CN101418039A - Novel antibacterial peptide and preparation method and use thereof - Google Patents
Novel antibacterial peptide and preparation method and use thereof Download PDFInfo
- Publication number
- CN101418039A CN101418039A CNA2008102294860A CN200810229486A CN101418039A CN 101418039 A CN101418039 A CN 101418039A CN A2008102294860 A CNA2008102294860 A CN A2008102294860A CN 200810229486 A CN200810229486 A CN 200810229486A CN 101418039 A CN101418039 A CN 101418039A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- 1cea
- gene
- temporin
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a new antibiosis peptide and a preparation method and application thereof, which belongs to the field of antibiosis peptide and preparation. According to the invention, the temporin-1CEa gene of the new antibiosis peptide is cloned from the total RNA of the skin of rana temporaria chensinensis; and all the DNA sequences are shown in a sequence list. The No.144 to No.192 nucleotides in the gene are encoded as temporin-1CEa; the total sequence is Phe Val Asp Leu Lys Lys Ile Ala Asn Ile Ile Asn Ser Ile Phe-AMIDATION; and the molecular weight is 1733 Daltons. The antibiosis peptide temporin-1CEa which can be prepared through an amino acid synthesizer or a genetic engineering method has remarkable antibiosis and anticancer activity and no haematolysis on the erythrocytes of a mammal, and can be used for preparing antibiosis and anticancer medicines.
Description
Technical field
The invention belongs to antibacterial peptide and preparation field thereof, the application of antibacterial peptide of particularly a kind of Rana temporaria chensinensis David genes encoding with antibiotic and antitumour activity and preparation method thereof and pharmacy aspect.
Background technology
Over past ten years, the widely-used a lot of bacteriums and the virus of causing of antibiotic medicine has all produced resistance to existing microbiotic, and the diffusion of resistance pathogenic strain makes antibiotic curative effect descend rapidly even disappears.Therefore, seek and kill and wound pathogenic micro-organism, and the chemical sproof new antibiotic of difficult formation has become one of focus of present research with brand-new mechanism.
Antibacterial peptide is that organism is through inducing a kind of micromolecule polypeptide with broad spectrum antibiotic activity of generation, generally form by 20-60 amino acid, molecular weight is about 1000-7000Da, have advantages such as thermally-stabilised, good water solubility, broad-spectrum antimicrobial, part bacterium, fungi, protozoon, virus and cancer cells etc. are all had powerful lethal effect.The mechanism of action of the antibacterial peptide of these genes encodings is different from traditional microbiotic, and it is not to come killing bacteria by the metabolic process that suppresses bacterium, but directly bores a hole on bacterial cell membrane, intracellular active substance is leaked cause bacterium death.Therefore, antibacterial peptide does not exist the use back to produce chemical sproof problem, is expected to become antibiotic, antiviral, the cancer therapy drug of a new generation.
Wood frog (Rana chensinensis) is the foot of a hill or mountain, Changbai Mountain, China the Northeast medicine, the dual-purpose precious frog kind of food.Wood frog is an amphibian animal, the living environment complexity is various, their skin is being kept their existence and is being adapted in the wide habitat and play an important role, in order to adapt to living environment, the biologically active substance of a great variety, that have special molecular structure, function complexity that distributed in the skin of batrachia is a huge bioactive molecules resources bank and drug resource storehouse.
Amphibians skin antibacterial peptide is the important composition composition in its congenital system of defense, and by genes encoding, rrna is synthetic, and 10-50 amino-acid residue formed, and molecular surface has positive charge, mostly can form the amphipathic αLuo Xuanjiegou.The antibacterial peptide of different genera Amphibians is at molecular weight, and amino acid is formed, charging property, and hydrophobicity, aspects such as space structure and antimicrobial spectrum are all different separately.Amphibians skin antibacterial peptide all is basic polypeptide mostly, combine with the lipid bilayer of the biomembranous layered arrangement of tart easily, rely on the characteristics of amphipathic α-Luo Xuanjiegou to form the ionic channel of striding film, mediate a series of biological effect, can under the prerequisite of injuring normal cell not, inhibitory or killing effect be arranged to bacterium, fungi, virus and cancer cells, become the focus of zoology, physiology, pharmaceutical research in the world in recent years, as microbiotic of new generation, extremely people pay close attention to.
Antibacterial peptide has experienced the quite a long time from being found to local the use, but less to their molecular structure and hereditary effect research, makes most antibacterial peptides can't be applied to clinical.
Summary of the invention
The purpose of this invention is to provide a kind of new antibacterial peptide with anti-microbial activity and antitumour activity, and the encoding sequence of this polypeptide and preparation method and the application in pharmacy thereof.
Antibacterial peptide temporin-1CEa of the present invention, it is the antibacterial peptide of Rana temporaria chensinensis David genes encoding, its total order is classified Phe Val Asp Leu Lys Lys Ile Ala Asn Ile Ile Asn Ser Ile Phe-AMIDATION as, molecular weight is 1733 dalton, can form tangible amphipathic α-Luo Xuanjiegou.
The encoding gene preprotemporin-1CEa of Rana temporaria chensinensis David antibacterial peptide temporin-1CEa of the present invention, it is: from the total RNA of Chinese Rana sylvatica Le conte skin skin separation and Extraction, purified mRNA, behind the synthetic cDNA of mRNA reverse transcription, be template with cDNA, GSP1/3 ' RACE Outer Primer is forward and reverse primer, carry out the PCR first time, with this product is template, and GSP1/3 ' RACE Inner Primer is forward and reverse primer, carries out the PCR second time.
The nucleotides sequence of the primer is classified as:
Primer GSP1:5 '-ATGTTCACCTTGAAGAAATCCCTG-3 ';
3’RACE?Outer?Primer：TACCGTCGTTCCACTAGTGATTT；
3’RACE?Inner?Primer：CGCGGATCCTCCACTAGTGATTTCACTATAGG。
The PCR program is as follows: 94 ℃ of 3min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, totally 30 circulations, 72 ℃ prolong 10min.The PCR product separates and recovery purpose fragment (see figure 1) through 3% agarose gel electrophoresis, the purpose fragment checks order with BcaBEST Primer RV-M, obtain the complete nucleotide sequence of Rana temporaria chensinensis David skin antibacterial peptide temporin-1CEa, sequence total length 315bp, its sequence is seen sequence table.
The engineered preparation method of antibacterial peptide temporin-1CEa is as follows:
1, the 144-192 position Nucleotide among the gene preprotemporin-1CEa of encoding antimicrobial peptide is carried out synthetic, and add 1 methionine(Met) codon ATG, be the dna fragmentation of 54bp at synthetic 51bpDNA sequence 5 ' end; Be connected in series behind 6 sections 54bp target DNA fragments, add terminator codon TAA, add two restriction enzyme site: SmaI/HindIII, total length 339bp respectively at 5 ' and 3 ' end at last at 3 ' end; The dna fragmentation of this 339bp of encoding antimicrobial peptide is spliced into complete double-stranded DNA by PCR, is T6AMP gene (see figure 2);
2, the preparation of CAG556-5 plasmid: the DNA and the Vector DNA (pSIMPLE-19EcoR V/BAP) of T6AMP gene mixed and use T
4Dna ligase connects, and 16 ℃ are incubated 30 minutes, connects liquid and is converted into E.coli JM109 competent cell, obtains containing the CAG556-5 plasmid of purpose antibacterial peptide gene T6AMP.
3, goal gene subclone: use Sma I/Hind III that the CAG556-5 plasmid is carried out after enzyme cuts, 3% agarose gel electrophoresis is carried out in sampling, after cutting glue and reclaiming about 340bp fragment, and called after CTB651 insert (see figure 3); Use PshAI/Hind III that pET-42a (+) the plasmid enzyme that spends the night is cut, 3% agarose gel electrophoresis is carried out in sampling, after cutting glue and reclaiming, and called after CTB651 carrier (see figure 4); Use T
4Dna ligase with CTB651 insert DNA and CTB651 carrier DNA carry out 16 ℃ be connected after, will connect product called after CTB651 (see figure 5), thermal transition to competence E.coli JM109, spread plate, incubated overnight thalline; From transforming the dull and stereotyped picking list bacterium colony of going up, be that primer carries out pcr amplification with T7/T7t, get the 1PCR amplified production and carry out 3% agarose gel electrophoresis, detect positive colony CTB651-6 gene (see figure 6).After the CTB651-6 thalline planted bacterium and extract plasmid, check order with the T7t primer, order-checking is correct.
4, genetic expression: the CTB651-6 gene transformation is to E.coli BL21 (DE3), transformant is cultivated, extracting protein also carries out SDS-PAGE and resolves, the CTB651-6 gene can be expressed under the standard expression condition, and soluble-expression is arranged, its molecular weight (see figure 7) that conforms to the theoretical value 43kD of prediction.
5, target protein purifying: with the GST-tag affinity column purification of recombinant proteins of GE company, be added to balance liquid the last white protein (about 4mg) that obtains (on the good pillar of 1 * PBS) balance, behind 5 times of column volume balance liquid flushing pillars 2 times, with 10 times of column volume elutriant (50mM Tris-HCl, 10mM reduced form glutathione, pH 8.0) the wash-out pillar, and collection effluent liquid, obtain the GST-T6AMP fusion rotein, in GST-T6AMP fusion rotein solution, add the Xa factor mixed solution, react 16h under the room temperature, GST-tag affinity column purification reaction liquid with GE company, obtain the T6AMP antimicrobial peptide protein, T6AMP is fractured into the temporin-1CEa antibacterial peptide through the hydrogen bromide effect.
Antibacterial peptide temporin-1CEa of the present invention can adopt the method for solid state chemistry to be prepared, Fmoc solid-phase peptide synthesis program according to standard carries out synthetic, synthetic peptide is through the reversed-phase HPLC (purifying of Vydac218TP1022 post 2.2cm * 25cm), adopt acetonitrile/water/trifluoroacetic acid system wash-out, the synthetic peptide purity that obtains is up to 98%, and HPLC schemes as Fig. 8; Its MALDI-TOF and EPI mass spectroscopy figure see Fig. 9.
The anti-microbial effect of antibacterial peptide be by itself with the attraction of negative charge of positive charge and bacterium surface be in contact with one another, form by hydrophobic amino acid then and stride the film ionic channel, cause the entocyte loss, thereby cause necrocytosis.Antibacterial peptide temporin-1CEa of the present invention belongs to cationic antibacterial peptide, contain basic aminoacids and partially hydrophobic amino acid, formed hydrophobic square on the amphipathic side that makes spiral, and with the electric charge dipole of alpha-helix in N end and the formation of C end, the antibacterial peptide activity is played a crucial role, therefore have broad spectrum antibiotic activity.
Antibacterial peptide temporin-1CEa of the present invention adopts 96 well plate method and M TT colorimetry to carry out antibiotic, anticancer experiment and hemolytic test research.Experimental result shows that temporin-1CEa is good to the anti-microbial activity of three kinds of gram positive bacteriums, and antitumour activity is the highest, IC
50The drug level of value during well below mammalian erythropoietin generation hemolytic action, this explanation is under the situation of not destroying the mammalian cell integrity, it can suppress the growth of part gram-positive microorganism, and can effectively suppress mammary cancer and cervical cancer cell growth, demonstrate application prospect as new antibiotic and antitumor drug.
Description of drawings
The agarose gel electrophoresis figure of Fig. 1 Rana temporaria chensinensis David skin antibacterial peptide gene preprotemporin-1CEa;
6 series connection Rana temporaria chensinensis David peptide temporin-1CEa gene T6AMP of Fig. 2 synthetic;
Fig. 3 expression vector pET42a PshAI/Hind III enzyme is cut back 3% agarose gel electrophoresis figure
M1：λHind?III?DNA?Marker；1：pET42a-PshAI/Hind?III；
Fig. 4 plasmid CAG556-5 is 3% agarose gel electrophoresis figure after Sma I/Hind III enzyme is cut
M1：λHind?III?DNA?Marker；2：CAG556-5-Sma?I/Hind?III；M2：DNA?Marker?DL2000；
Fig. 5 goal gene T6AMP and expression vector pET42a connection diagram;
3% agarose gel electrophoresis figure of Fig. 6 positive colony CTB651-6 amplified production
M:DNA Marker DL2000; The 1-3PCR product;
Fig. 7 gene expression product protein SDS-PAGE figure
M: protein standard; 1-3: carrier pET42a whole-cell protein, soluble protein and inclusion body part; 3-6: recombinant vectors pET42a-T6AMP whole-cell protein, soluble protein and inclusion body part;
Fig. 8 antibacterial peptide temporin-1CEa solid state chemistry synthetic HPLC figure;
Fig. 9 antibacterial peptide temporin-1CEa solid state chemistry synthetic MS figure;
The 1% agarose gel electrophoresis figure of the total RNA of Figure 10 Rana temporaria chensinensis David skin
M:DNA Marker DL2,0001: the total RNA of Rana temporaria chensinensis David skin.
Embodiment
Following examples is further explained content of the present invention, but not in order to restriction the present invention.
The clone of antibacterial peptide temporin-1CEa gene preprotemporin-1CEa
1, primer design
Aminoacid sequence according to batrachia skin antibacterial peptide gene precursor signal peptide N-end among the GenBank, designed and synthesized 3 ' RACE gene-specific primer GSP1:5 '-ATGTTCACCTTGAAGAAATCCCTG-3 ', 3 ' RACE Outer Primer:TACCGTCGTTCCACTAGTGATTT, 3 ' RACE Inner Primer:CGCGGATCCTCCACTAGTGATTTCACTATAGG, primer is synthetic by Japanese TaKaRa Dalian company.
2, the cDNA of antibacterial peptide gene clone
(1) from Chinese Rana sylvatica Le conte skin skin, extracts total RNA: get the Rana temporaria chensinensis David skin of back, freeze-drying in liquid nitrogen.Take by weighing 300mg freeze-drying skin, add RNAiso solution 10mL, 0 ℃ of homogenate 30 minutes; Add isopyknic phenol/chloroformic solution in the homogenate, about 10 minutes of concuss, centrifugal (12000rpm, 4 ℃) 10 minutes remove protein precipitation; Get supernatant liquor and add isopyknic Virahol, room temperature was placed 10 minutes, and centrifugal (12000rpm, 4 ℃) 10 minutes, precipitation is cleaned 1-2 time with 75% ethanol, dries up, and obtains the total RNA of Rana temporaria chensinensis David skin.The total RNA of 10 μ g Rana temporaria chensinensis David skins is dissolved in the 10 μ LDEPC water, 1% agarose gel electrophoresis, as seen 18S and 28S two bands clearly, ratio shows that greater than 1 (see figure 10) total RNA integrity is good.
(2) RT-PCR and 3 ' RACE: get the total RNA of the above-mentioned Rana temporaria chensinensis David skin of 1 μ g, employing TaKaRa company 3 '-the synthetic cDNA of Full RACE Core Set Ver.2.0 test kit.At first carry out the synthetic cDNA of reverse transcription reaction according to following reaction system:
The total RNA 1 μ g of Rana temporaria chensinensis David skin
3’RACE?Adaptor(5μlM) 1μl
5×M-MLV?Buffer 2μl
dNTP?Mixture(10mM?each) 1μl
RNase?Lnhibitor(40U/1) 0.25μl
Reverse?Transcriptase?M-MLV(Rnase?H
-)(200U/μl) 0.25μl
RNase?Free?dH
2O 4.5μl
Total 10μl
42 ℃ of reactions are after 60 minutes, and 70 ℃ of reaction of degeneration 15 minutes obtain cDNA solution.CDNA with acquisition is a template, carries out the sleeve type PCR reaction.At first carry out outer PCR reaction, carry out according to following reaction system:
Above-mentioned inverse transcription reaction liquid 2 μ l
1×cDNA?Dilution?Buffer?II 8μl
Gene?Specific?Outer?Primer(10μM) 2μl
3’RACE?Outer?Primer(10μM) 2μl
10×LA?PCR?Buffer?II(Mg
2+Free) 4μl
Mgcl
2(25mM) 3μl
TaKaRa?LA?Taq(5U/μl)
*1 0.25μl
dH
2O 28.75μl
Total 50μl
The PCR program is as follows: 94 ℃ of 3min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, totally 30 circulations, 72 ℃ prolong 10min.Reaction is carried out irnner PCR after finishing, and carries out according to following reaction system:
dNTP?Mixture(2.5mM?each) 8μl
10×LA?PCR?Buffer?II(Mg
2+Free) 5μl
Mgcl
2(25mM) 5μl
TaKaRa?LA?Taq(5U/μl) 0.5μl
Gene?Specific?Lnner?Primer(10μM) 2μl
3’RACE?Lnner?Primer(10μM) 2μl
dH
2O 26.5μl
Total 50μl
The PCR program is as follows: 94 ℃ of 3min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, totally 30 circulations, 72 ℃ prolong 10min.Get 10 μ l PCR products and separate and recovery purpose fragment through 3% agarose gel electrophoresis, reclaim product and be connected with the pMD19-T carrier, thermal transition is to competent cell JM109,37 ℃ of incubated overnight, select positive bacterium colony and plant bacterium, extract plasmid DNA, carry out dna sequencing.
3, the sequential analysis of antibacterial peptide gene
Get wherein cDNA clone use BcaBEST Primer RV-M order-checking, obtain the complete nucleotide sequence of Rana temporaria chensinensis David skin antibacterial peptide temporin-1CEa gene preprotemporin-1CEa.The sequence of BcaBEST Primer RV-M is GAGCG GATAA CAATT TCACA CAGG.The sequencing result of gene such as sequence table.
The engineered preparation of antibacterial peptide temporin-1CEa
One, synthetic gene
1, the making of dna fragmentation
The dna fragmentation of aim sequence is (a molecular weight: 51bp): 5 '-TTTGTAGATTTGAAAAAGATTGCAAATATTATCAATTCTATATTTGGAAAA-3 '.Add 1 methionine(Met) codon ATG at aim sequence 5 ' end, be the dna fragmentation of 54bp.Be connected in series after 6 times, add terminator codon TAA at 3 ' end, at last 5 ' and 3 ' hold to add two restriction enzyme site: SmaI/HindIII, total length 339bp respectively.Synthetic 339bp strand small pieces segment DNA by PCR method, is spliced into a complete double chain DNA fragment to strand small pieces segment DNA again, is called the T6AMP gene, sees Fig. 2.The PCR program is as follows: 94 ℃ of 3min, and 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1min, totally 30 circulations, 72 ℃ prolong 10min.
2, connection and conversion
In little centrifuge tube, add 2 μ l T6AMP DNA (about 200ng), 1 μ l carrier DNA (pSIMPLE-19EcoR V/BAP) (about 50ng) and H
2O2 μ l, 16 ℃ are incubated 30 minutes, connect the liquid full dose and are converted into E.coli JM109 competent cell.
3, the extraction of positive colony detection and plasmid DNA
Bacterium colony on the flat board is carried out PCR with the M13-47/RV-M primer, and the PCR program is the same; Detect and insert segmental length scale in the contained plasmid, contain the insertion fragment of purpose length in the CAG556-5 bacterium colony.Extract the CAG556-5 plasmid DNA, carry out determined dna sequence.Use instrument to be the full-automatic nucleotide sequencing instrument of Applied Biosystems373A, sequencing primer is BcaBEST Primer RV-M (GAG CGG ATAACA ATT TCA CAC AGG), BcaBEST Primer M13-47 (CGC CAG GGT TTT CCCAGT CAC GAC), BcaBEST Primer pMD18F (GCC TCT TCG CTA TTA CGCCA).Insertion fragment in the sequencing result CAG556-5 plasmid is entirely true.
Two, goal gene subclone
Use the CAG556-5 plasmid, utilize Sma I/Hind III with the target gene fragment subclone to pET42a-PshAI/Hind III expression vector, and sequence verification.
Use PshAI/Hind III that the pET-42a plasmid enzyme that spends the night is cut, get 5 μ l and carry out the agarose gel electrophoresis separation, use TaKaRa Agarose Gel DNA Purification Kit Ver.2.0 (Code No.DV805A) to cut glue and reclaim purpose fragment, called after CTB65l carrier.Using Sma I/Hind III that the CAG556-5 plasmid is carried out enzyme cuts, get 5 μ l and carry out agarose gel electrophoresis, after using TaKaRa Agarose Gel DNA PurificationKit Ver.2.0 (Code No.DV805A) to cut the about 340bp fragment of glue recovery, called after CTB651 inserts fragment.Use the Solution I among the TaKaRa DNA Ligation Kit (Code No.D6022), to insert sheet segment DNA and carrier DNA carry out 16 ℃ be connected after, to connect product called after CTB651, thermal transition is to E.coli competent cell JM109 (Code No.D9052), spread plate, the incubated overnight thalline.
From transforming the dull and stereotyped picking list bacterium colony of going up, be that primer carries out pcr amplification with T7/T7t, to get 5 μ l pcr amplification products and carry out agarose gel electrophoresis, detected result shows and has positive colony.
After the CTB651-6 thalline planted bacterium and extract plasmid, check order with the T7t primer, order-checking is correct.Detect and sequencing primer sequence: T7:5 '-TAATACGACTCACTATAGGG-3 ' (20nt)
T7t：5’-GCTAGTTATTGCTCAGCGG-3’(19nt)
Three, CTB651-6 genetic expression
1, transformant is cultivated
The single bacterium colony of picking CTB651-6 contains in the LB substratum of 50mg/ml kantlex 37 ℃ of incubated overnight to 2ml.Get and cultivate the LB substratum that bacterium liquid 100 μ l adding 5ml contains the 50mg/ml kantlex, 37 ℃ are cultured to OD
600The nm value is about 0.55-0.7.It is 1mM that interpolation 100mM IPTG 50 μ l make its final concentration, induces 3hr, OD for 37 ℃
600The nm light absorption value is 0.988.
2, protein extracting
4 ℃ 6 of nutrient solution, the centrifugal 10min of 500rpm, results precipitation thalline.Thalline adds the PBS damping fluid and reaches 10OD/ml, and mixing is got 200 μ l and carried out ultrasonic 2-3 time, and each 10 seconds, until liquid-transparent.Get 50 μ l as full cell sample.Remainder 20,000 * g (about 14,000rpm) 4 ℃ centrifugal 5 minutes, supernatant (solubility) liquid and precipitation, precipitation adds 150 μ l PBS damping fluid mixings.Get each extract (whole protein, supernatant, precipitation) 10 μ l, add 2.5 μ l, 5 * SDS sample-loading buffer, 95 ℃ were heated 10 minutes, and last sample carries out the SDS-PAGE electrophoresis.Deposition condition: (c.c.) 20mA/ piece, about 90 minutes; 12% polyacrylamide; 10 μ l/well.The result shows that the CTB651-6 gene can express under the standard expression condition, and soluble-expression is arranged, and its molecular weight conforms to the theoretical value 43kD of prediction.
Four, recombinant protein purification
GST-tag affinity column purification of recombinant proteins with GE company.Concrete operation method is as follows: the 24ml that obtains is gone up white protein membrane filtration with 0.45 μ m before crossing post.With balance liquid (1 * PBS) balance, flow velocity 1-2ml/min (1ml column).Drawing sample liquid 20ml (about 4mg) with syringe is added in the pillar, for obtaining best effect, use low flow velocity 0.2-1ml/min (1ml column), with 5 times of column volume balance liquid wash-outs 2 times, flow velocity 1-2ml/min (1ml column) closes at every turn and collects 1ml balance liquid survey OD280 value when finishing.With 10 times of column volume elutriants (pH 8.0 for 50mM Tris-HCl, 10mM reduced form glutathione) wash-out pillar, and collect effluent liquid, obtain the GST-T6AMP fusion rotein.Flow velocity 1-2ml/min (1ml column).Get 20mLGST-T6AMP fusion rotein solution (protein content 4mg), add 1mL Xa factor mixed solution (40 μ l Xa factors add 960 μ lXa factors fracture damping fluid), react 16h under the room temperature.GST-tag affinity column purification reaction liquid with GE company.Concrete operation method such as top identical: be added to balance liquid (pillar that 1 * PBS) balance cross in syringe the reaction solution that obtains, with 5 times of column volume balance liquid wash-outs 2 times, flow velocity 1-2ml/min (1ml column), use 10 times of column volume elutriant (50mM Tris-HCl then, 10mM reduced form glutathione, pH 8.0) the wash-out pillar, and collect effluent liquid, obtain the T6AMP antimicrobial peptide protein.Add CNBr solution in T6AMP antimicrobial peptide protein solution, effect is 2 hours under the room temperature, obtains the temporin-1CEa mixing solutions, after the lyophilize, obtains temporin-1CEa antibacterial peptide powder.
The solid phase synthesis of Rana temporaria chensinensis David antibacterial peptide temporin-1CEa
According to the synthetic peptide of standard Fmoc solid-phase peptide synthesis program synthetic Rana temporaria chensinensis David antibacterial peptide: temporin-1CEa (PheValAspLeuLysLysIleAlaAsnIleIleAsnSerIlePhe-AMIDATION) through the reversed-phase HPLC (purifying of Vydac 218TP1022 post 2.2cm * 25cm), adopt acetonitrile/water/trifluoroacetic acid system wash-out, MALDI-TOF and EPI mass spectroscopy.Antibacterial peptide is synthetic, and (SBS GenetechCo., Ltd.Bejing China) finishes by match Parkson, Beijing company.
The pharmacologically active of antibacterial peptide
1, the mensuration of anti-microbial activity
According to people's methods such as Conlon (Conlon JM, et al.Protein and Peptide Letters, 2006,13 (4): 411-415.), the antibacterial peptide solution 50 μ L that in 96 orifice plates, add different concns (1.0 to-100 μ mol/L) respectively, in each hole, add respectively again be in the growth logarithmic phase 4 kinds of bacterium Escherichiacoli, Staphylococcus aureus, Bacillus cereus, each 50 μ L of Streptococcus agalactiae bacterium liquid, final bacterium amount is every hole 5 * 10
5CFU/mL.Add 10 μ L, 0.5% TTC solution at last in every hole, vibration 1min makes its mixing, puts into 37 ℃ of incubators after adding a cover and hatches 24h, observes colour-change, reads each minimum inhibitory concentration value (MICs).Have bacteria growing then to take on a red color in the hole, asepsis growth is no colour-change in the hole then.MICs is defined as the minimum concentration of the antibacterial peptide of asepsis growth.Liquid nutrient medium is as negative control, and gentamicin is as positive control.
The minimal inhibitory concentration of table 1 Rana temporaria chensinensis David skin antibacterial peptide temporin-1CEa
Temporin-1CEa only has restraining effect to gram-positive microorganism, and stronger to staphylococcus aureus, bacillus cereus and streptococcus uberis restraining effect, the MIC value is 14.4 μ mol/L;
2, the mensuration of antitumour activity
Adopt MTT colorimetry (Sargent JM.Recent Results in Cancer Research, 2003,161:13.), in 96 orifice plates, add MCF-7 and the HeLa cell suspension 200 μ L that are in logarithmic phase respectively, cultivate the antibacterial peptide solution that adds 5 kinds of different concns of 4 μ L (1.0-200 μ mol/L) behind the 24h for 37 ℃, continue to cultivate 20,44, add the MTT solution of 20 μ L 5mg/mL behind the 68h, hatch and stopped in 4 hours cultivating, supernatant discarded adds 150 μ L DMSO vibration 10min.Measure the light absorption value in each hole, calculation of half inhibitory concentration (IC with immune microplate reader (wavelength 570nm)
50) value.IC
50Be defined as: the antibacterial peptide concentration of tumour cell semilethal rate.The nutrient solution group is as negative control, and the mitomycin group is as positive control.The results are shown in Table 2.
3, the mensuration of antibacterial peptide hemolytic
Mouse red blood cell is made into 2% suspension with 0.9% sodium chloride solution, gets the antibacterial peptide solution (final concentration is 1.0-500 μ mol/L) that the 1mL red blood cell suspension adds 7 kinds of different concns respectively, gently mix incubation in rearmounted 37 ℃ the thermostat container.Centrifugal behind the 3h, get supernatant, survey the 545nm light absorption value, calculate hemolysis rate and LD
50Value.Hemolysis rate (%)=(developmental tube absorbancy-negative control pipe absorbancy)/(positive control pipe absorbancy-negative control pipe absorbancy) * 100%.0.9% physiological saline is as negative control, and distilled water is as positive control.LD
50Value reaches the concentration of 50% o'clock antibacterial peptide solution for hemolysis rate.The results are shown in Table 2.
Antitumour activity and the hemolytic activity of table 2 Rana temporaria chensinensis David skin antibacterial peptide temporin-1CEa
As shown in Table 2: temporin-1CEa all has in various degree restraining effect to MCF-7 and HeLa cell.At LD
50In the value scope, temporin-1CEa all has the obvious suppression effect to two kinds of cancer cells, the IC of effect MCF-7 cell
50Value only is 8 μ mol/L, and restraining effect far is better than the HeLa cell, can not produce hemolytic action to mammiferous red corpuscle.
Sequence table
SEQUENCE?LISTING
＜110〉Liaoning Normal University
＜120〉a kind of new antibacterial peptide and its production and application
<130>
<160>2
<210>1
<211>315
<212>DNA
＜213〉Rana temporaria chensinensis David (Rana chensinensis)
<400>1
<210>2
<211>15
<212>PRT
＜213〉Rana temporaria chensinensis David (Rana chensinensis)
<220>
<221>AMIDATION
<222>(15)
<400>2
Claims (5)
1, a kind of antibacterial peptide temporin-1CEa of Rana temporaria chensinensis David genes encoding is characterized in that: the total order of polypeptide is classified Phe Val Asp Leu Lys Lys Ile Ala Asn Ile Ile Asn Ser Ile Phe-AMIDATION, molecular weight 1733 dalton as.
2, Rana temporaria chensinensis David antibacterial peptide temporin-1CEa gene nucleotide series is characterized in that: the sequence total length 315bp of cDNA, it sees sequence table from 5 ' end to the sequence of 3 ' end.
3, Rana temporaria chensinensis David antibacterial peptide temporin-1CEa gene nucleotide series as claimed in claim 2, it is characterized in that: the ripe antibacterial peptide of coding Rana temporaria chensinensis David is a 144-192 position Nucleotide, and its nucleotides sequence is classified TTTGTAGATTTGAAAAAGATTGCAAATATTATCAATTCTATATTTGGAAAA as.
4, the gene engineering preparation method of the described antibacterial peptide temporin-1CEa of a kind of claim 1 is as follows:
(1) synthetic T6AMP gene: the 144-192 position Nucleotide in the gene of the described antibacterial peptide of the claim 1 of will encoding carries out synthetic, add 1 methionine(Met) codon ATG at sequence 5 ' end, be connected in series after 6 sections, add terminator codon TAA at 3 ' end, add two restriction enzyme site: SmaI/HindIII respectively at 5 ' and 3 ' end at last, and the dna fragmentation of this 339bp is spliced into double-stranded DNA, be the T6AMP gene;
(2) preparation of genetic engineering bacterium: utilize Sma I/Hind III with T6AMP gene fragment subclone to pET42a-PshAI/Hind III expression vector, and be converted among the E.coli BL21 (DE3) genetic engineering bacterium of the Rana temporaria chensinensis David antibacterial peptide temporin-1CEa that obtains efficiently expressing;
(3) target protein purifying:, obtain the temporin-1CEa antibacterial peptide with GST-tag affinity column purification of recombinant proteins.
5, the application of the described antibacterial peptide temporin-1CEa of claim 1 in preparing antibiotic and cancer therapy drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102294860A CN101418039B (en) | 2008-12-10 | 2008-12-10 | Novel antibacterial peptide and preparation method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102294860A CN101418039B (en) | 2008-12-10 | 2008-12-10 | Novel antibacterial peptide and preparation method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101418039A true CN101418039A (en) | 2009-04-29 |
| CN101418039B CN101418039B (en) | 2011-12-07 |
Family
ID=40629054
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102294860A Expired - Fee Related CN101418039B (en) | 2008-12-10 | 2008-12-10 | Novel antibacterial peptide and preparation method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101418039B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101856323A (en) * | 2010-06-11 | 2010-10-13 | 吉林大学 | Beta-CD inclusion suppository containing rana chensinensis antibacterial peptide and preparation method thereof |
| CN101648990B (en) * | 2009-09-17 | 2011-08-10 | 山东大学 | Small peptide D with antibacterial and antitumor functions and applications thereof |
| CN102952820A (en) * | 2011-08-30 | 2013-03-06 | 青岛根源生物技术集团有限公司 | Production method of genetic engineering hybrid antimicrobial peptide CecA-Temporin-SHF |
| CN104109198A (en) * | 2014-07-17 | 2014-10-22 | 中国人民解放军军事医学科学院野战输血研究所 | Derived polypeptides formed by modifying structures of frog skin antibacterial peptides AR-23 and application of derived polypeptides |
| CN106798613A (en) * | 2017-03-12 | 2017-06-06 | 南昌青囊中医药有限责任公司 | A kind of baby's diaper with antibacterial, moisture-proof role |
| CN112457378A (en) * | 2020-12-25 | 2021-03-09 | 辽宁师范大学 | Temporin-1CEc modified peptides with broad-spectrum antibacterial activity and low hemolysis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1064050C (en) * | 1998-10-29 | 2001-04-04 | 吉林大学 | Biologic antibiotic peptide, and method for preparing same |
-
2008
- 2008-12-10 CN CN2008102294860A patent/CN101418039B/en not_active Expired - Fee Related
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101648990B (en) * | 2009-09-17 | 2011-08-10 | 山东大学 | Small peptide D with antibacterial and antitumor functions and applications thereof |
| CN101856323A (en) * | 2010-06-11 | 2010-10-13 | 吉林大学 | Beta-CD inclusion suppository containing rana chensinensis antibacterial peptide and preparation method thereof |
| CN102952820A (en) * | 2011-08-30 | 2013-03-06 | 青岛根源生物技术集团有限公司 | Production method of genetic engineering hybrid antimicrobial peptide CecA-Temporin-SHF |
| CN104109198A (en) * | 2014-07-17 | 2014-10-22 | 中国人民解放军军事医学科学院野战输血研究所 | Derived polypeptides formed by modifying structures of frog skin antibacterial peptides AR-23 and application of derived polypeptides |
| CN106798613A (en) * | 2017-03-12 | 2017-06-06 | 南昌青囊中医药有限责任公司 | A kind of baby's diaper with antibacterial, moisture-proof role |
| CN112457378A (en) * | 2020-12-25 | 2021-03-09 | 辽宁师范大学 | Temporin-1CEc modified peptides with broad-spectrum antibacterial activity and low hemolysis |
| CN112457378B (en) * | 2020-12-25 | 2022-06-10 | 辽宁师范大学 | Temporin-1CEc modified peptides with broad-spectrum antibacterial activity and low hemolysis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101418039B (en) | 2011-12-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101418039B (en) | Novel antibacterial peptide and preparation method and use thereof | |
| CN109593127B (en) | Gene recombinant collagen peptide MJ L GG-34 and preparation method and application thereof | |
| CN106282216B (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN101698682B (en) | Double-functional fusion protein based on antibacterial peptide, preparation method and applicaitoin thereof | |
| CN109576275A (en) | A kind of Cynoglossus semilaevis antibacterium disease related gene and its application method | |
| Vaseeharan et al. | Molecular cloning, sequence analysis and expression of Fein-Penaeidin from the haemocytes of Indian white shrimp Fenneropenaeus indicus | |
| CN110551732A (en) | Trachinotus ovatus antimicrobial peptide LEAP-2 gene and application thereof | |
| CN101003788A (en) | Anti tumor translocation peptide of scorpion, preparation method and application | |
| CN111499759A (en) | Zinc finger protein-lactoferrin fusion protein with cell membrane penetrating property and preparation and application thereof | |
| CN102875659A (en) | Antibacterial peptide secreted by skins of northeast forest frog, and coding sequence and application thereof | |
| CN102094024A (en) | Plutella xylostella cecropin gene, encoded protein, corresponding expression system and application | |
| Xu et al. | Molecular characteristics of hemoglobins in blood clam and their immune responses to bacterial infection | |
| CN114752610B (en) | Application of diaphorina citri ubiquitin conjugated enzyme E2J2 gene in prevention and control of citrus yellow dragon disease | |
| CN106479987B (en) | Preparation method and application of soluble housefly MdpropO1 recombinant protein | |
| Pang et al. | Identification and functional characterization of interferon-γ-inducible lysosomal thiol reductase (GILT) gene in common Chinese cuttlefish Sepiella japonica | |
| CN102094023A (en) | Plutella xylostella gloverin gene and encoded protein, corresponding expression system and application | |
| Shen et al. | Triintsin, a human pathogenic fungus-derived defensin with broad-spectrum antimicrobial activity | |
| CN105255932B (en) | A kind of conotoxin variant GMVIIA and its preparation method and application | |
| WO2005034863A2 (en) | Countermeasures against malaria | |
| CN102516394A (en) | CMG 2mutant and Fc fusion protein, its encoding gene and its application | |
| CN106636175A (en) | Induced expression method of cell injury repair protein in pichia pastoris and purification method and application of cell injury repair protein | |
| CN102993309A (en) | Human auxin fusion protein TAT-hGH as well as preparation method and application thereof | |
| CN103467580B (en) | Preparation method and application of artificial antimicrobial peptide MA-D4 | |
| CN107513107A (en) | Antineoplastic amalgamation protein and its preparation method and application | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111207 Termination date: 20141210 |
|
| EXPY | Termination of patent right or utility model |