CN104560800B - A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid - Google Patents
A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid Download PDFInfo
- Publication number
- CN104560800B CN104560800B CN201410818165.XA CN201410818165A CN104560800B CN 104560800 B CN104560800 B CN 104560800B CN 201410818165 A CN201410818165 A CN 201410818165A CN 104560800 B CN104560800 B CN 104560800B
- Authority
- CN
- China
- Prior art keywords
- acid
- phenylpyruvic
- phenylpyruvic acid
- reductase
- acid reductase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/225—Lactobacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
- C12N15/746—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora for lactic acid bacteria (Streptococcus; Lactococcus; Lactobacillus; Pediococcus; Enterococcus; Leuconostoc; Propionibacterium; Bifidobacterium; Sporolactobacillus)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
- C12P7/42—Hydroxy-carboxylic acids
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
A kind of application the invention discloses phenylpyruvic acid reductase and its in asymmetric syntheses (R) phenyllactic acid, belongs to technical field of bioengineering.The invention provides a kind of new phenylpyruvic acid reductase and its encoding gene, when the phenylpyruvic acid reductase prepares (R) phenyllactic acid as biocatalyst for asymmetric reduction phenylpyruvic acid, not only production concentration is high for prepared (R) phenyllactic acid, and optical purity is good, expensive coenzyme need not be additionally added, reaction condition is gentle, easy to operate, it is easy to amplify, therefore there is good prospects for commercial application in the production of biological preservative.
Description
Technical field
The present invention relates to a kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R)-phenyllactic acid, belong to raw
Thing field of engineering technology.
Background technology
Phenyllactic acid (Phenyllactic acid, PLA), also known as the phenylpropionic acid of 2- hydroxyls -3, be danshensu (β -3,4 one two
Hydroxy phenyl sodium lactate) derivative, be known as identical pharmacological function with the red sage root, the level of the steroids in human body can be adjusted
With the activity of platelet aggregation-against.Phenyllactic acid is also the important intermediate for synthesizing many medicines, such as：Hypoglycemic agent Englitazone
(Englitazone), non-protein amino acid Shi Deding (Statine), anti-AIDS toxin preparation, new antihelmintic PFl022A,
Phenylalanine, the emulsifiable paste for treating dry skin or preparation etc..In addition, phenyllactic acid is new biology newfound in recent years
Preservative, there is extensive antimicrobial spectrum, to gram-positive bacteria (such as：Staphylococcus aureus, the Hypertrophic Liszt of monokaryon
Bacterium), Gram-negative bacteria is (such as：Escherichia coli, salmonella) and eukaryotic microorganisms are (such as：Aspergillus mould) etc. have suppression make
With.
It is short using lactic fermentation that the biosynthesis of phenyllactic acid mainly includes fermentation method and biotransformation method, Kamata M et al.
Bacillus (Brevibacterium Lactofermentum) fermentation prepares (R)-PLA, production concentration 1.94g/L；2000,
Lavermicoccca P et al. find Lactobacillus plantarum (Lactobacillusplantarum) can be used for asymmetric syntheses (R)-
PLA, production concentration 0.056g/L；2004, Li Demao et al. was using bacterial strain MRSH (Staphylococcus
Haemolyticus) T0l fermentations prepare (R)-PLA, production concentration 1.59g/L；2011, Zheng Zhaojuan et al. was using gemma breast
Sour bacterium (Bacillus coagulans) bacterial strain asymmetric reduction phenylpyruvic acid prepares phenyllactic acid, production concentration 37.3g/L；
2013, bacterial strain Pediococcus pentosaceus (Pediococcuspentosaceus) was applied to asymmetric syntheses benzene breast by Yu Shuhuai et al.
Acid, production concentration 0.9g/L.2013, Zheng Zhaojuan etc. was by the method for rite-directed mutagenesis to from lactobacillus bulgaricus
The carbonyl reductase of (Lactobacillus bulgaricus) has carried out molecular modification, can be by 50mM phenylpropyl alcohols in 1.5 hours
Ketone acid is reduced to phenyllactic acid, and ee>99%.
By data above it can be seen that the yield that phenyllactic acid is prepared using fermentation method is relatively low, extraction is difficult, and bioconversion
Method prepares carrying capacity and yield on the substrate of phenyllactic acid and increased, but can not still reach the requirement of industrialized production, it is necessary to
Further develop efficient phenylpyruvic acid reductase.The invention provides a kind of phenylpyruvic acid reductase, efficiently asymmetric can go back
The former phenylpropionic acid ((R)-PLA) of phenylpyruvic acid (and its sodium salt) generation (R) -2- hydroxyls -3, the reaction, which has, is not required to external source addition
Expensive coenzyme, reaction condition mild condition, simple operation and other advantages.
The content of the invention
The invention solves first technical problem be to provide a kind of lactobacillus (Lactobacillus sp.), the bacterium
China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved on November 13rd, 2014, deposit number is
CGMCC No.9967, preservation address are Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica.
The catalytic activity for the phenylpyruvic acid reductase that the lactobacillus CGMCC No.9967 are produced is high, enantioselectivity is strong,
Substrate tolerance is good.
The invention solves second technical problem be to provide a kind of new phenylpyruvic acid reductase, can be with phenylpyruvic acid
Or its salt is that substrate prepares (R)-phenyllactic acid through asymmetric reduction, the phenylpyruvic acid reductase is：(a) by SEQ ID No.2
The protein of shown amino acid composition；Or (b) amino acid sequence as shown in SEQ ID No.2 passes through substitution, missing or addition one
There is the derived protein of phenylpyruvic acid reductase activity obtained from individual or multiple amino acid.
In one embodiment of the invention, the derived protein has SEQ ID No.4 or SEQ ID No.6 institutes
The amino acid sequence shown.
In one embodiment of the invention, encoding the gene of the phenylpyruvic acid reductase has SEQ ID No.1
(LcKAR) base sequence shown in；Or one or more bases of base sequence shown in SEQ ID No.1 are replaced, lacked
Lose or increase the base sequence of obtained albumen of the coding with phenylpyruvic acid reductase activity.Due to the degeneracy of codon,
The base sequence for encoding the phenylpyruvic acid reductase is not limited to SEQ ID No.1, and those skilled in the art can pass through
It is suitably introduced into replacement, missing, change, insertion or increases to obtain the homologue of the base sequence, as long as the recombinase of its expression
Keep phenylpyruvic acid reducing activity.
In one embodiment of the invention, the base sequence such as SEQ of the gene of the phenylpyruvic acid reductase is encoded
Shown in ID No.3 or SEQ ID No.5.
The present invention also provides a kind of recombinant expression carrier for including phenylpyruvic acid reductase gene of the present invention.Ability can be passed through
Domain conventional method by the present invention phenylpyruvic acid reductase gene nucleotide sequence be connected on various suitable carriers build and
Into phenylpyruvic acid reductase gene can realize composing type or inducible expression by suitable regulating and controlling sequence.The carrier can
To be the various conventional carriers of this area, such as commercially available plasmid, clay, bacteriophage or viral vector.
In one embodiment of the invention, expression vector is plasmid, and such as pET28 and pET24, connection phenylpyruvic acid is also
Recombinant expression carrier pET28a-LcKAR, pET24a-LcKAR are obtained after nitroreductase gene LcKAR.
Present invention also offers a kind of restructuring table comprising phenylpyruvic acid reductase gene of the present invention or recombinant expression carrier
Up to transformant.Can be by the way that the recombinant expression carrier of the present invention be converted to host cell the recombinant expression transformants are made.
The host cell can be the various conventional host cells of this area, on condition that can make the recombinant expression carrier stably from
Row replicates, and the reductase gene entrained by it can be by effective expression.
In one embodiment of the invention, the host is Escherichia coli such as ETEC (Escherichia
Coli) BL21 (DE3) or ETEC (E.coli) DH5a.
In one embodiment of the invention, the host is while phenylpyruvic acid reductase gene is recombinantly expressed,
Glucose dehydrogenase can also be overexpressed simultaneously, the dual-enzyme coupling type coenzyme circulatory system is built, to realize following for reduced coenzyme
Ring is supplied, and reduces the cost of catalytic reaction.
The present invention also provides a kind of preparation method for recombinating phenylpyruvic acid reductase, and it comprises the following steps：Cultivate this hair
Bright recombinant expression transformants, isolate and purify acquisition restructuring phenylpyruvic acid reductase.Wherein, the recombinant expression transformants are cultivated
Described culture medium, may be selected from the conventional medium of this area, on condition that making transformants grew and producing the propiophenone of the present invention
Sour reductase.
In one embodiment of the invention, phenylpyruvic acid reductase gene will be included as obtained by being expanded PCR
PCR primer restriction enzyme NdeI and XhoI double digestion, forms the cohesive terminus,cohesive termini of complementation, at the same by cloning vector fragment and
Expression vector pET28a restriction enzyme NdeI and XhoI double digestions, the gene of digestion is connected through through T4DNA ligases
Fragment and expression vector, form the recombinant expression plasmid pET28-LcKAR of the phenylpyruvic acid reductase gene containing the present invention.Will
The recombinant expression plasmid pET28-LcKAR is converted into ETEC BL21 (DE3), you can obtains engineering strain
E.coli BL21 (DE3)/pET28-LcKAR, its fermenting and producing phenylpyruvic acid reductase can be made by cultivating the bacterium.
In one embodiment of the invention, when the recombinant bacterium for producing phenylpyruvic acid reductase is recombination bacillus coli,
It is preferred that LB culture mediums, recombination bacillus coli is seeded in the LB culture mediums containing kanamycins and cultivated, as the OD of nutrient solution600Reach
During to 0.5~0.7, under the induction of final concentration of 0.1~1mM isopropyl-beta D-thio galactopyranoside (IPTG), i.e.,
Can high efficient expression restructuring phenylpyruvic acid reductase of the invention.
The present invention also provides a kind of method for preparing (R)-phenyllactic acid using the phenylpyruvic acid reductase, is to come from breast
Bacillus CGMCC No.9967 phenylpyruvic acid reductase or its active mutant, or carry and come from lactobacillus CGMCC No.9967
Phenylpyruvic acid reductase or the bacterial strain of its active mutant be catalyst, catalysis phenylpyruvic acid (or sodium salt) asymmetric reduction is anti-
Should prepare (R)-phenyllactic acid, specific reaction condition such as concentration of substrate, pH, buffer solution composition, enzyme dosage etc. can by this area this
The normal condition of class reaction is carried out.Methods described can be carried out under vibration or stirring condition.Methods described it is time-optimized with turn
Rate>99% is defined.After asymmetric reduction reaction terminates, it can be extracted by this area conventional method from reaction mixture chiral
Alcohol product.
In one embodiment of the invention, when concentration of substrate is 10mM, with the lactobacillus CGMCC's 9967
1g wet cells are biocatalyst, and the conversion ratio of phenylpyruvic acid can be realized in 12 hours up to 90%, and the optical purity of product is
99%ee (R).
In one embodiment of the invention, in pH 5.0~9.0 phosphate buffer, in glucose dehydrogenation
Enzyme, glucose and NAD+Existence condition under, using phenylpyruvic acid reductase or restructuring phenylpyruvic acid reductase as catalyst, to benzene
Pyruvic acid carries out asymmetric reduction, and optical activity (R)-phenyllactic acid is made.The phosphate buffer can be this area routine
Any phosphate buffer, such as phosphoric acid-sodium phosphate buffer；The concentration of phosphate buffer can be 50~200mM.It is not right
Reduction reaction temperature can be referred to as 20~40 DEG C, preferably 30 DEG C.Concentration of the substrate phenylpyruvic acid (or sodium salt) in reaction solution can
Think 10~500mM.The dosage of glucose is 15~750mM, and NAD+ dosage is 0~1mM.
The positive effect of the present invention is：Expressed the invention provides a kind of lactobacillus strain, and by the bacterial strain
Phenylpyruvic acid reductase, the bacterial strain or its phenylpyruvic acid reductase can be with the not right of efficient catalytic phenylpyruvic acid (or sodium salt)
Reduction is claimed to prepare optical voidness (R)-phenyllactic acid.500mM (or 92g/L Sodium.beta.-phenylpyruvates and 81g/L phenylpropyl alcohols are up in concentration of substrate
Ketone acid) when product optical purity still reach more than 99%ee.Relative to other asymmetric reduction preparation methods, present invention side is used
The production concentration that method prepares gained is high, and optical purity is good, and reaction condition is gentle, environment-friendly, easy to operate, is easy to amplify,
The important drugs such as synthesizing new natural antiseptic agent and danshensu, Englitazone have good application prospect.
Biomaterial preservation
Lactobacillus (Lactobacillus sp.), Chinese microorganism strain preservation pipe is preserved on November 13rd, 2014
Reason committee common micro-organisms center, deposit number are CGMCC No.9967, and preservation address is BeiChen West Road, Chaoyang District, BeiJing City
No. 3 Institute of Microorganism, Academia Sinica of No. 1 institute.
Brief description of the drawings
Fig. 1 phenylpyruvic acids reduction enzymatic phenylpyruvic acid (sodium) generation (R)-phenyllactic acid schematic diagram
Fig. 2 genes LcKAR PCR amplification electrophoresis patterns.M, Marker；1, LcKAR gene
Fig. 3 recombinant expression plasmids pET28-LcKAR structure schematic diagram
Fig. 4 restructuring phenylpyruvic acid reductases LcKAR protein electrophoresis figure.M, Marker；Swimming lane 1,2 and 3 is respectively large intestine
Full cell, broken supernatant sediment fraction after bacillus BL21 (DE3)/pET28a-LcKAR inductions.
Fig. 5 recombinant co-expression plasmids pET24a-gdh-T7-LcKAR structure schematic diagram
Embodiment
Actual conditions unless otherwise noted, the test method in each embodiment is conventionally with condition or according to examination
Agent specification is carried out.Unless otherwise clearly marking, the content of each component is represented with mass/volume (w/v) content.Expression plasmid
PET28a and pET24a is purchased from Shanghai Novagen companies.E.coli BL21 (DE3) competent cell, 2 × Taq PCRMaster
Mix, Ago-Gel DNA QIAquick Gel Extraction Kits are purchased from Beijing Tiangeng biochemical technology Co., Ltd.
The enzyme-activity unit 1U of phenylpyruvic acid reductase is defined as the enzyme required for 1 μm of ol substrates generation product of conversion per minute
Amount.Phenylpyruvic acid reductase vitality assay method is as follows：Reaction medium：100mM sodium phosphate buffers, pH 7.0, add 2mM benzene
Pyruvic acid, appropriate crude enzyme liquid is added after 0.1mM NADH, 30 DEG C of insulation 2min, it is rapid to mix, the suction at 340nm is detected in real time
Light value changes.
The lactobacillus CGMCC No.9967 of embodiment 1 screening
(1) using phenylpyruvic acid as substrate, from isolated one plant of Wuxi Mashan can efficient catalytic phenylpyruvic acid it is also primary
Into the lactobacillus JNU-KR1002 of (R)-phenyllactic acid, preserving number is：CGMCC 9967.
(2) lactobacillus CGMCC No.9967 are catalyzed the asymmetric reduction of phenylpyruvic acid
Lactobacillus CGMCC No.9967 are in MRS culture mediums (beef extract 10g/L, peptone 10g/L, yeast extract powder 5g/
L, glucose 20g/L, sodium acetate 5g/L, dibasic ammonium citrate 2g/L, magnesium sulfate 0.58g/L, manganese sulfate 0.28g/L, tween
800.1g/L, dipotassium hydrogen phosphate 2g/L, pH 6.2-6.4) in 37 DEG C cultivate 24 hours.Gained nutrient solution obtains bacterium through centrifugation
Body precipitates,, can be in 12 hours when concentration of substrate is 10mM using the wet cell of lactobacillus described in 10g/L as biocatalyst
Making the conversion ratio of phenylpyruvic acid, Product yields 1.5g/L, the optical purity of product is 99%ee (R) up to 90%.The lactobacillus has
Have>99% enantioselectivity, and maintain>90% conversion ratio, it is an excellent phenylpyruvic acid reductase producing strains.
Conversions of the lactobacillus CGMCC 9967 of table 1 to phenylpyruvic acid
The clone of the ketone acid reductase gene of embodiment 2
Using the phenylpyruvic acid reductase gene in the above-mentioned lactobacillus CGMCC No.9967 of shotgun cloning.
(1) above-mentioned lactobacillus CGMCC No.9967 are leached in 10g/L containing beef extract, peptone 10g/L, yeast first
Powder 5g/L, glucose 20g/L, sodium acetate 5g/L, dibasic ammonium citrate 2g/L, magnesium sulfate 0.58g/L, manganese sulfate 0.28g/L, tween
800.1g/L, dipotassium hydrogen phosphate 2g/L, pH 6.2-6.4 culture medium in 37 DEG C cultivate 24 hours.Gained nutrient solution is through centrifugation
Bacterial sediment is obtained, and is extracted with this area routine techniques and obtains STb gene.
(2) gained STb gene can use restriction enzyme to carry out digestion to form specific cohesive terminus,cohesive termini, for example, can lead to
Cross Sau3AI digestions and form GATC cohesive terminus,cohesive terminis.By controlling enzyme dosage and reaction time, the piece STb gene digestion into 2~6kb
Section simultaneously carries out digestion recovery.These fragments and the pET28a of BamHI (recognition sequence GGATCC, cohesive terminus,cohesive termini GATC) digestion are carried
Body is efficiently connected with identical cohesive end.After enzyme connect product thing transformed competence colibacillus cell E.coli BL21 (DE3), it is coated on
On LB solid plates containing 50mg/L kanamycins, plate is inverted, after 37 DEG C are cultivated 12~16h, picking single bacterium colony is carried out
Screening active ingredients.
(3) single bacterium colony is seeded into LB solid medium flat boards with sterile toothpick to be preserved, is then seeded to 96 hole depths
Orifice plate culture, treats OD600When reaching 0.6~0.8, addition 0.5mM isopropyl-beta D-thios galactopyranoside (IPTG), 30 DEG C
After induction 12 hours, centrifugation medium collects cell, with pH 7.0 buffer solution suspension gained cell, is carried out using lysozyme thin
Centrifuged after born of the same parents are broken, collect supernatant, addition glycerine to final concentration of 10% is crude enzyme liquid, is saved backup in -80 DEG C.Pass through
The mode of the change of light absorption value at 340nm is detected, carries out phenylpyruvic acid reduction enzyme activity to clasmatosis liquid using spectrophotometer
The detection of power, the broken supernatant for finding to have a recombinant bacterial strain have significant phenylpyruvic acid reducing activity.
(4) positive gram with notable phenylpyruvic acid reducing activity by Shanghai Sai Yin Bioisystech Co., Ltd to gained
Grand middle inserted exogenous sequences are sequenced.Sequencing result shows that exogenous sequences length is 1897bp, utilizes ORF Finder
On-line prediction ORFs, it is found that wherein 600~1200bp ORFs only has one.
(5) it is foundation according to the ORFs obtained by shotgun cloning, design primer is as follows：
Sense primer：GGAATTCCATATGATGAAGATTCTAAACAG；
Anti-sense primer：CCGCTCGAGTCAGTATCCG CGCGTGAGATC。
Wherein sense primer dashed part is Nde I restriction enzyme sites, and anti-sense primer dashed part is Xho I restriction enzyme sites.
Using lactobacillus Lactobacillus sp.CGMCC No.9967 genome as template, enter performing PCR amplification.PCR amplification system
For the μ l of 10 × Taq PCR MasterMix 2, each 0.2 μ l of upstream and downstream primer (20 μm of ol/L), the μ l of TaKaRa Ex Taq 0.2
(5U/ μ l), DNA profiling 0.2 μ l and ddH2O 17.2μl.PCR amplification steps：(1) 95 DEG C, (2) 94 DEG C of pre-degeneration 5min, denaturation
30s；(3) 52 DEG C of annealing 30s；(4) 72 DEG C of extension 1min 20s；Step 2-4 is repeated 29 times；(5) 72 DEG C of extension 10min, cooling
To 4 DEG C.PCR primer is purified through agarose gel electrophoresis, and 700-1000bp sections are reclaimed using agarose gel QIAquick Gel Extraction Kit
Band (Fig. 2), i.e. phenylpyruvic acid reductase gene.Gained phenylpyruvic acid reductase full-length gene is named as LcKAR, its base sequence
Row are as shown in SEQ ID No.1 in sequence table, total length 939bp, and its initiation codon is ATG, terminator codon TGA, sequence
Middle intronless, coded sequence stop from the 1st base to 936 bases, and coded protein has such as SEQ in sequence table
Amino acid sequence shown in ID No.2.
The recombinant plasmid pET28a-LcKAR of embodiment 3 structure and recombination expression
By the phenylpyruvic acid reductase gene LcKAR target stripes that embodiment 2 reclaims at 37 DEG C with restriction enzyme Nde
I and Xho I double digestion 9h, through agarose electrophoresis after purification, target fragment is reclaimed using agarose gel DNA QIAquick Gel Extraction Kits.Will
Target fragment is in the presence of T4DNA ligases, with the plasmid equally through restriction enzyme Nde I and Xho I double digestions
PET28a, connected at 4 DEG C and obtain recombinant plasmid pET28a-LcKAR (Fig. 3) overnight.By recombinant plasmid pET28a-
LcKAR is converted into E.coli BL21 (DE3) competence, and conversion fluid is applied on the LB flat boards containing 50mg/L kanamycins,
37 DEG C of inversion overnight incubations, picking single bacterium colony enters performing PCR and enzyme activity is verified, and acquisition positive restructuring bacterium E.coli BL21 (DE3)/
pET28a-LcKAR.By recombination bacillus coli E.coli BL21 (DE3)/pET28a-LcKAR of gained be seeded to containing card that
In the LB culture mediums of mycin, 37 DEG C of concussion and cultivates are stayed overnight, by 3% (v/v) inoculum concentration access equipped with 80ml LB culture mediums
In 500ml triangular flasks, 37 DEG C, 120rpm shaking table culture are placed in, as nutrient solution OD660Added when reaching 0.6 final concentration of
Thalline is collected after 0.5mM IPTG, 30 DEG C of induction 5h.After thalline ultrasonication, SDS-PAGE detects its full cell, supernatant
With the albumen composition in precipitation as shown in figure 4, understanding the phenylpyruvic acid reductase from lactobacillus CGMCC No.9967 big
Heterogenous expression is successfully obtained in enterobacteria, and the overwhelming majority is expressed in the form of soluble protein, only a small amount of inclusion body egg
In vain, molecular weight of albumen size is about 38kD.Because the recombinase in N-terminal contains His labels, can be obtained by conventional affinity chromatography
To corresponding pure enzyme.
The structure of the recombinant plasmid pET24a-gdh-LcKAR of embodiment 4 plasmid
In order to realize the circulation-supplied of reduced coenzyme, the cost of catalytic reaction is reduced, bacillus subtilis will be derived from
Glucose dehydrogenase (glucose dehydrogenase, GDH, the Genbank accession of (Bacillus subtilis)
No.CP010053.1) introduce, build the dual-enzyme coupling type coenzyme circulatory system.It is as follows to design primer：
Sense primer：GGAATTCCATATGTATCCGGATTTAAAAGC；
Anti-sense primer：CCCAAGCTTTTAACCGCGGCCTGC.
Dashed part is respectively being identified as a little for restriction enzyme NdeI and HindIII in up/down trip primer.Through PCR
The full length sequence of gdh genes is obtained, PCR primer and pET24a plasmids is simultaneously double through restriction enzyme NdeI and HindIII
Fragment and linearized vector containing cohesive end are obtained after digestion, 4 DEG C of connections overnight, obtain recombinant plasmid pET24a-gdh.
It is as follows according to the primers of plasmid pET28a-LcKAR T7 promoters and phenylpyruvic acid reductase：
Sense primer：AAGGAAAAAAGCGGCCGCTAATACGACTCACTATAG；
Anti-sense primer：CCGCTCGAGTCAGTATCCG CGCGTGAGATC。
Wherein sense primer dashed part is Not I restriction enzyme sites, and anti-sense primer dashed part is Xho I restriction enzyme sites.
Using plasmid pET28a-LcKAR as template, enter performing PCR amplification.PCR amplification system is the μ l of 10 × Taq PCRMasterMix 2, on
Each 0.2 μ l of anti-sense primer (20 μm of ol/L), the μ l of TaKaRaEx Taq 0.2 (5U/ μ l), DNA profiling 0.2 μ l and ddH2O 17.2μ
l.PCR amplification steps：(1) 95 DEG C, (2) 94 DEG C of pre-degeneration 5min, it is denatured 30s；(3) 52 DEG C of annealing 30s；(4) 72 DEG C of extensions
1min 20s；Step 2-4 is repeated 29 times；(5) 72 DEG C of extension 10min, are cooled to 4 DEG C.PCR primer is pure through agarose gel electrophoresis
Change, the band in 1000-1500bp sections is reclaimed using agarose gel QIAquick Gel Extraction Kit, i.e., the phenylpyruvic acid containing T7 promoters is also
Nitroreductase gene.
By the phenylpyruvic acid reductase gene target stripe containing T7 promoters of recovery at 37 DEG C with restriction enzyme
Not I and Xho I double digestion 9h, through agarose electrophoresis after purification, target patch is reclaimed using Ago-Gel DNA QIAquick Gel Extraction Kits
Section.By target fragment in the presence of T4DNA ligases, with the plasmid equally through restriction enzyme NotI and XhoI double digestion
PET24a-gdh, connected at 4 DEG C and obtain recombinant plasmid pET24a-gdh-LcKAR (Fig. 5) overnight.
The recombinant bacterium E.coli BL21 (DE3) of embodiment 5/pET24a-gdh-LcKAR preparation and culture
Recombinant plasmid pET24a-gdh-LcKAR prepared by embodiment 4 is converted to E.coli BL21 (DE3) again and felt
In by state, conversion fluid is applied on the LB flat boards containing kanamycins, 37 DEG C of inversion overnight incubations, that is, obtains positive restructuring bacterium
E.coli BL21(DE3)/pET24a-gdh-LcKAR。
The recombination bacillus coli of above-mentioned gained is seeded in the LB culture mediums containing kanamycins, 37 DEG C of concussion and cultivate mistakes
Night, by 3% (v/v) 500ml triangular flasks of the inoculum concentration access equipped with 80ml LB culture mediums, be placed in 37 DEG C, 120rpm shakes
Bed culture, as nutrient solution OD660Final concentration of 0.5mM IPTG is added when reaching 0.6, thalline is collected after 30 DEG C of induction 5h, is used in combination
Brine is freeze-dried to obtain lyophilized cells twice, by the resting cell of gained.
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 6 produces (R)-phenyllactic acid
The thalline 1g/L of the gained of embodiment 5,100 μm of ol benzene are added in 10ml kaliumphosphate buffers (100mM, pH 6.0)
Pyruvic acid, 150 μm of ol glucose, at 30 DEG C, 200r/min reacts 12h.
The detection of substrate and product：Reaction takes a certain amount of conversion fluid after terminating, addition 9%HCl adjusts pH to be extremely less than 2,
8000r/min high speed centrifugation 10min, the insoluble impurity such as thalline are removed, carry out HPLC analyses：Hitachi chromaster (Japan),
Agilent Zorbax SB-C18 chromatographic columns (150mm × 4.6mm)；Mobile phase turns into methanol：Water：Trifluoroacetic acid=40：60：
0.05；Flow velocity 1ml/min；30 DEG C of column temperature.Detection wavelength the UV 290nm, retention time 17.5min of phenylpyruvic acid；Phenyllactic acid
Detection wavelength：UV 210nm, retention time 9.5min.Another part conversion fluid 8000r/min high speed centrifugation 10min, fill
Divide and go the removal of impurity, supernatant is extracted 3 times with the ethyl acetate of 3 times of volumes, is added excessive anhydrous magnesium sulfate and is dried overnight, will handle
The HPLC analyses of stereoselectivity are carried out after sample high speed centrifugation afterwards：Daicel Chiralcel OD-H(250mm×
4.6mm) liquid-phase chromatographic column；Mobile phase is n-hexane：Isopropanol：Trifluoroacetic acid (95:5:0.05, v/v/v)；Flow velocity 1mL/min,
30 DEG C of column temperature；Ultraviolet detection wavelength 210nm；Sample size 5 μ L, the retention time 34.3min of (R)-phenyllactic acid.Measurement result is shown in Table
2。
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 7 produces (R)-phenyllactic acid
Thalline 10g/L, the 1mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 6.0)
Pyruvic acid, 1.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 8 produces (R)-phenyllactic acid
Thalline 20g/L, the 5mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 6.0)
Pyruvic acid, 7.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 9 life acid production (R)-phenyllactic acid
Thalline 20g/L, the 6mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 6.0)
Pyruvic acid, 9.0mmol glucose, at 30 DEG C, 200r/min reacts 24h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 10 produces (R)-phenyllactic acid
Thalline 20g/L, the 5mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 6.5)
Pyruvic acid, 7.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.
The recombinant bacterium catalytic asymmetric reduction phenylpyruvic acid of embodiment 11 produces (R)-phenyllactic acid
Thalline 20g/L, the 5mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 7.0)
Pyruvic acid, 7.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.
The recombinant bacterium catalytic asymmetric reduction Sodium.beta.-phenylpyruvate of embodiment 12 produces (R)-phenyllactic acid
Thalline 20g/L, the 5mmol benzene of the gained of embodiment 5 is added in 10ml kaliumphosphate buffers (100mM, pH 6.0)
Sodium Pyruvate, 7.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Substrate and product assay measure are the same as embodiment 6.Measurement result is shown in Table 2.The phenylpyruvic acid reductase both can be with benzene
Pyruvic acid is substrate, again can be using Sodium.beta.-phenylpyruvate as substrate, and asymmetric reduction prepares optical voidness (R)-phenyllactic acid.
The recombinant bacterium catalytic asymmetric reduction Sodium.beta.-phenylpyruvate of embodiment 13 produces (R)-phenyllactic acid
The effect of restructuring phenylpyruvic acid reductase production (R)-phenyllactic acid is amplified in 100mL systems.Take 2g real
The recombination bacillus coli lyophilized cells for applying the gained of example 5 are suspended in 100ml phosphoric acid-kaliumphosphate buffer (100mmol/L, pH 6.0)
In, add 9.31g substrate Sodium.beta.-phenylpyruvates, 15g glucose.At 30 DEG C, 200r/min reacts 9h.Reaction uses acetic acid second after terminating
Ester is extracted, and is extracted 3 times, combining extraction liquid, is added anhydrous sodium sulfate drying and is stayed overnight, and rotary evaporation removes solvent, obtains
8.51g (R)-phenyllactic acid, ee>99.9%.
The asymmetric reduction of the recombinant bacterium of table 2 catalysis phenylpyruvic acid (sodium)
The structure and recombination expression of the phenylpyruvic acid reductase mutant enzyme of embodiment 14
Carried out for the phenylpyruvic acid reductase LcKAR full-length gene orders (SEQ ID No.1) obtained by case study on implementation 2
Base mutation, the G of the 180th of reductase gene coded sequence being sported into C respectively, the T of the 515th sports C, and the 543rd
The C of position sports A, and the A of the 773rd sports T, and the C of the 894th sports T, and (in addition to 515 and the 773rd, remaining is heavy
Silent mutation), so as to obtain the base sequence of the mutator as shown in SEQ ID No.3 and SEQ ID No.5.Its ammonia encoded
Base acid sequence is SEQ ID No.4 and SEQ ID No.6, i.e., by the phenylpyruvic acid reductase (SEI ID No.2) of lactobacillus
172 Phe for being sport Ser, and the Asp of the 258th sports Val, therefore respectively by the phenylpropyl alcohol coded by mutator
Ketone acid reductase is named as LcKAR/F172S and LcKAR/D258V.Method Prepare restructuring transformant as described in Example 3, and
According to embodiment 4 method structure with glucose dehydrogenase coexpression recombinant conversion body, and according to example 5 method prepare it is quiet
Cell is ceased, and is freeze-dried to obtain lyophilized cells.
Embodiment 15 carries the asymmetric reduction of mutant enzyme LcKAR/F172S recombinant bacterium catalysis Sodium.beta.-phenylpyruvate
The gained of embodiment 14 is added in 10ml kaliumphosphate buffers (100mmol/L, pH 6.0) contains mutant enzyme
(LcKAR/F172S) thalline 0.2g, 1mmol Sodium.beta.-phenylpyruvate, 1.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Reaction takes a certain amount of conversion fluid after terminating, and the HCl for adding 9% adjusts pH to be removed to 2,8000r/min high speed centrifugation 5min are less than
The insoluble impurity such as thalline, HPLC analyses are carried out using method same as Example 6.It the results are shown in Table 3.Contain mutant enzyme
(LcKAR/F172S) recombinant conversion body only needs 3h to convert 100mM 2- oxo -3- phenylpropionic acid sodium, and ee values are still protected
Hold>99% (R).
Embodiment 16 carries the asymmetric reduction of mutant enzyme LcKAR/F172S recombinant bacterium catalysis Sodium.beta.-phenylpyruvate
The gained of embodiment 14 is added in 10ml kaliumphosphate buffers (100mmol/L, pH 6.0) contains mutant enzyme
(LcKAR/F172S) thalline 0.2g, 5mmol Sodium.beta.-phenylpyruvate, 7.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.
Reaction takes a certain amount of conversion fluid after terminating, and the HCl for adding 9% adjusts pH to be removed to 2,8000r/min high speed centrifugation 5min are less than
The insoluble impurity such as thalline, HPLC analyses are carried out using method same as Example 6.It the results are shown in Table 3.Contain mutant enzyme
(LcKAR/F172S) recombinant conversion body only needs 6h to convert 500mM 2- oxo -3- phenylpropionic acid sodium, and ee values are still protected
Hold>99% (R).Compared with female parent, the mutant only needs the time can of half to reach identical changing effect.Vigor point
Analysis display, the phenylpyruvic acid reductase that the mutation in the site makes improve 4 times to the catalysis activity of phenylpyruvic acid substrate, thus
Under the conditions of same catalyst amount and concentration of substrate, it is only necessary to which less time can reach identical effect.
Embodiment 17 carries the asymmetric reduction of the mutant enzyme LcKAR/D258V phenylpropionic acid of recombinant bacterium catalysis 2- oxos -3
The gained of embodiment 12 is added in 10ml kaliumphosphate buffers (100mmol/L, pH 6.0) contains mutant enzyme
(LcKAR/D258V) thalline 0.2g, 1mmol 2- oxo -3- phenylpropionic acid sodium, 1.5mmol glucose, at 30 DEG C, 200r/
Min reacts 12h.Reaction terminate after take a certain amount of conversion fluid, add 9% HCl adjust pH to be less than 2,8000r/min at a high speed from
Heart 5min, the insoluble impurity such as thalline are removed, HPLC analyses are carried out using method same as Example 6.It the results are shown in Table 3.Contain
The recombinant conversion body of mutant enzyme (LcKAR/D258V) can not convert 5100mM 2- oxo -3- phenylpropionic acid sodium, ee values in 24h
Still keep>99% (R).The mutation in the site result in the reduction of phenylpyruvic acid reductase vitality, only retain maternal 20%
Vigor, although 24h will be extended in the reaction time, still it can not reach>99% conversion.But the mutational site is selected for mapping
Selecting property does not influence, and remains in that>99%ee (R).
Asymmetric reduction of the phenylpyruvic acid reductase mutant enzyme of table 3 to phenylpyruvic acid
The asymmetric reduction of the pure enzymatic Sodium.beta.-phenylpyruvate of the phenylpyruvic acid reductase of embodiment 18
The restructuring phenylpyruvic acid of the gained of embodiment 3 is added in 10ml kaliumphosphate buffers (100mmol/L, pH 6.0) also
The pure enzyme 50mg of protoenzyme, 1mmol Sodium.beta.-phenylpyruvates, 1.5mmol glucose, at 30 DEG C, 200r/min reacts 12h.After reaction terminates
Take a certain amount of conversion fluid, the HCl for adding 9% adjusts pH to being less than 2,8000r/min high speed centrifugation 5min, using with embodiment 6
Identical method carries out HPLC analyses.In 12h, it is possible to achieve the complete conversion of 100mM Sodium.beta.-phenylpyruvates, and ee values>99%
(R)。
Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill
The people of art, without departing from the spirit and scope of the present invention, it can all do various change and modification, therefore the protection model of the present invention
Enclose being defined of being defined by claims.
Claims (7)
1. a kind of lactobacillus (Lactobacillus sp.), the bacterium were preserved in Chinese microorganism strain on November 13rd, 2014
Preservation administration committee common micro-organisms center, deposit number are CGMCC No.9967, and preservation address is Chaoyang District, Beijing City north
No. 3 Institute of Microorganism, Academia Sinica of institute of occasion West Road 1.
2. a kind of phenylpyruvic acid reductase, it is characterised in that the phenylpyruvic acid reductase is the amino as shown in SEQ ID No.2
Acid sequence is by the derivative with phenylpyruvic acid reductase activity obtained from substituting, lacking or adding one or more amino acid
Protein；Amino acid sequence of the derived protein as shown in SEQ ID No.4 or SEQ ID No.6.
A kind of 3. gene for encoding phenylpyruvic acid reductase, it is characterised in that the base sequence of the gene such as SEQ ID No.3
Or shown in SEQ ID No.5.
A kind of 4. recombinant expression carrier for including gene described in claim 3.
A kind of 5. recombinant expression transformants for including gene described in claim 3.
6. application of the lactobacillus described in claim 1 in the production of phenylpyruvic acid reductase or (R)-phenyllactic acid.
7. the method that one kind prepares (R)-phenyllactic acid using phenylpyruvic acid reductase, it is characterised in that be to come from lactobacillus
CGMCCNo.9967 phenylpyruvic acid reductase or its active mutant, or carry the benzene for coming from lactobacillus CGMCC No.9967
The bacterial strain of pyruvic acid reductase or its active mutant is catalyst, is catalyzed phenylpyruvic acid or its sodium salt asymmetric reduction reaction system
Standby (R)-phenyllactic acid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410818165.XA CN104560800B (en) | 2014-12-24 | 2014-12-24 | A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410818165.XA CN104560800B (en) | 2014-12-24 | 2014-12-24 | A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104560800A CN104560800A (en) | 2015-04-29 |
| CN104560800B true CN104560800B (en) | 2018-04-06 |
Family
ID=53077881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410818165.XA Active CN104560800B (en) | 2014-12-24 | 2014-12-24 | A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104560800B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107164341A (en) * | 2017-06-21 | 2017-09-15 | 江南大学 | A kind of phenylpyruvic acid reductase in Lactobacillus plantarum source and application |
| CN108277190A (en) * | 2018-01-18 | 2018-07-13 | 江南大学 | A kind of method of resting cell phenylalanine production phenyllactic acid |
| CN113025544A (en) * | 2021-03-02 | 2021-06-25 | 江南大学 | Method for synthesizing L-phenyllactic acid by utilizing recombinant microorganism whole cell catalysis |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101333547A (en) * | 2008-08-05 | 2008-12-31 | 江南大学 | Method for producing phenyl-lactic acid by controlling pH value, feeding and fermenting |
| CN1940078B (en) * | 2006-08-23 | 2010-07-21 | 江南大学 | Production of biological antiseptic agent phenyllactic acid |
| CN103555608B (en) * | 2013-09-16 | 2015-06-03 | 华东理工大学 | Quininone reductase and application thereof in asymmetric synthesis of (R)-3-quinuclidinol |
-
2014
- 2014-12-24 CN CN201410818165.XA patent/CN104560800B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1940078B (en) * | 2006-08-23 | 2010-07-21 | 江南大学 | Production of biological antiseptic agent phenyllactic acid |
| CN101333547A (en) * | 2008-08-05 | 2008-12-31 | 江南大学 | Method for producing phenyl-lactic acid by controlling pH value, feeding and fermenting |
| CN103555608B (en) * | 2013-09-16 | 2015-06-03 | 华东理工大学 | Quininone reductase and application thereof in asymmetric synthesis of (R)-3-quinuclidinol |
Non-Patent Citations (2)
| Title |
|---|
| UniProtKB - K0N557(K0N557_LACCA);Uniprot;《Uniprot》;20121128;全文 * |
| UniProtKB - K6RLM1(K6RLM1_LACCA);Uniprot;《Uniprot》;20130109;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104560800A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wen et al. | Enhanced solvent production by metabolic engineering of a twin-clostridial consortium | |
| CN103667371B (en) | A kind of biological production of Salvianic acidA | |
| EP2308959A1 (en) | Novel microorganism and its use in lignocellulose detoxifixcation | |
| KR101076042B1 (en) | Enhanced Ethanol and Butanol Producing Microorganisms and Method for Preparing Ethanol and Butanol Using the Same | |
| BRPI0618074A2 (en) | thermophilic organisms for converting lignocellulosic biomass to ethanol | |
| CN110791493B (en) | Aspartate ammonia lyase mutant and application thereof | |
| TW200914610A (en) | Isopropyl alcohol-producing bacteria and method for producing isopropyl alcohol using the same | |
| CN107312737A (en) | A kind of recombination bacillus coli, preparation method and the method for synthesizing 3,4 dihydroxy butyric acid | |
| CN104560800B (en) | A kind of phenylpyruvic acid reductase and its application in asymmetric syntheses (R) phenyllactic acid | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN109370967A (en) | A kind of engineering bacteria and its application in tyrosol production | |
| CN101463358B (en) | Nitrile hydratase gene cluster and use thereof | |
| CN107142251A (en) | Serratieae carbonyl reductase and its application in optical activity alkyl lactone is prepared | |
| CN106520715A (en) | Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis | |
| CN105200076A (en) | Bacillus subtilis recombined to express gamma-lactamase and immobilization and application | |
| CN105062938A (en) | Engineering bacterium capable of producing D-lactate by aid of pentose and hexose synchronously by means of fermentation, and fabrication and application of engineering bacterium | |
| WO2015158094A1 (en) | Clostridium beijerinckii with high stress resistance and uses thereof | |
| CN108531434A (en) | A method of improving Raoul bacterium 2,5- furandicarboxylic acid yield | |
| CN114806998B (en) | Ralstonia engineering bacterium for producing glucose and fermentation production method | |
| CN116064435A (en) | Curcumin reductase Cfcura, coding gene and application thereof | |
| CN102146123A (en) | Gluconobacter oxydans-pyrroloquiniline quinone (PQQ) synthetic protein system and gene cluster for coding same | |
| CN114107356B (en) | Method for transforming pseudomonas putida to assimilate D-galactose | |
| CN110184291A (en) | A kind of building and its application of the non-methanol induction of Pichia pastoris expression vector of sequestered | |
| CN113234611B (en) | Saccharomyces cerevisiae engineering bacteria and application thereof in preparation of protocatechuic acid | |
| CN111394396B (en) | Method for producing 1, 3-propylene glycol by using glycerol fermentation by microorganisms |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |