application, which relate to a QTL chromosomal mapping interval, its obtaining method and its application. The QTL mapping interval of the soybean flowering period is BAR_04_0012-LJ_SSR-PSI0526, and the method is as follows: 1. Hybridize the soybean variety BR121 and Harosory, and self-fertilize the seeds obtained in the _F1 generation to obtain a recombinant inbred line population; 2. , Using Map? Manager? program? QTXb20 determines genetic distance, using Mapchart? 2.1 Drawing a linkage group map; 3. Using MapQTL? 5.0, with LOD ≥ 2.5 as the standard, the genetic mapping of soybean flowering period was carried out. Among them, the soybean flowering stage SSR marker LJ_SSR is used as a molecular marker for selecting soybean flowering stage in soybean genetics and breeding.

Description

A Chromosomal Mapping Interval of Soybean Flowering QTL and Its Obtaining Method and Application

technical field

The invention belongs to the field of soybean molecular breeding, and in particular relates to a QTL chromosome mapping interval, its obtaining method and its application.

Background technique

Soybeans provide human beings with important vegetable proteins and oils. Worldwide, soybeans are cultivated in a wide range of regions ranging from high latitudes in northern Europe, Sweden and North America to Canada, and south to Brazil and Argentina. It is closely related to the growth period gene of soybean. So far, 10 gene loci E1-E9 and J that mainly affect soybean flowering and maturity (growth) stages have been discovered. However, the flowering period of soybean is a quantitative trait, which is controlled by multiple genes at the same time. Discovering the genetic loci of quantitative traits related to soybean growth period is of great significance for further enriching the research on the regulation network of soybean growth period.

Contents of the invention

The object of the present invention is to provide a chromosome mapping interval of soybean anthesis QTL and its obtaining method and application, and the mapping interval is the No. 4 chromosome mapping interval BAR_04_0012-LJ_SSR of soybean anthesis QTL as shown in Table 1 -PSI0526, Satt519 in this interval can be used as a molecular marker for selecting soybean flowering period.

The present invention relates to a molecular marker for the chromosome mapping interval of the QTL of soybean flowering stage, wherein the LJ_SSR mapping interval of soybean flowering stage is BAR_04_0012-LJ_SSR-PSI0526.

The application of the soybean flowering stage SSR marker LJ_SSR of the present invention as a molecular marker for selecting soybean flowering stage in soybean genetic breeding.

A method for obtaining the chromosome mapping interval of the QTL of the soybean flowering stage of the present invention, the QTL mapping interval of the soybean flowering stage is BAR_04_0012-LJ_SSR-PSI0526t_026, which is carried out according to the following steps:

1. Hybridize the soybean variety BR121 and Harosory, and self-cross the seeds obtained from the _F1 generation to obtain a recombinant inbred line population;

2. Use the Map Manager program QTXb20 to determine the genetic distance, and use Mapchart 2.1 to draw the linkage group map;

3. Using MapQTL 5.0, with LOD ≥ 2.5 as the standard, the genetic mapping of soybean flowering period was carried out.

The present invention utilizes soybean variety BR121 and Harosory to cross, and selects seeds from 127 offspring to continue planting, and self-crosses for multiple generations to obtain a recombinant inbred line group consisting of 127 strains. The genetic map of chromosome 4 was constructed using these 127 F2 individuals.

The present invention utilizes the Map Manager program QTXb20 to determine the genetic distance, uses the multi-interval mapping method of the MapQTL 5.0 mapping software, and uses LOD ≥ 2.5 as the standard to perform genetic mapping on the soybean flowering period. The QTL interval BAR_04_0012-LJ_SSR-PSI0526 was found on chromosome 4, as shown in Table 1.

The present invention comprises following beneficial effect:

In the present invention, the intervals of BAR_04_0012-LJ_SSR-PSI0526t_026 centered on LJ_SSR are all ideal marking intervals of soybean flowering period (as shown in Table 1), wherein LJ_SSR is the highest point of LOD, and its contribution rate is 34.7%. The additive effect of the QTL closely connected with this marker is negative, that is, BR121 is the donor of this QTL. Therefore, the interval BAR_04_0012-LJ_SSR-PSI0526 centered on LJ_SSR is an ideal marker interval for soybean flowering period, no matter from the location of QTL or the contribution rate of QTL to phenotype. The significance of using the soybean anthesis chromosome mapping interval BAR_04_0012-LJ_SSR-PSI0526 shown in Table 1 provided by the present invention is that it provides a new most economical and effective molecular breeding approach for further enriching the soybean anthesis regulation network.

Description of drawings

Figure 1 shows the genetic mapping of soybean anthesis of the present invention.

Detailed ways

Embodiment 1: A chromosome mapping interval of QTL for soybean flowering period, the QTL mapping interval for soybean flowering period is BAR_04_0012-LJ_SSR-PSI0526.

Embodiment 2: This embodiment differs from Embodiment 1 in that: LJ_SSR is used as a molecular marker to select the QTL mapping interval BAR_04_0012-LJ_SSR-PSI0526 for soybean flowering stage. Others are the same as in the first embodiment.

Specific embodiment three: the difference between this embodiment and specific embodiment one or two is that the molecular marker LJ_SSR uses the genomic DNA of the material to be identified as a template, and is a fragment obtained by PCR amplification with primers; the primers The sequence is:

Upstream primer: 5'GGGAAAAAACTCACTCCTACA 3'

Downstream primer: 5'ATGACAATCTTGAAACTCCCG 3'.

Others are the same as in the first or second embodiment.

Specific embodiment four: this embodiment is different from one of specific embodiments one to three: the described PCR reaction conditions are as follows:

PCR amplification conditions were: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 48°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles, 72°C extension for 10 min, and 4°C incubation. Others are the same as those in the first to third specific embodiments.

Embodiment 5: This embodiment is different from Embodiment 1 to Embodiment 4 in that the primers used for PCR amplification of BAR_04_0012 are:

Upstream primer: 5'TTCACACGACAATGTTTGACA 3'

Downstream primer: 5'TCTTGATCTCCCTTGTTTCACA 3'.

Others are the same as one of the specific embodiments 1 to 4.

Specific embodiment six: this embodiment is different from one of specific embodiments one to five in that: the primers used for PCR amplification of PSI0526 are:

Upstream primer: 5'TTTTGGAGTTAGGTTTGGTG 3'

Downstream primer: 5'CCATCGCATTTCAAAAGTTA 3'.

Others are the same as one of the specific embodiments 1 to 5.

Embodiment 7: The application of the soybean flowering stage SSR marker LJ_SSR in this embodiment as a molecular marker for selecting soybean flowering stage in soybean genetics and breeding.

Embodiment 8: This embodiment differs from Embodiment 7 in that: the soybean flowering stage SSR marker LJ_SSR is derived from the soybean variety Harosory. Others are the same as in the seventh embodiment.

Specific embodiment nine: the obtaining method of the QTL mapping interval of a kind of soybean flowering stage of the present embodiment, it is carried out according to the following steps:

1. Hybridize the soybean variety BR121 and Harosory, and self-cross the seeds obtained from the _F1 generation to obtain a recombinant inbred line population;

2. Use the Map Manager program QTXb20 to determine the genetic distance, and use Mapchart 2.1 to draw the linkage group map;

3. Using MapQTL 5.0, with LOD ≥ 2.5 as the standard, the genetic mapping of soybean flowering period was carried out.

Embodiment 10: This embodiment differs from Embodiment 9 in that: in step 1, the seeds obtained from the _F1 generation are self-crossed to obtain the F2 generation hybrid population, and the population is used to construct the genetic linkage map of chromosome 4 of soybean. Others are the same as in the ninth embodiment.

Verify the beneficial effects of the present invention through the following examples:

Example 1

Establishment of chromosome mapping interval BAR_04_0012-LJ_SSR-PSI0526t_026 of soybean flowering QTL:

Two soybean cultivars BR121 and Harosory with obvious differences in flowering period were used to configure the hybrid combination, and 127 hybrid offspring were obtained, and the genetic map of chromosome 4 was constructed using these 127 F2 individuals.

The operating procedure of the PCR experiment was denaturation at 94°C for 5 minutes, 35 amplification cycles (30 seconds at 94°C, 30 seconds at 48°C, 30 seconds at 72°C), and extension at 72°C for 5 minutes. PCR amplification products were directly detected by 6% polyacrylamide gel electrophoresis. Using the multi-interval mapping method of MapQTL 5.0 mapping software, the genetic mapping of soybean flowering period was carried out with LOD ≥ 2.5 as the standard. And draw the linkage group map with Map Manager program QTXb20/Mapchart 2.1.

There are 17 markers in this genetic map, and the molecular markers in the map include 13 SSR markers and 3 promoter-specific markers. The QTL interval BAR_04_0012-LJ_SSR-PSI0526 was found on chromosome 4, as shown in Table 1.

Wherein, the primers for performing PCR labeling at each marker site of the entire chromosome shown in Figure 1 are as follows:

BAR_04_0001:

Upstream primer: 5'TGCAAATTCCAACGGTTTTT 3'

Downstream primer: 5'AACACTGGTTTCACCTTGGC 3'

BAR_04_0012

Upstream primer: 5'TTCACACGACAATGTTTGACA 3'

Downstream primer: 5'TCTTGATCTCCCTTGTTTCACA 3'

LJ-SSR

Upstream primer: 5'GGGAAAAAACTCACTCCTACA 3'

Downstream primer: 5'ATGACAATCTTGAAACTCCCG 3'

PSI0526

Upstream primer: 5'TTTTGGAGTTAGGTTTGGTG 3'

Downstream primer: 5'CCATCGCATTTCAAAAGTTA 3'

BAR_04_0366

Upstream primer: 5'CTCCCCCACCATCTCAATTA 3'

Downstream primer: 5'AAGGTGTTGATCCAGCTCGT 3'

PSI0532

Upstream primer: 5'CAATTTCTGAGTAATGCGGT 3'

Downstream primer: 5'GTTGAGCTTGATGAGATGCT 3'

Satt646

Upstream primer: 5'GCGGGGTATGAATTAATTAATGTAGAAT 3'

Downstream primer: 5'GCGCCTTCAAAAACTAATGACATATCAT 3'

Satt718

Upstream primer: 5'GCGTGCAACACCTCAAGTTTCAAATAC 3'

Downstream primer: 5'GCGTAGCTCTTTCCAAAGTTTTCATC 3'

AW277661

Upstream primer: 5'GCGCATGGAGCATCATCTTCATA 3'

Downstream primer: 5'GCGAGAAAACCCAATCTTTTATATCAATA 3'

Satt339

Upstream primer: 5'TAATATGCTTTAAGTGGTGTGGTTATG 3'

Downstream primer: 5'GTTAAGCAGTTCCTCTCATCACG 3'

Sat_085

Upstream primer: 5'GGTTTTAGATCCTTAAATTTGT 3'

Downstream primer: 5'GGGGAAGCAAGTAGCT 3'

Sat_077

Upstream primer: 5'GACACTTGTGGAATTACTCA 3'

Downstream primer: 5'GGGTTGAAGACTTAAATTTGAAATCTCT 3'

Satt173

Upstream primer: 5'TGCGCCATTTATTCTTCA 3'

Downstream primer: 5'AAGCGAAATCACCTCCTCT 3'

Sat_311

Upstream primer: 5'GCGAACACAGAATGACCCTGATTGTAAT 3'

Downstream primer: 5'GCGTGACTCCCACGTTAAAAATCTCAAAA 3'

PSI0582

Upstream primer: 5'AAGAAAGTTCTTATTTACAAGATCAA 3'

Downstream primer: 5'TACATTTGTATTTCTTGTGTTTTTC 3'

Satt338

Upstream primer: 5'GCGCCCAAGTATTATGAGATATTTGAT 3'

Downstream primer: 5'GCGATAATTTTAAAACTGGACCA 3'

Satt180

Upstream primer: 5'TCGCGTTTGTCAGC 3'

Downstream primer: 5'TTGATTGAAACCCAACTA 3'

The PCR experiment procedure required for the above primers is denaturation at 94°C for 5 minutes, 35 cycles of amplification (94°C for 30 seconds, 48°C for 30 seconds, 72°C for 30 seconds), and 72°C for 5 minutes.

In this example, the QTL interval BAR_04_0012-LJ_SSR-PSI0526 was found on chromosome 4, as shown in Table 1. Among them, LJ_SSR is the highest point of LOD, and its contribution rate is 34.7%. The additive effect of the QTL closely connected with this marker is negative, that is, BR121 is the donor of this QTL. Therefore, the interval BAR_04_0012-LJ_SSR-PSI0526 centered on LJ_SSR is an ideal marker interval for soybean flowering period, no matter from the location of QTL or the contribution rate of QTL to phenotype. The significance of using the soybean anthesis chromosome mapping interval BAR_04_0012-LJ_SSR-PSI0526 as shown in Table 1 provided by the present invention is that it provides a new most economical and effective molecular breeding approach for further enriching the regulatory network of soybean anthesis.

Table 1 QTL intervals of soybean flowering period

The above descriptions are only preferred embodiments of the present invention, and are only illustrative, not restrictive, of the present invention. Those skilled in the art can make various changes, modifications, and even equivalent replacements within the spirit and scope defined by the claims of the present invention, all of which fall within the protection scope of the present invention.

Claims (10)

1. A chromosome mapping interval of soybean flowering QTL, characterized in that the QTL mapping interval of soybean flowering is BAR_04_0012-LJ_SSR-PSI0526. 2. The chromosome mapping interval of a soybean flowering QTL according to claim 1, characterized in that the QTL mapping interval BAR_04_0012-LJ_SSR-PSI0526 of soybean flowering is selected as a molecular marker with LJ_SSR. 3. the chromosomal mapping interval of a kind of soybean anthesis QTL according to claim 1, it is characterized in that described molecular marker LJ_SSR is to use the genomic DNA of material to be identified as template, carry out the fragment of PCR amplification gain with primer ; The primer sequence is: Upstream primer: 5'GGGAAAAAACTCACTCCTACA 3' Downstream primer: 5'ATGACAATCTTGAAACTCCCG 3'. 4. the chromosome mapping interval of a kind of soybean anthesis QTL according to claim 3, is characterized in that: Described PCR reaction condition is as follows: The PCR amplification conditions were: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 48°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles, 72°C extension for 10 min, and 4°C incubation. 5. the chromosome mapping interval of a kind of soybean anthesis QTL according to claim 1, it is characterized in that the primers for PCR amplification BAR_04_0012 are: Upstream primer: 5'TTCACACGACAATGTTTGACA 3' Downstream primer: 5'TCTTGATCTCCCTTGTTTCACA 3'. 6. the chromosomal mapping interval of a kind of soybean anthesis QTL according to claim 1, is characterized in that being used for the primer of PCR amplification PSI0526 is: Upstream primer: 5'TTTTGGAGTTAGGTTTGGTG 3' Downstream primer: 5'CCATCGCATTTCAAAAGTTA 3'. 7. The application of soybean flowering stage SSR marker LJ_SSR as a molecular marker for soybean flowering stage selection in soybean genetics and breeding. 8. The application of the soybean flowering stage SSR marker LJ_SSR according to claim 7, characterized in that the soybean flowering stage SSR marker LJ_SSR is derived from the soybean variety Harosory. 9. A method for obtaining the chromosome mapping interval of soybean anthesis QTL, characterized in that it is carried out according to the following steps: 1. Hybridize the soybean variety BR121 and Harosory, and self-cross the seeds obtained from the _F1 generation to obtain a recombinant inbred line population; 2. Use the Map Manager program QTXb20 to determine the genetic distance, and use Mapchart 2.1 to draw the linkage group map; 3. Using MapQTL 5.0, with LOD ≥ 2.5 as the standard, the genetic mapping of soybean flowering period was carried out. 10. the chromosome mapping interval obtaining method of a kind of soybean anthesis QTL according to claim 9, it is characterized in that in the step 1, the seed that _F1 generation obtains carries out selfing and obtains F2 generation hybrid population, and utilizes this population construction Genetic linkage map of soybean chromosome 4.