CN104548073B - Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared - Google Patents
Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared Download PDFInfo
- Publication number
- CN104548073B CN104548073B CN201410766259.7A CN201410766259A CN104548073B CN 104548073 B CN104548073 B CN 104548073B CN 201410766259 A CN201410766259 A CN 201410766259A CN 104548073 B CN104548073 B CN 104548073B
- Authority
- CN
- China
- Prior art keywords
- prx
- peroxiredoxin
- recombinant proteins
- protein
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a kind of Peroxiredoxin Prx I recombinant proteins prepare resistance acute bacterial sepsis disease drug in application, described recombinant protein be Peroxiredoxin Prx I amino acid sequences amino terminal or carboxyl terminal connection feed back peptide sequence it is built-up；The amino acid sequence for feeding back peptide is AAVLLPVLLAAP；The present invention provides Peroxiredoxin Prx I recombinant proteins except with decomposing H first2O2Classical biochemical function outside, the also immunologic function with new resistance acute bacterial septicemia；By carrying out modified recombinant to the protein molecular, the efficiency that activated protein enters cell is significantly increased, it is assigned with higher biological activity by improving utilization ratio, so as to reduce production cost, has a good application prospect.
Description
(1) technical field
The present invention relates to a kind of recombinant protein and application, more particularly to a kind of Peroxiredoxin Prx I restructuring
Application of the albumen in bacteria resistance sepsis disease drug is prepared.
(2) background technology
Peroxiredoxin (Peroxiredoxins, Prx, EC 1.11.1.15) is a class peroxidase man
Race's albumen, is widely present in the cells such as animal and plant.Including in the vertebrate including mammal, there is six kinds
Prxs albumen (Prx I~VI), they have conservative amino acid sequence, functional activity site and similar catalyst mechanism,
It is respectively positioned in the organelles such as nucleus, cytoplasm, mitochondria, peroxisome, lysosome and golgiosome, constitutes thin
The important antioxidant network system of intracellular.In Prxs protein families, Prx I are content highest and widely distributed member.Mesh
Before think that the major functions of Prxs protein families is by decomposing H2O2And play antioxidation.Prxs decomposing Hs2O2Molecule
Mechanism is realized by the redox of cysteine (Cys) residue in its amino acid sequence, i.e., protected in Prxs albumen
The reproducibility Cys-SH kept is by H2O2Oxidation, generates oxidation state Cys-SOH, so that by H2O2It is reduced into H2O；And oxidation state Cys-
SOH residues can react with the reproducibility Cys-SH in another Prx albumen, form intermolecular or intramolecular disulfide bond, constitute
Homotype or heterodimer；Then the dimer can be further in thioredoxin (Trx), thioredoxin reductase (TrxR)
In the presence of the NADPH Trx also original systems constituted or reduced glutathione GSH, monomer reduction state egg is reduced into again
In vain, circulate in this way, make H2O2Constantly it is decomposed.Due to H2O2It is one of important biochemical products of biologic artifact physiological metabolism,
The H of high concentration2O2Accumulate and balance the oxidation-reduction for destroying body, to intracellular lipid, nucleic acid, carbohydrate and protein etc.
Molecule causes oxidative damage, so as to produce toxic action to cell, induces the generation of body aging and numerous metabolic diseases.Cause
This, Prxs albumen may play a significant role in terms of body oxidation-reduction balance is maintained.
Except enzymatic decomposition H2O2Biochemical function outside, for Prxs whether have other biological function it is unclear.This
Invention finds that Prxs albumen has the immunology New function of bacterial-infection resisting using Prx I as research object, first, and for Prx
I be it is a kind of be distributed in intracellular activated protein, it is necessary to be played a role in intracellular, and the Prx I proteins of in-vitro recombination expression because
Cell can not be efficiently entering and this application problem that is difficult to play a role, design it is a kind of have to feed back enter cell ability
Peptide sequence (referred to as feeds back peptide), a kind of with feedback cell function by by the feedback peptide and Prx I molecular recombinations, constructing
New Prx I recombinant proteins, the antibacterial immunity function of Prx I proteins is significantly improved.
(3) content of the invention
Mesh of the present invention, which is to provide a kind of Peroxiredoxin Prx I recombinant proteins, has bacteria resistance septicemia
New function；By the way that Prx I proteins are carried out into molecular structure alteration, recombinated in its amino or carboxyl terminal a kind of thin with feeding back
The peptide sequence (feedback peptide) of born of the same parents' ability, makes the antisepsis function of Prx I proteins be significantly improved.
The technical solution adopted by the present invention is：
The present invention provides a kind of Peroxiredoxin Prx I recombinant proteins and is preparing bacteria resistance sepsis disease drug
In application, described recombinant protein is the amino terminal (- NH in Peroxiredoxin Prx I amino acid sequences2)
Or carboxyl terminal (- COOH) connection feedback peptide sequence is built-up；The amino acid sequence for feeding back peptide is AAVLLPVLLAAP,
The nucleotides sequence for encoding the signal peptide amino acid sequence is classified as GCAGCCGTTCTTCTCCCTGTTCTTCTTGCCGCACCC.
Bacterial septicemia of the present invention infects for Aeromonas hydrophila (Aeromonas hydrophila, A.h)
Caused acute sepsis.
Peroxiredoxin Prx I proteins of the present invention are compiled by the Prx I genes of vertebrate filefish
Code, is formed using Escherichia coli in-vitro recombination expression, and the gene order (gb DQ003333.1) of coding Prx I proteins is SEQ
Shown in ID NO.1.
Prx I recombinant proteins of the present invention be used in particular for Aeromonas hydrophila (Aeromonas hydrophila,
A.h the preparation of the anti-infectious immunity medicine of acute sepsis caused by), it can significantly increase experimental animal and acute bacterial is lost
The resistance of mass formed by blood stasis, increases substantially survival rate.
It is of the present invention to carry the Prx I recombinant proteins for feeding back peptide sequence, it is successfully solved as a kind of intracellular activity
Albumen, after being produced through vivoexpression, how efficient lossless hinders ground into this application problem of cells play function.Respectively in body
Outer culture cell and in-vivo tissue level detect the feedback cell ability of Prx I recombinant proteins, while utilizing Aeromonas hydrophila
Experimental animal (zebra fish) acute sepsis model of infection, the Prx I proteins compared before and after transforming are (not connected to feed back peptide just
Normal Prx I proteins and connection feed back the restructuring Prx I proteins of peptide) to the difference of acute bacterial septicemia resistivity, so that
Prove that the function of engineered Prx I proteins is significantly improved.
Compared with prior art, the beneficial effects are mainly as follows：(1) present invention provides peroxide first
Oxidoreducing enzyme Prx I are except with decomposing H2O2Classical biochemical function outside, also with the new bacillary acute sepsis of resistance
Immunologic function；(2) by carrying out modified recombinant to the protein molecular, carry it a kind of with many of feedback cell function
Peptide sequence, has been successfully established a kind of undamaged approach for giving cytoactive albumen, and the approach can significantly increase activated protein
Into the efficiency of cell, it is assigned with higher biological activity by improving utilization ratio, so that production cost is reduced,
Have a good application prospect.
(4) illustrate
Fig. 1 is the cDNA amplifications of Prx I recombinant proteins；M：DNA Marker；1：Prx I-NS cDNA fragments；2：
Prx I-CS cDNA fragments；3：Prx I cDNA fragments.
Fig. 2 is the induced expression result of Prx I recombinant proteins；M：Albumen Marker；1,3,5：Converted Prx I-NS,
Prx I-CS and Prx I recombinant expression plasmids but the control group without induction；2：The induced expression knot of Prx I-NS recombinant proteins
Really；4：The induced expression result of Prx I-CS recombinant proteins；6：The induced expression result of normal Prx I proteins.
Fig. 3 is the feedback cell function qualification result (200 ×) of Prx I recombinant proteins；The first row：Ordinary optical microscope
Under cell image；Second row：Cell image under fluorescence microscope, represents FITC, FITC-Prx I, FITC-Prx respectively
I-NS and FITC-Prx I-CS recombinant proteins feed back the result that fluorescence signal is sent after cell.
Fig. 4 is the histiocytic shows fluorescent microscopy images of feedback in vivo (200 ×) of Prx I recombinant proteins；Represent respectively
FITC-Prx I-NS recombinant proteins, FITC-Prx I and FITC send fluorescence after feeding back the different tissues cells such as liver,spleen,kidney, intestines
The result of signal.
Fig. 5 is the immunologic function qualification result that Prx I recombinant proteins antisepsis infects.N is the number of experiment fish.
(5) embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
The cDNA clone and structure of embodiment 1, Prx I and its recombinant molecule
RNA is extracted from filefish spleen according to the explanation of Trizol kits (TaKaRa), 3'-Full RACE Core are utilized
RNA reverse transcriptions are cDNA by Set kits (TaKaRa), using the cDNA as template, and peptide nucleotide sequence is fed back with containing coding
Primers F 1 and R1 amplification with N-terminal feed back peptide Prx I (Prx I-NS)；Peptide nucleotides sequence is fed back with primers F 2 and containing coding
The primer R2 amplifications of row feed back the Prx I (Prx I-CS) of peptide with C-terminal；With primers F 0 and R0 amplifications without the normal of feedback peptide
Prx I。
F1：5'-CCATGGCAGCCGTTCTTCTCCCTGTTCTTCTTGCCGCACCCGCTGCAGGCAAAGCTC-3'
R1：5'-CTCGAGGTGCTTGGAGAAGAACTC-3'
F2：5'-CCATGGGCCACCACCACCACCACCACGCTGCAGGCAAAGCTC-3'
R2：5'-CTCGAGTTAGGGTGCGGCAAGAAGAACAGGGAGAAGAACGGCTGCGTGCTTGGAGAAGAACTC
-3'
F0：5'-CCATGGCTGCAGGCAAAGCTC-3'
R0：5'-CTCGAGGTGCTTGGAGAAGAACTC-3'
PCR amplification system composition is shown in Table 1；PCR conditions are：94 DEG C of pre-degenerations 4min, 94 DEG C of denaturation 30s, 56 DEG C of annealing
30s, 72 DEG C of extensions 30s, 72 DEG C of extension 10min, totally 35 circulations.PCR primer is reflected through 1.2% agarose gel electrophoresis and sequencing
It is fixed, obtain the Prx I-NS, the Prx I-CS that are consistent with expected size and sequence and Prx I cDNA (Fig. 1).
PCR amplification system prepared by table 1.Prx I and its recombinant molecule cDNA
The preparation of embodiment 2, Prx I and its recombinant protein
NcoI and XhoI restriction enzyme sites are separately added into the PCR primer described in embodiment 1, then respectively by PCR primer
Recombinate in carrier T, build Prx I, Prx I-NS and Prx I-CS plasmids (pT/Prx I, pT/Prx I-NS and pT/Prx
I-CS)；With NcoI and XhoI difference digestions pT/Prx I, pT/Prx I-NS and pT/Prx I-CS plasmids, purpose product warp
1.2% agarose gel electrophoresis identify and be sequenced it is errorless after, then recombinate into pET28 (a) expression plasmids, obtain three kinds it is corresponding
Prokaryotic expression plasmid.Convert E. coli expression strains Rosetta (BL21) respectively with these three prokaryotic expression plasmids, will convert
Bacterium is inoculated in LB fluid nutrient mediums (Shanghai life work) of the 5ml containing Amp (ampicillin, the μ g/ml of final concentration 50), is put 37 DEG C and is shaken
Bed, 250rpm culture 5h, then by nutrient solution with 1:100 volume ratio, adds the LB liquid containing Amp (the μ g/ml of final concentration 50) and trains
Support and spread cultivation in base, by above-mentioned condition by Bacteria Culture to OD600Between 0.6~1.0 when add IPTG (isopropylthio galactolipins
Glycosides, final concentration 0.1mM), it is transferred to 20 DEG C of low temperature shaking tables, 100rpm overnight incubations.Next day, conversion bacterial strain is collected, after ultrasonication
Albumen supernatant is collected, the expression of Prx I, Prx I-NS and Prx I-CS recombinant proteins is identified using SDS-PAGE, and is passed through
Ni-NTA protein purifications post (Shanghai life work) is isolated and purified.As a result show, above method success is induction of soluble Prx I, Prx
The expression of I-NS and Prx I-CS recombinant proteins, and obtain corresponding purifying protein (Fig. 2).
Embodiment 3, Prx I and its recombinant protein feed back the identification of cell function
1st, FITC fluorescence labelings Prx I and its recombinant protein Prx I-NS and Prx I-CS
Crosslinked fluid is prepared：Take 7.56g NaHCO3、1.06g Na2CO3With 7.36g NaCl, pH is adjusted extremely after being dissolved in water
9.5, add water and be settled to 1L, 121 DEG C sterilizing 30 minutes it is standby.FITC mark crosslinked fluids are with preparation：Fluorescein FITC pulvis is molten
In above-mentioned crosslinked fluid, final concentration of 1mg/ml.It is prepared by protein-crosslinking liquid：Obtained with being purified in above-mentioned crosslinked fluid dialysis embodiment 2
Prx I-NS, the Prx I-CS and Prx I recombinant proteins obtained, trapped fluid is the protein-crosslinking liquid of these three albumen.
FITC mark crosslinked fluids are separately added into by Prx I- with F/P (FITC/Protein)=15 μ g/100 μ g ratio
In NS, Prx I-CS and Prx I protein crosslinked fluids, 4 DEG C of lucifuges are well mixed.4 DEG C, 10000g centrifugation 10min abandon precipitation, on
Clear liquid is albumen (FITC-Prx I-NS, FITC-Prx I-CS and FITC-Prx I) solution of FITC marks.Utilize PBS
Three kinds of labelled proteins of (pH 7.2) dialysis, collect trapped fluid, determine light absorption value A280And A495, utilize formula：Protein concentration (mg/
ML)=[A280–0.31×A495]/1.4, calculate the concentration of FITC labelled proteins.
2nd, the external feedback cell function identification of FITC labelled proteins
The Hela cells that IMDM nutrient solutions (U.S. CORNING, containing 10%FBS) are cultivated access 96 well culture plates, per hole
5000 cells, 37 DEG C, 5%CO2Cultivate 24h.Next day, nutrient solution is discarded, change the IMDM nutrient solutions without FBS, trained to cell
Support in hole and be separately added into the FITC solution that 10 μ L concentration are 10 μM and the labelled protein (FITC-PrxI- that 10 μ L concentration are 10 μM
NS, FITC-Prx I-CS and FITC-Prx I), every group of sample sets 3 repetitions, 37 DEG C, 5%CO2It is incubated 0.5h.Then use
PBS cell, is repeated twice, then adds 150 μ l PBS into every hole cell, puts inverted fluorescence microscope (ZEISS
Axiovert40 observation is taken pictures under).As a result show, add the cell of FITC and FITC-Prx I proteins, have no obvious fluorescence
Signal, and add the cell for being connected to the Prx I recombinant proteins (FITC-Prx I-NS and FITC-Prx I-CS) for feeding back peptide, then
Obvious fluorescence signal is presented, shows that Prx I protein penetration cell films can effectively be guided and enter intracellular (figure by feeding back peptide
3)。
3rd, the external feedback histocyte Function Identification of FITC labelled proteins
Take 15 tail zebra fish, be randomly divided into 3 groups, 5 tails/group, be injected intraperitoneally respectively FITC solution that 10 μ l concentration are 10 μM,
10 μ l concentration are 10 μM of FITC-Prx-I and 10 μ l concentration are to raise 2h in 10 μM of FITC-Prx-I-NS, 28 DEG C of recirculated waters
Afterwards, liver, spleen, kidney and intestinal tissue are taken respectively, frozen section embedding medium (Tissue-Tek O.C.T) embedding is put, and -80 DEG C solid
It is fixed to stay overnight, freezing microtome (LeiCa 1950) section, 4.5 μm of slice thickness, in inverted fluorescence microscope (ZEISS
Axiovert40 observation is taken pictures under).As a result show, the tissue in FITC and FITC-Prx-I injection individuals source has no obvious glimmering
Optical signal, and the tissue in FITC-Prx-I-NS injection individuals source shows strong fluorescence signal, shows that feeding back peptide can not only have
Effect guiding Prx I proteins penetrate the cell of in vitro culture, moreover it is possible to effectively guide Prx I proteins to penetrate in-vivo tissue cell (figure
4)。
The Function Identification of embodiment 4, Prx I recombinant protein bacteria resistance septicemia
Aeromonas hydrophila (Aeromonas hydrophila, A.h) bacterial strain (is carried by Zhejiang Institute of Fresh Water Aquatic Products
For) access beef-protein medium, 28 DEG C, 200rpm is cultivated after 8h, is collected thalline, is suspended with PBS.Take 150 tail zebras
Fish, is randomly divided into 3 groups, 50 tails/group, first group of intraperitoneal injection A.h bacterium (0.5 × 106CFU/ tails) it is used as control；Second group of abdominal cavity
Inject the mixed liquor (0.5 × 10 of A.h bacterium and restructuring Prx I proteins6CFU+0.25 μ g/ tails)；3rd group of intraperitoneal injection A.h bacterium and
Recombinate the mixed liquor (0.5 × 10 of Prx I-NS albumen6CFU+0.25 μ g/ tails), raised in 28 DEG C of recirculated water.Every 3 after infection
Once, Continuous Observation 24 hours records the death rate of each group, and experiment is repeated 3 times for hour observation, the statistics relative protection of 24 hours
Rate.Relative protection ratio=(the 1- experimental groups death rate/control group death rate) × 100%.As a result show, A.h bacterium infectable infections
The zebra fish death rate be 76.7 ± 1.1%, A.h bacterium joint Prx I recombinant protein co-injection groups the death rate be 73.3 ±
4.2%, protective rate is 4.4 ± 4.0%, and the death rate of A.h bacterium joint Prx I-NS recombinant protein co-injection groups for 57.7 ±
3.7%, protective rate is 25.2 ± 3.9%, compared with A.h bacterium, individually injection group and A.h bacterium combine Prx I protein injection groups
Compared with the septicemia death rate of A.h bacterium joint Prx I-NS recombinant protein injection groups significantly reduces (P<0.05) Prx I-NS, are shown
Recombinant protein has played the Septicemia function of significant anti-Aeromonas hydrophila induction.
The Function Identification of table 2.Prx I recombinant protein bacteria resistance septicemia
In the present invention, the restructuring Prx I proteins by molecular modification obtain the ability for feeding back cell, and show new
The immunologic function of bacteria resistance septicemia.But what experiment was enumerated is only some instantiations of the present invention above, it is clear that this
Invention also has many deformations, the institute that one of ordinary skill in the art directly can export or associate from present disclosure
There is deformation, be considered as protection scope of the present invention.
Claims (2)
1. a kind of application of Peroxiredoxin Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared, its
It is at amino terminal or the carboxyl end of Peroxiredoxin Prx I amino acid sequences to be characterised by described recombinant protein
It is built-up that end connection feeds back peptide sequence；The amino acid sequence for feeding back peptide is AAVLLPVLLAAP；The bacteria resistance loses
Mass formed by blood stasis is acute sepsis caused by Aeromonas hydrophila (Aeromonas hydrophila).
2. application as claimed in claim 1, it is characterised in that the nucleotide sequence of the Peroxiredoxin Prx I
Shown in SEQ ID NO.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410766259.7A CN104548073B (en) | 2014-12-12 | 2014-12-12 | Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410766259.7A CN104548073B (en) | 2014-12-12 | 2014-12-12 | Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104548073A CN104548073A (en) | 2015-04-29 |
| CN104548073B true CN104548073B (en) | 2017-08-11 |
Family
ID=53065842
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410766259.7A Active CN104548073B (en) | 2014-12-12 | 2014-12-12 | Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104548073B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101616928A (en) * | 2007-01-29 | 2009-12-30 | 株式会社普罗赛尔制药 | Novel macromolecule transduction domains and recognition methods thereof and purposes |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6835810B2 (en) * | 2002-05-13 | 2004-12-28 | Geneshuttle Biopharma, Inc. | Fusion protein for use as vector |
-
2014
- 2014-12-12 CN CN201410766259.7A patent/CN104548073B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101616928A (en) * | 2007-01-29 | 2009-12-30 | 株式会社普罗赛尔制药 | Novel macromolecule transduction domains and recognition methods thereof and purposes |
Non-Patent Citations (3)
| Title |
|---|
| Peroxiredoxin IV Regulates Pro-Inflammatory Responses in Large Yellow Croaker (Pseudosciaena crocea) and Protects against Bacterial Challenge;Suhong Yu,et al;《Journal of Proteome Research》;20100930;1424-1436页 * |
| 大黄鱼免疫应答的功能蛋白质组学研究;余素红;《中国博士学位论文全文数据库 农业科技辑》;20100115(第1期);D052-1页 * |
| 大黄鱼脾脏转录组和表达谱分析以及过氧化物酶4结构与功能研究;母尹楠;《中国优秀硕士学位论文全文数据库 农业科技辑》;20111115(第11期);D052-9 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104548073A (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105061603B (en) | Antibacterial peptide-lysozyme fusion protein preparation method and applications | |
| CN109593127B (en) | Gene recombinant collagen peptide MJ L GG-34 and preparation method and application thereof | |
| Leng | Unravelling methanogenesis in ruminants, horses and kangaroos: the links between gut anatomy, microbial biofilms and host immunity | |
| CN102304484B (en) | New strain of pseudoalteromonas flavipulchra and use thereof | |
| Vaseeharan et al. | Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus | |
| CN104448004A (en) | Fused antibacterial peptide and preparation method thereof | |
| Bruno et al. | The diversification of the antimicrobial peptides from marine worms is driven by environmental conditions | |
| CN101418039A (en) | Novel antibacterial peptide and preparation method and use thereof | |
| Germond et al. | Symbiotic associations in ciliates: ecological and evolutionary perspectives | |
| CN104548073B (en) | Application of the Prx I recombinant proteins in bacteria resistance sepsis disease drug is prepared | |
| CN104805066A (en) | Staphylococcus lyase and application thereof | |
| CN102241747A (en) | Humanlike elastin and production method thereof | |
| Omeka et al. | Glutaredoxin 2 from big belly seahorse (Hippocampus abdominalis) and its potential involvement in cellular redox homeostasis and host immune responses | |
| CN104611343A (en) | Isolated antiviral natural immune protein TRIM32 (tripartite motif 32) for carps and antiviral activity | |
| CN1238378C (en) | An antibiotic peptide and its coded sequence and use | |
| CN100352841C (en) | Antibiotic peptide and its coding sequence and uses | |
| Zheng et al. | Prediction and characterization of a novel hemoglobin-derived mutant peptide (mTgHbP7) from Tegillarca granosa | |
| Wibawa et al. | acid soluble collagen from skin of common carp (Cyprinus carpio L), red snapper (Lutjanus sp.) and milkfish (Chanos chanos) | |
| CN101565462B (en) | Large yellow croaker BPI-BN protein, primer and applications thereof in preparing antibiotic drugs | |
| CN102604906B (en) | Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof | |
| CN101420973A (en) | Pharmaceutical compositions comprising SODs and prolamine based peptide fragments | |
| CN105755030A (en) | Preparation method of Pinctada fucata meat antioxidant peptides | |
| CN100402552C (en) | Antibiotic peptide and its code sequence and use | |
| CN101139599A (en) | Cultivated silkworm peptidoglycan identification protein gene | |
| CN107827968A (en) | A kind of polypeptide separated from Greenling |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211207 Address after: 311106 room 402, building 3, No. 1500, Wenyi West Road, Cangqian street, Yuhang District, Hangzhou City, Zhejiang Province Patentee after: HANGZHOU S-EVANS BIOSCIENCES, Ltd. Address before: 310058 No. 388 Tong Road, Xihu District, Zhejiang, Hangzhou, Yuhang Patentee before: ZHEJIANG University |