CN104530236B - A kind of full people source HER2 antibody, its encoding gene and application - Google Patents

Abstract

The present invention relates to medicinal chemistry art, and in particular to two kinds of full people source HER2 antibody, its encoding gene and application.The invention provides two kinds of full people source HER2 antibody, the amino acid sequence of the weight chain variable district of one of which HER2 antibody is SEQ ID NO:1, the amino acid sequence of light chain variable district is SEQ ID NO:2, the amino acid sequence of the weight chain variable district of another HER2 antibody is SEQ ID NO:10, the amino acid sequence of light chain variable district is SEQ ID NO:11.Full people source HER2 antibody can reduce infusion reaction and immunogenicity, improve drug safety, have more preferable pharmacokinetic characteristic.In addition, the human antibody of the present invention can be used to treat HER2 positive tumors with other HER2 positive tumors therapeutic agents.

Description

A kind of full people source HER2 antibody, its encoding gene and application

Technical field

The present invention relates to antibody technique field, and in particular to a kind of full people source HER2 antibody, its encoding gene and application.

Background technology

Breast cancer is the most common malignant tumour of global women.HER families adjust the growth and development of normal breast, HER2 Overexpression with it is breast cancer related.Herceptin (Trastuzumab), trade name Trastuzumab (Trastuzumab), it is first For the monoclonal antibody drug for the humanization for treating human epidermal growth factor receptor 2 (HER2) positive metastatic breast cancer.Though So in the positive malignant tumours of HER2, Trastuzumab has turned into the therapeutic scheme of standard, but still has 40% patient to He Sai Spit of fland does not respond to.In addition, in anti-HER2 treatment method, drug resistance turns into a common serious problems.Growth factor Redundancy and intracellular signal transduction path between crosstalk be considered as in patient with breast cancer promote drug resistance main original Cause.Handkerchief trastuzumab (Pertuzumab) is that Genentech companies of the U.S. develop jointly develop recently one with Roche Holding Ag The new anti-HER 2 humanized antibody of kind, different from Trastuzumab, its targeted epitope is located at the extracellular II of HER2 acceptors Area, but clinical and experimental study result shows that the appropriate pearl of pa, which is used alone, only produces weaker antineoplastic treatment function.Although treatment Metastatic breast cancer positive HER2, it is available in spite of kinds of schemes, but still there is no meet demand.Treat this disease The prioritization scheme of disease persistently occurs, but the situation of recurrence occur in most of metastatic breast cancer patients.

The content of the invention

The invention provides a kind of HER2 antibody in full people source, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:1, the amino acid sequence of light chain variable district is SEQ ID NO:2.

Present invention also offers a kind of HER2 antibody in full people source, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:10, the amino acid sequence of light chain variable district is SEQ ID NO:11.

The present invention full people source HER2 antibody, it is Fab, Fab ', F (ab ')₂, Fv or scFv form.The Fab, Fab’、F(ab’)₂, Fv or scFv there is the implication that this area usually understands.

The full people source HER2 antibody of above two of the present invention, the heavy chain constant region and chain constant of human IgG can also be included Area.In a specific embodiment, the human IgG is IgG1.In a specific embodiment, the human IgG weight The amino acid sequence of chain constant region is SEQ ID NO:5, the amino acid sequence of the human IgG constant region of light chain is SEQ ID NO: 6。

The invention provides the nucleotide sequence of the full people source HER2 antibody of the coding present invention.

In a specific embodiment, encoding amino acid sequence is SEQ ID NO:The nucleosides of 1 weight chain variable district Acid sequence is SEQ ID NO:3, encoding amino acid sequence is SEQ ID NO:The nucleotides sequence of 2 light chain variable district is classified as SEQ ID NO:4。

In a specific embodiment, encoding amino acid sequence is SEQ ID NO:The nucleosides of 10 weight chain variable district Acid sequence is SEQ ID NO:12, encoding amino acid sequence is SEQ ID NO:The nucleotides sequence of 11 light chain variable district is classified as SEQ ID NO:13。

In a specific embodiment, when two kinds of full people source HER2 antibody of the present invention are full length antibody, at this In the nucleotide sequence of invention, the nucleotides sequence of encoding heavy chain constant is classified as SEQ ID NO:7, encode the core of constant region of light chain Nucleotide sequence is SEQ ID NO:8.

The invention provides a kind of expression vector, wherein the expression control sequence of the nucleotide sequence of the present invention and expression vector Row are operably connected.In specific embodiments, the expression vector is pGEM-T carriers or 293 carriers.

The invention provides a kind of cell, and it includes the expression vector of the present invention.The cell can be protokaryon or eucaryon 's.In specific embodiments, the cell can be with mammalian cell, such as FreeStyle 293F cells.

The invention provides a kind of pharmaceutical composition, and it includes full the people source HER2 antibody and pharmaceutical acceptable carrier of the present invention.

The invention provides a kind of combination medicine, and it includes the full people source HER2 antibody of the present invention and other HER2 are positive swollen Knurl therapeutic agent, the HER2 positive tumors therapeutic agent are Trastuzumab and/or the appropriate pearl of pa.Wherein, the combination medicine can be with such as Under amount be applied to subject：The full people source HER2 antibody+0.001-500mg/kg Trastuzumabs of 0.001-500mg/kg and/or pa are appropriate Pearl；The full people source HER2 antibody+0.001-300mg/kg Trastuzumabs of 0.001-300mg/kg and/or the appropriate pearl of pa；0.001-200mg/ The full people source HER2 antibody+0.001-200mg/kg Trastuzumabs of kg and/or the appropriate pearl of pa；The full people source HER2 antibody of 0.01-200mg/kg+ 0.01-200mg/kg Trastuzumabs and/or the appropriate pearl of pa；The full people source HER2 antibody+0.01-100mg/kg He Sai of 0.01-100mg/kg Spit of fland and/or the appropriate pearl of pa；The full people source HER2 antibody+0.1-90mg/kg Trastuzumabs of 0.1-90mg/kg and/or the appropriate pearl of pa；0.1- The full people source HER2 antibody+0.1-70mg/kg Trastuzumabs of 70mg/kg and/or the appropriate pearl of pa；The full people source HER2 antibody of 0.1-60mg/kg+ 0.1-60mg/kg Trastuzumabs and/or the appropriate pearl of pa；The full people source HER2 antibody+0.1-50mg/kg Trastuzumabs of 0.1-50mg/kg and/or The appropriate pearl of pa；The full people source HER2 antibody+0.1-40mg/kg Trastuzumabs of 0.1-40mg/kg and/or the appropriate pearl of pa；The full people sources of 1-40mg/kg HER2 antibody+1-40mg/kg Trastuzumabs and/or the appropriate pearl of pa.The full people source HER2 antibody of the present invention is positive with other described HER2 Tumor therapeutic agent can separately or simultaneously give subject.Method of administration can be route of antibody administration commonly used in the art.

The invention provides a kind of kit, and it includes the full people source HER2 antibody of the present invention.The kit can be used for Detect the HER2 albumen in sample.The kit can also include other usual components in this area detection HER2 kits.

It is used to prepare the HER2 positives being used to treat in subject the invention provides the full people source HER2 antibody of the present invention The purposes of the medicine of tumour.

" the HER2 positive tumors " refers to if IHC (Immunohistochemical Method) inspection result is 3 plus siges (+++), i.e. big Complete strong coloring is presented in the after birth of 30% tumour cell, indicates that as the HER2 positives；If 2 plus siges (++), i.e. At least 10% tumour cell presents weak to the complete after birth dyeing of moderate, then is further FISH (fluorescence in situ hybridization) Or CISH (colour developing hybridization in situ) is checked, if result is positive (producer amplification), it is possible to be diagnosed as the HER2 positives. Preferably, HER2 positive tumors testing result is the detection kit using the certification of food and medicine supervision and management general bureau of China The result that (IHC, FISH and CISH detection kit) obtains.How medical practitioner is known judges whether tumour is HER2 positive swollen Knurl.

The tumour positive HER2 can be selected from the positive breast cancer of HER2, stomach cancer, lung cancer, non-small cell lung cancer, bone Cancer, cancer of pancreas, cutaneum carcinoma, head or neck cancer, skin or intraocular melanoma, uterine cancer, oophoroma, the carcinoma of the rectum, anal region cancer, colon It is cancer, uterine cancer, carcinoma of fallopian tube, carcinoma of endometrium, cervical carcinoma, carcinoma of vagina, carcinoma of vulva, Hodgkin's disease, cancer of the esophagus, carcinoma of small intestine, interior Excretory system cancer, thyroid cancer, parathyroid carcinoma, adrenal, soft tissue cancer, carcinoma of urethra, carcinoma of penis, prostate cancer, bladder Cancer, kidney or carcinoma of urethra, clear-cell carcinoma, carcinoma of renal pelvis, celiothelioma, hepatocellular carcinoma, gallbladder cancer, chronic or acute leukemia, lymph are thin Born of the same parents' lymthoma, central nervous system (CNS) cancer, tumor of spine, brain stem glioma, glioblastoma multiforme (glioblastoma multiforme), astrocytoma, neurinoma, ependymoma, medulloblastoma, meningioma, Squamous cytoma and pituitary adenoma.

Preferably, the subject is people.

Brief description of the drawings

Figure 1A shows the anti-human HER2 antibody GB235-019 and GB235-042 heavy chain expression vectors (293- of recombinant full-lenght VH-CH structural representation)；Figure 1B shows anti-human HER2 antibody GB235-019 and the GB235-042 light chain expression of recombinant full-lenght The structural representation of carrier (293-VL-CL).With PCR method, obtained respectively using corresponding template and primer (detailed in Example 5) Signal peptide, weight chain variable district (VH) containing 5 ' end EcoRI restriction enzyme sites, terminator codon containing TGA and 3 ' end BamH I digestions positions Point heavy chain constant region (CH) genetic fragment, and with over-lapping PCR methods by three sections connection, obtain GB235-019 and The heavy chain full-length gene fragment of GB235-042 antibody.GB235-019 and GB235-042 antibody is obtained in the same way contains signal The light chain full-length gene fragment of peptide, light chain variable district (VL) and constant region of light chain (CL).Utilize EcoR I and BamH I digestion shapes Into cohesive end heavy chain and light chain full-length gene fragment are cloned into pGEM-T carriers respectively.

Fig. 2A and Fig. 2 B show the anti-human HER2 antibody GB235-019 and GB235-042 of recombinant full-lenght SDS-PAGE electricity Swimming result figure.Obtained GB235-019 and GB235-042 antibody and Trastuzumab control sample will be purified in 50mM dithiothreitol (DTT)s Parsed under reducing condition through 10% polyacrylamide gel electrophoresis, as a result show GB235-019 and GB235-042 antibody and He Sai The heavy chain and light chain of two bands, respectively antibody that molecular weight is 50KDa and 25KDa is presented in spit of fland.

Fig. 3 A show the combination knot of recombinant full-lenght anti-human HER2 antibody GB235-019, GB235-042 and people's HER2 antigens Fruit is schemed.With people's HER2 antigen coat elisa plates, with the GB235-019 of various concentrations, GB235-042 antibody and Trastuzumab and bag Combined in the antigen molecule on plate, and the antibody combined with the goat anti-human igg Fc TPPAs of HRP marks.As a result display with Trastuzumab is the same, GB235-019, and GB235-042 antibody can be combined in people HER2, and show concentration dependent and saturable Property.

Fig. 3 B show the combination knot of recombinant full-lenght anti-human HER2 antibody GB235-019, GB235-042 and monkey HER2 antigens Fruit is schemed.With monkey HER2 antigen coat elisa plates, with the GB235-019 of various concentrations, GB235-042 antibody and Trastuzumab and bag Combined in the antigen molecule on plate, and the antibody combined with the goat anti-human igg Fc TPPAs of HRP marks.As a result display with Trastuzumab is the same, GB235-019, and GB235-042 antibody can be combined in monkey HER2, and show concentration dependent and saturable Property.

Fig. 3 C show the combination of recombinant full-lenght anti-human HER2 antibody GB235-019, GB235-042 and mouse HER2 antigens Result figure.With mouse HER2 antigen coat elisa plates, with the GB235-019 of various concentrations, GB235-042 antibody and Trastuzumab Combined with the antigen molecule being coated on plate, and the antibody combined with the goat anti-human igg Fc TPPAs of HRP marks.As a result show Show, GB235-019, GB235-042 antibody can be combined in mouse HER2, and show concentration dependent and saturability.

Fig. 3 D show recombinant full-lenght anti-human HER2 antibody GB235-019, GB235-042 and people HER1, HER2, HER3, The combination result figure of HER4 antigens.With people's HER1, HER2, HER3, HER4 antigen coat elisa plate, with fixed concentration GB235-019, GB235-042 antibody and Trastuzumab are combined with the antigen molecule being coated on plate, and the goat-anti people marked with HRP The antibody that IgG Fc TPPAs combine.As a result show, GB235-019, GB235-042 antibody can combine people HER2, GB235- 019, GB235-042 antibody can not combine people's HER1, HER3, HER4 antigen.

Fig. 4 shows the anti-human HER2 antibody GB235-019 of recombinant full-lenght and GB235-042 and Trastuzumab epitope competition knot Fruit is schemed.With ELISA method, with recombined human HER2 antigen coat elisa plates, with the GB235-019 and GB235-042 of various concentrations After antibody and Trastuzumab are incubated at room temperature 2 hours jointly with the Trastuzumab (0.005 μ g/mL fixed concentrations) of biotin labeling respectively and The hardened conjunction of recombined human HER2 antigen coats, and the antibody combined is detected with the anti-biotin antibodies of HRP marks.As a result show, With the increase of Trastuzumab concentration, the combination of the Trastuzumab of biotin labeling on HER2 is suppressed；And GB235-019 and GB235- Even 042 antibody is in maximum concentration (the 10 μ g/mL) that experiment is related to, still to the Trastuzumab of biotin labeling on HER2 Acted on reference to unrestraint.

Fig. 5 shows the anti-human HER2 antibody GB235-019 of recombinant full-lenght and the appropriate pearl epitope competition of pa result figure.With ELISA method, with recombined human HER2 antigen coat elisa plates, with the appropriate pearl of GB235-019 antibody and pa of various concentrations respectively with Incubation at room temperature resists the GB235-019 antibody (0.1 μ g/ml fixed concentrations) of biotin labeling after 2 hours with recombined human HER2 jointly The hardened conjunction of primordial covering, and the antibody combined is detected with the anti-biotin antibodies of HRP marks.As a result show, resist with GB235-019 Bulk concentration increase, the combination of the GB235-019 antibody of biotin labeling on people HER2 are suppressed；And even the appropriate pearl of pa exists When testing maximum concentration (the 30 μ g/mL) being related to, still to the combination on people HER2 of the GB235-019 antibody of biotin labeling without Inhibitory action.

Fig. 6 shows the binding curve result of the anti-human HER2 antibody GB235-019 antibody of recombinant full-lenght and BT-474 cells Figure.By the BT-474 breast cancer cells of the high expression of HER2 in the U-shaped board of 96- holes respectively the GB235-019 antibody with various concentrations, Trastuzumab and the appropriate pearl of pa are incubated, and after abundant washing, add goat-anti people's Fc antibody tests of FITC marks, are examined with flow cytometer Survey the antibody combined.As a result show, GB235-019 antibody can be combined in expression HER2 cell as Trastuzumab, the appropriate pearl of pa Surface, and concentration dependent and saturability are showed, prompt GB235-019 antibody to have high selectivity to HER2.

Fig. 7 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses SK-BR-3 cell-proliferation activities Experimental result.By the SK-BR-3 breast cancer cells of the high expression of HER2 in complete medium the GB235- with various concentrations respectively 019 antibody and Trastuzumab use Alamar Blue measure cytoactives after being incubated 72 hours.As a result show, Trastuzumab is being trained completely SK-BR-3 cells propagation can be suppressed by supporting in base, and show concentration dependent.GB235-019 antibody in complete medium not SK-BR-3 cells propagation can be suppressed.

Fig. 7 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght reverses Heregulin α inductions SK- Experimental result of the BR-3 cells to Trastuzumab drug-resistant effect.The SK-BR-3 breast cancer cells of the high expression of HER2 are being cultivated completely Heregulin α are added in base, produce the drug-resistant effect to Trastuzumab.The GB235-019 antibody and Trastuzumab of various concentrations are independent Administration, or GB235-019 antibody and Trastuzumab administering drug combinations, with Alamar Blue measure cytoactives after being incubated 72 hours.Knot Fruit is shown, propagation of Heregulin α, the Heregulin α induction of SK-BR-3 is added in complete medium.SK-BR-3 is to He Sai Spit of fland, which is administered alone, becomes insensitive, and GB235-019 antibody is administered alone no inhibitory action, and GB235-019 antibody and He Sai Spit of fland administering drug combinations inhibit Heregulin α proliferative induction to act on, and show concentration dependent.

Fig. 8 shows the anti-human HER2 antibody GB235-019 antibodies on breast cancer SK-BR-3 cell signallings of recombinant full-lenght Inhibitory action.HER2 height expresses breast cancer cell SK-BR-3 after the hungry culture of 0.1% hyclone culture medium 24 hours, GB235-019 antibody 20 μ g/ml are added, the μ g/ml of Trastuzumab 20 are administered alone, and GB235-019 antibody and Trastuzumab Administering drug combinations, antibody handled SK-BR-3 cells after 6 hours, and the Heregulin α for adding final concentration of 100ng/ml induce 15 points Sampled after clock.Western blotting is done with cell pyrolysis liquid, with corresponding antibodies separately detect whole and phosphorylation HER3, Akt and ERK.Fig. 8 result is shown, is compared and is not added with Heregulin α control group, and Heregulin α cause SK-BR-3 cells HER3 The up-regulation effect of phosphorylation.Each independent medication slightly inhibits Heregulin α to SK- to GB235-019 antibody with Trastuzumab The up-regulation effect of HER3 phosphorylations, compares and is administered alone, GB235-019 antibody combines use with Trastuzumab in BR-3 cells Medicine, up-regulation effects of the Heregulin α to HER3 phosphorylations has been reversed completely.Meanwhile GB235-019 antibody and Trastuzumab are independent Medication, do not suppress up-regulation effects of the Heregulin α to Akt phosphorylation, compare and be administered alone, GB235-019 antibody with it is conspicuous The drug combination in match spit of fland substantially inhibits up-regulation effects of the Heregulin α to Akt phosphorylation.GB235-019 antibody and Trastuzumab Independent medication, up-regulations of the Heregulin α to ERK1/2 phosphorylations is also substantially inhibited to act on, and GB235-019 antibody and He Sai Spit of fland drug combination has reversed up-regulation effects of the Heregulin α to ERK1/2 phosphorylations completely.

Fig. 9 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses the reality of BT-474 cell-proliferation activities Test result.By the BT-474 breast cancer cells of the high expression of P-HER2 in complete medium the GB235- with various concentrations respectively 019 antibody and Trastuzumab be administered alone and administering drug combinations be incubated 72 hours after with Alamar Blue measure cytoactive.As a result It has been shown that, Trastuzumab can suppress BT-474 cells propagation in complete medium, and show concentration dependent.GB235-019 resists Body can not suppress BT-474 cells propagation in complete medium.GB235-019 antibody and Trastuzumab drug combination, do not increase The inhibitory action of Trastuzumab.

Fig. 9 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght reverses Heregulin α inductions BT- Experimental result of 474 cells to Trastuzumab drug-resistant effect.The BT-474 breast cancer cells of the high expression of P-HER2 are being cultivated completely Heregulin α are added in base, the GB235-019 antibody and Trastuzumab of various concentrations is administered alone, or GB235-019 antibody and Trastuzumab administering drug combinations, with Alamar Blue measure cytoactives after being incubated 6 days.As a result show, added in complete medium Propagation of Heregulin α, the Heregulin α induction of BT-474 cells.BT-474 cells are administered alone to Trastuzumab becomes resistance to Medicine, GB235-019 antibody, which is administered alone, does not have inhibitory action yet.And GB235-019 antibody and Trastuzumab administering drug combinations inhibit The proliferation function of Heregulin α inductions, and the level before being induced less than Heregulin α is substantially suppressed to, and show concentration Dependence.

Figure 10 shows the anti-human HER2 antibody GB235-019 antibodies on breast cancer BT-474 cell signallings of recombinant full-lenght Inhibitory action.P-HER2 height expresses breast cancer cell BT-474 after the hungry culture of 0.1% hyclone culture medium 24 hours, The μ g/ml of GB235-019 antibody 20 are added, the μ g/ml of Trastuzumab 20 are administered alone, and the connection of GB235-019 antibody and Trastuzumab Close administration, antibody handles BT-474 cells after 6 hours, add final concentration of 100ng/ml Heregulin α induce 10 minutes after Sampling.Western blotting is done with cell pyrolysis liquid, HER3, Akt and ERK of whole and phosphorylation are separately detected with corresponding antibodies.Figure 10 result is shown, is compared and is not added with Heregulin α control group, and Heregulin α cause BT-474 cell HER3 phosphorylations Up-regulation effect.Each independent medication substantially inhibits Heregulin α to BT-474 cells to GB235-019 antibody with Trastuzumab The up-regulation effect of middle HER3 phosphorylations, compares and is administered alone, and the drug combination of GB235-019 antibody and Trastuzumab is completely inverse Up-regulation effects of the Heregulin α to HER3 phosphorylations is turned.Meanwhile GB235-019 antibody and Trastuzumab independent medication, do not have Suppress up-regulation effects of the Heregulin α to Akt phosphorylation, compare and be administered alone, GB235-019 antibody is combined with Trastuzumab Medication it is faint inhibit Heregulin α to Akt phosphorylation up-regulation effect.GB235-019 antibody and Trastuzumab independent medication Faint inhibits up-regulation effects of the Heregulin α to ERK1/2 phosphorylations, and GB235-019 antibody combines use with Trastuzumab Medicine has reversed up-regulation effects of the Heregulin α to ERK1/2 phosphorylations completely.

Figure 11 shows that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses the cells of MDA-MB-175 VII propagation and lived The experimental result of property.By the HER2 for the expressing medium level and HER3 of the medium level breast cancer cells of MDA-MB-175 VII complete It is administered alone respectively with the GB235-019 antibody and Trastuzumab of various concentrations in full culture medium and after administering drug combinations are incubated 6 days Cytoactive is determined with Alamar Blue.As a result show, GB235-019 antibody is administered alone in complete medium with Trastuzumab The middle cells of suppression MDA-MB-175 VII propagation that can be faint.GB235-019 antibody and Trastuzumab drug combination, can be completely inhibited The cells of MDA-MB-175 VII are bred, and show concentration dependent.

Figure 12 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses the reality of the cell-proliferation activities of MCF 7 Test result.The HER2 and high-level HER3 of reduced levels will be expressed, but the breast cancer of MCF 7 for not expressing P-HER2 and P-HER3 is thin Born of the same parents are administered alone respectively with the GB235-019 antibody and Trastuzumab of various concentrations in complete medium and administering drug combinations are incubated With Alamar Blue measure cytoactives after 72 hours.As a result show, Trastuzumab is administered alone complete with GB235-019 antibody The cells of MCF 7 propagation can not all be suppressed in full culture medium, Trastuzumab is with the antibody combined administrations of GB235-019 in complete medium In, the cells of MCF 7 propagation can not be suppressed.

Figure 12 B show the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght in complete medium Heregulin α induce the experimental result of the cell-proliferation activities of MCF 7.The HER2 and high-level HER3 of reduced levels will be expressed, but The breast cancer cells of MCF 7 for not expressing P-HER2 and P-HER3 add Heregulin α in complete medium, various concentrations GB235-019 antibody and Trastuzumab are administered alone, or GB235-019 antibody and Trastuzumab administering drug combinations, are used after being incubated 72 hours Alamar Blue determine cytoactive.As a result show, it is faint that Heregulin α, Heregulin α are added in complete medium Induction of the propagation of the cells of MCF 7.Trastuzumab, which is administered alone, inhibits Heregulin α to act on the proliferative induction of the cells of MCF 7 Part, but effect is limited, and GB235-019 antibody is administered alone no inhibitory action.And GB235-019 antibody and Trastuzumab joint The inhibitory action without increase Trastuzumab is administered.

Figure 13 A and Figure 13 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght is trained to low hyclone Support the experimental result of the Heregulin α inductions cell-proliferation activities of MCF 7 in base.The HER2 and high level of reduced levels will be expressed HER3, but the breast cancer cells of MCF 7 for not expressing P-HER2 and P-HER3 add Heregulin in low hyclone culture medium α, the GB235-019 antibody of various concentrations are administered alone, or the GB235-019 antibody of various concentrations and fixed concentration Trastuzumab connection Administration is closed, with Alamar Blue measure cytoactives after being incubated 72 hours.As a result show, added in low hyclone culture medium Heregulin α, Heregulin α are significantly induction of the propagation of the cells of MCF 7.GB235-019 antibody, which is administered alone, to be inhibited Heregulin α induce the propagation of the cells of MCF 7, and show concentration dependent.GB235-019 antibody and 10ng/ml Trastuzumabs Administering drug combinations, collaboration inhibit the propagation of the Heregulin α induction cells of MCF 7.GB235-019 antibody and 100ng/ml He Sai Spit of fland administering drug combinations, collaboration inhibit the propagation of the Heregulin α induction cells of MCF 7, and add maximum suppression effect.

Figure 14 shows the anti-human cell signallings of HER2 antibody GB235-019 antibodies on breast cancer MCF 7 of recombinant full-lenght Inhibitory action.The HER2 and high-level HER3 of reduced levels are expressed, but does not express the P-HER2 and P-HER3 breast cancer of MCF 7 Cell adds GB235-019 antibody 20 μ g/ml, the μ of Trastuzumab 20 after the hungry culture of 0.1% hyclone culture medium 24 hours G/ml is administered alone, and the administering drug combinations of GB235-019 antibody and Trastuzumab, and antibody handled 7 cells of MCF after 6 hours, added Final concentration of 100ng/ml Heregulin α are added to be sampled after inducing 10 minutes.Western blotting is done with cell pyrolysis liquid, with corresponding Antibody separately detects HER3, Akt and ERK of whole and phosphorylation.Figure 14 result is shown, is compared and is not added with Heregulin α's Control group, Heregulin α cause the up-regulation of the cell HER3 phosphorylations of MCF 7 to act on.GB235-019 antibody with Trastuzumab each Independent medication substantially inhibits up-regulations of the Heregulin α to HER3 phosphorylations in the cells of MCF 7 to act on, and compares and is administered alone, The drug combination of GB235-019 antibody and Trastuzumab, up-regulation effects of the Heregulin α to HER3 phosphorylations has been reversed completely.Together When, GB235-019 antibody and Trastuzumab independent medication, hence it is evident that suppress up-regulation effects of the Heregulin α to Akt phosphorylation.Compare Relatively it is administered alone, the drug combination of GB235-019 antibody and Trastuzumab has reversed Heregulin α to the upper of Akt phosphorylation completely Tune acts on.GB235-019 antibody substantially inhibits up-regulations of the Heregulin α to ERK1/2 phosphorylations with Trastuzumab independent medication Effect, and GB235-019 antibody has reversed up-regulations of the Heregulin α to ERK1/2 phosphorylations completely with Trastuzumab drug combination Effect.

The anti-human HER2 antibody GB235-019 antibodies on breast cancer KPL-4 cell mouses in-vivo tumour life of Figure 15 recombinant full-lenghts Long inhibitory action.The P-HER2 of human breast carcinoma (KPL-4) cells express high levels.KPL-4 cells press 5 × 10⁶Cell/only small Mouse is seeded on the right side of 38 SCID Beige mouse bodies under the pad second from the bottom to breast respectively.When gross tumor volume reaches 100- 200mm³When, choose 24 mouse according to gross tumor volume size and body weight and be randomly divided into 4 groups, every group of 6 animals.Trastuzumab group (30mg/kg Trastuzumabs), GB235-019 antibodyomes (30mg/kg GB235-019 antibody), drug combination group (30mg/kg He Sai Spit of fland+30mg/kg GB235-019 antibody) and blank control group (PBS), all drug administration approach is are injected intraperitoneally, a Monday It is secondary, surrounding is administered altogether.Gross tumor volume is measured twice a week and carries out weighing mouse weight.Result such as Figure 15 shows Trastuzumab list Private medicine can partly suppress the growth of KPL-4 tumours；GB235-019 antibody independent medication can not suppress the growth of KPL-4 tumours； GB235-019 antibody and Trastuzumab drug combination completely inhibit the growth of KPL-4 tumours, and the tumour that has generated can be made bright It is aobvious to reduce, embody significantly collaboration and suppress the effect of KPL-4 tumour growths.

Embodiment

Below with specific embodiment, technical scheme is described further；But the present invention is not limited to These embodiments.

Embodiment 1 is screened from Quan Renyuan scFv phage libraries and the clone of people HER2-Fc specific bindings

Using the antigen-antibody binding specificity of elisa technique, people HER2 (extracellular domain)-Fc fusion proteins (are referred to as HHER2-Fc) antigen coat is to ELISA Plate, by washing the bacteriophage being specifically adhered to elutriation on envelope antigen.People HER2-Fc (is purchased from Sino Biological companies, article No.：10004-H02H) antigen PBS (0.01M Na₂HPO₄·12H₂O +0.002M KH₂PO₄+ 0.14M NaCl+0.002M KCl, pH=8.6) 5 μ g/ml are diluted to, add enzyme mark according to 100 μ l/ holes In plate, 4 DEG C of coatings are overnight.5%BSA is added after PBST the PBS of 0.05% polysorbas20 (contain) board-washing 4 times (to be purchased from Amresco, article No.：0332-100g, solution PBS) 300 μ l/ holes, 37 DEG C are closed 1 hour.PBST board-washings are used again 2 times.It will contain Have 7 × 10¹⁰(this antibody library is limited by You Rui sections (Beijing) biotechnology for the full people source scFv phage antibody libraries of independent cloning Company is built-up with the antibody variable gene of multiple Healthy Individuals and the artificial synthesized heavy chain CDR3 assortments of genes) Suspension according to 100 μ l/ holes add ELISA Plate in, be incubated 2 hours under the conditions of 37 DEG C.After incubation terminates, ELISA Plate hole is suctioned out In phage suspensions, PBST 300 μ l/ holes, fully piping and druming one time are then added in every hole, it is every all over 5 minutes, with remove with The bacteriophage of the non-specific binding of envelope antigen.Add and (be purchased from Amresco, article No. containing 0.1%BSA:0332-100g, solution For PBS) 0.2M glycine-HCIs (pH=2.2) eluent, incubation at room temperature 10 minutes after, fully blow and beat, elution specificity Ground is adhered to the bacteriophage on envelope antigen.By the phage suspensions under eluting with 1M Tris-HCl (pH9.1) buffer solution With.The phage-infect of elution is added to TG1 (OD600 about 0.3~04.) (Lucigen, article No. of 1ml logarithmic phases:60500- 0, the U.S.) infected, 37 DEG C, stand 1 hour.By bacterium solution after infection take 10 μ l carry out 10 times of gradient dilutions, carry out 10 times, 100 times, 1000 times dilution after apply plate count.Take 90 μ l infect after bacterium solution preserve glycerol stock, final glycerol concentration 10%, put- 80 DEG C of preservations.Residue infects rear bacterium solution and is all applied to 2 × YT-A of 150mm solid plates (17g/L tryptones, 10g/L ferment Female extract, 5g/L sodium chloride, 15g/L agar, 100 μ g/ml ampicillins), 37 DEG C are incubated overnight.Add 2 × YT- of 5ml A-10% glycerin mediums are gently scraped with sterile spreading rod to being incubated overnight on 150mm flat board bacterium, to flat board on noresidue Bacterium solution.Second wheel amplification, appropriate scrape is taken to obtain bacterium solution to 5ml2 × YT-AMP-glucose fluid nutrient mediums (17g/L pancreases Change peptone, 10g/L yeast extracts, 5g/L sodium chloride, 2% glucose, 100 μ g/ml ampicillins) in (OD600 is about 0.05~0.1), 37 DEG C, 200rpm cultures arrive logarithmic phase (OD600 about 0.3~0.4), it is total to add 20 times of thalline M13K07 helper phages (NEB companies, article No.:N0315S, the U.S.) infect, 37 DEG C, 1 hour.1500g after having infected, 5 minutes Collect thalline and be resuspended in 2 × YT-AMP-Kana culture mediums (17g/L tryptones, 10g/L yeast extracts, 5g/L chlorinations Sodium, 50 μ g/ml kanamycins, 100 μ g/ml ampicillins), 30 DEG C, 200rpm be incubated overnight, complete the expansion of recombinant phage Increase and prepare.Carry out identical second and take turns elutriation, third round amplification and elutriation.Picking colony is to 5ml (2 × YT-AMP-glucose Fluid nutrient medium (17g/L tryptones, 10g/L yeast extracts, 5g/L sodium chloride, 2% glucose, 100 μ g/ml ammonia benzyls Penicillin), 37 DEG C, 200rpm is incubated overnight.Plasmid extraction kit (Qiagen companies, article No.：12943, the U.S.) extracting matter Grain, pass through sequencing identification, -80 DEG C of preservations of plasmid.

Embodiment 2 specifically binds the immune response of people HER2-Fc bacteriophages with enzyme linked immunosorbent assay (ELISA) identification Property

Bitten with the specific binding people HER2-Fc obtained in enzyme linked immunosorbent assay (ELISA) further identification embodiment 1 The immunoreactivity of thalline.People HER2-Fc antigens (are purchased from Sino Biological companies, article No.：10004-H02H) use PBS (pH=8.6) 2 μ g/ml are diluted, are added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.5% is added after PBST board-washings 4 times BSA (is purchased from Amresco, article No.：0332-100g, solution PBS) 300 μ l/ holes, 37 DEG C are closed 1 hour.PBST board-washings 2 are used again It is secondary, 100 μ l/ holes phage clone suspensions are added, are incubated 2 hours under the conditions of 37 DEG C.PBST board-washings 4 times.Add HRP marks Anti- M13K07 phage antibodies (GE, article No.：27-9421-01, PBST 1:5000 dilutions, 100 μ l/ holes), incubation at room temperature 1 is small When.PBST board-washings 4 times, add the tetramethyl benzidine substrates solution of 100 μ l/ holes soluble type one pack system 3,3', 5,5'- (Tiangen, article No.：PA107-01).Incubation at room temperature develops the color for 15 minutes, 50 μ l/ holes terminate liquids (1M sulfuric acid) is added, multi-functional On ELIASA (Bio-Rad, Model 680Micro reader) light absorption value is read under 450/570nm wavelength.

As a result show, repeat to screen by three-wheel, obtaining 1312 altogether can be with the scFv phagocytosis of people's HER2-Fc antigen bindings Body is cloned, wherein 499 scFv phage clone numbers that can be combined with people's HER2-Fc antigentic specificities.Through DNA sequencing, these There is the scFv (as shown in table 1) that 102 kinds of DNA/ amino acid sequences are different from clone.

Table 1

Embodiment 3 with ELISA method detection 102 people's HER2-Fc specificity scFv kind cross reaction and HER families into The intermolecular cross reaction of member

Divide with 102 people's HER2-Fc specificity scFv of ELISA method detection kind cross reaction and with HER family members Cross reaction between son.Method changes coated people HER2-Fc antigens into monkey HER2-Fc and (is purchased from Sino respectively with embodiment 2 Biological companies, article No.：90295-C02H), mouse HER2-Fc (is purchased from Sino Biological companies, article No.： 50714-M02H), people HER1-Fc (is purchased from Sino Biological companies, article No.：10001-H02H), people HER3-Fc (is purchased from Sino Biological companies, article No.：10201-H05H) and people HER4-Fc (is purchased from Sino Biological companies, article No.： 10363-H02H).Antigen dilutes 2 μ g/ml with PBS (pH=8.6), is added according to 100 μ l/ holes in ELISA Plate, 4 DEG C were coated with Night.5%BSA is added after PBST board-washings 4 times and (is purchased from Amresco, article No.：0332-100g, solution PBS) 300 μ l/ holes, 37 DEG C Closing 1 hour.PBST board-washings are used again 2 times, add 102,100 μ l/ holes scFv phage clone suspensions, incubated under the conditions of 37 DEG C Educate 2 hours.PBST board-washings 4 times.The anti-M13K07 phage antibodies for adding HRP marks (are purchased from GE, article No.：27-9421-01, PBST 1:5000 dilutions, 100 μ l/ holes), it is incubated at room temperature 1 hour.PBST board-washings 4 times, add 100 μ l/ holes soluble type one pack systems 3,3', 5,5'- tetramethyl benzidine substrates solution (are purchased from Tiangen, are purchased from：PA107-01).Incubation at room temperature develops the color for 15 minutes, 50 μ l/ holes terminate liquids (1M sulfuric acid) are added, 450/ on multi-function microplate reader (Bio-Rad, Model 680Micro reader) Light absorption value is read under 570nm wavelength.

As a result show there are 96 scFv phage clones and monkey HER2-Fc antigens to have cross reaction, wherein there are 20 scFv Phage clone has cross reaction with mouse HER2-Fc antigens.102 all clones and people HER1-Fc, people HER3-Fc and people The equal no cross reaction of HER4-Fc antigens (as shown in table 2).

Table 2

The affinity sequence of 4 102 scFv phage clones of embodiment

102 scFv phage clones are sorted by ELISA method affinity, by people's HER2-Fc antigens PBS from 25 μ g/ml start ten doubling dilutions totally 8 gradients, and the phage suspensions with 102 scFv phage clones are incubated in room temperature respectively 4 hours are educated to reach balance；Resulting mixed liquor is added to 2 μ g/ml people HER2-Fc antigens (pH=8.6PBS, 4 DEG C of mistakes Night, 100 μ l/ holes) in advance in coated ELISA Plate, and (Amresco, article No. are purchased from 5%BSA：0332-100g, solution are PBS the ELISA Plate) closed, to combine scFv antibody at large.The anti-M13 phage antibodies for adding HRP marks (are purchased from GE, article No.：27-9421-01, with PBST1:5000 dilutions, 100 μ l/ holes), detected in method same as Example 2.With IC50 values are ranked up (IC50 values are lower, and affinity is higher) to the affinity of 102 positive colonies.

As a result the IC50 Distribution value scopes of 102 scFv phage clones are shown, wherein there is the affinity of 4 clones high In Trastuzumab.

Table 3

The structure of the carrier for expression of eukaryon of embodiment 5GB235-019 and GB235-042 recombinant full-lenght IgG1 type antibody

From 102 scFv phage clone sequences, structure GB235-019 and GB235-042 recombinant full-lenght IgG1 types resist The carrier for expression of eukaryon of body.Screen to obtain WG1-019 (in the screening of scFv phage libraries through full people source scFv phage libraries Be WG1-019 to single chain antibody sequence clone designation) single-chain antibody clone nucleotides sequence be classified as SEQ ID NO:9, it is included Weight chain variabl area sequence and the nucleotide sequence of light chain variable district be respectively SEQ ID NO:3 (amino acid sequence of coding is SEQ ID NO:And SEQ ID NO 1):4 (amino acid sequence of coding is SEQ ID NO:2).

Obtain WG1-042 ((it is WG1-042 to obtain single chain antibody sequence clone designation in the screening of scFv phage libraries)) The clone nucleotide sequence of single-chain antibody is SEQ ID NO:14, the core of its weight chain variabl area sequence included and light chain variable district Nucleotide sequence is respectively SEQ ID NO:12 (amino acid sequence of coding is SEQ ID NO:And SEQ ID NO 10):13 (codings Amino acid sequence be SEQ ID NO:11).Signal peptide amino acid sequence is：MELGLSWIFLLAILKGVQC；Nucleotide sequence For：ATGGAGTTGGGACTGTCTTGGATTTTCCTGTTGGCTATTCTGAAAGGTGTGCAGTGT(by Shanghai JaRa biology work Journey Co., Ltd synthesizes).

The heavy chain constant region of GB235-019 and GB235-042 recombinant full-lenght antibody and the nucleotide sequence of constant region of light chain Not to be SEQ ID NO:7 (amino acid sequence of coding is SEQ ID NO:And SEQ ID NO 5):8 (the amino acid sequences of coding It is classified as SEQ ID NO:6) (synthesized by Shanghai Jierui Biology Engineering Co., Ltd).

Design primer is used to build the true of GB235-019 and GB235-042 recombinant full-lenghts IgG1 types heavy chain of antibody and light chain Nuclear expression carrier, primer sequence are as follows：

1-1：5’-GAATTCGCGGCCGCATGGAGTTGGGACTG-3’

2-3：5’-CTGGGTCATCTGGATGTCACACTGCACACCTTTC-3’

3-3：5’-GAAAGGTGTGCAGTGTGACATCCAGATGACCCAG-3’

4-3：5’-GATGGTGCAGCCACAGTACGTTTGATATCCACTTTG-3’

4-4：5’-GATGGTGCAGCCACAGTACGTTTGATCTCCACCTTG-3’

5-2：5’-ATCAAACGTACTGTGGCTGCACCATC-3’

6-1：5’-GTTTAAACGGATCCCTAACACTCTCCCCTGTTG-3’

7-6：5’-GCACCAGCTGGACCTG ACACTGCACACCTTTC-3’

7-7：5’-GTACCAGCTGGACCTC ACACTGCACACCTTTC-3’

8-6：5’-GAAAGGTGTGCAGTGTCAGGTCCAGCTGGTGC-3’

8-7：5’-GAAAGGTGTGCAGTGTGAGGTCCAGCTGGTAC-3’

9-1：5’-GATGGGCCCTTGGTGGAGGCTGAGGAGACGGTCAC-3’

10-1：5’-ACCGTCTCCTCAGCCTCCACCAAGGGCCCATC-3’

11-1：5’-GTTTAAACGGATCCTCATTTACCGGGAGACAGGGAG-3’

Using the signal peptide sequence of synthesis as template, 1-1 and 2-3 are primer, are expanded by PCR method and obtain the digestions of I containing EcoR The genetic fragment in site, it is named as " SPL-GB235-019 "；With the light-chain variable sequence SEQ ID NO of synthesis:4 be template, 3-3 and 4-4 is primer, and the amplification of PCR methods obtains chain variable region gene fragment, is named as " VL-GB235-019 "；Simultaneously with conjunction Into constant light chain sequences SEQ ID NO:8 be template, and 5-2 and 6-1 are primer, and the amplification of PCR methods obtains termination codon containing TGA The weight chain constant area gene fragment of son and BamH I restriction enzyme sites, is named as " CL-GB235-019 ".With SPL-GB235-019, VL-GB235-019, CL-GB235-019 genetic fragment are template, and 1-1 and 6-1 are primer, pass through over-lapping PCR sides Method (Higuchi R, et al.A general method of in vitro preparation and specific mutagenesis of DNA fragments:study of protein and DNA interactions.Nucleic Acids Research,1988,16(15):7351-67.) amplification obtains the light chain full-length gene fragment of GB235-019 antibody. Using the signal peptide sequence of synthesis as template, 1-1 and 2-3 are primer, and the base for obtaining the restriction enzyme sites of I containing EcoR is expanded by PCR method Because of fragment, it is named as " SPL-GB235-042 "；With the light-chain variable sequence SEQ ID NO of synthesis:13 be template, 3-3 and 4- 3 be primer, and the amplification of PCR methods obtains chain variable region gene fragment, is named as " VL-GB235-042 "；Simultaneously with the light chain of synthesis Constant-region sequences SEQ ID NO:8 be template, and 5-2 and 6-1 are primer, and the amplification of PCR methods obtains terminator codon containing TGA and BamH The light chain constant region gene fragment of I restriction enzyme sites, is named as " CL-GB235-042 ".With SPL-GB235-042, VL-GB235- 042nd, CL-GB235-042 genetic fragments are template, and 1-1 and 6-1 are primer, are obtained by the amplification of over-lapping PCR methods Obtain the light chain full-length gene fragment of GB235-042 antibody.

Same method, using the signal peptide sequence of synthesis as template, 1-1 and 7-7 are primer, and by PCR, (polymerase chain is anti- Should) method amplification obtain the restriction enzyme sites of I containing EcoR genetic fragment, be named as " SPH-GB235-019 "；With the heavy chain of synthesis Variable region sequences SEQ ID NO:3 be template, and 8-7 and 9-1 are primer, and the amplification of PCR methods obtains heavy chain variable region gene fragment, life Entitled " VH-GB235-019 "；Simultaneously with the heavy chain constant region sequence SEQ ID NO of synthesis:7 be template, and 10-1 and 11-1 are to draw Thing, the amplification of PCR methods obtain terminator codon containing TGA and the weight chain constant area gene fragment of BamH I restriction enzyme sites, are named as “CH-GB235-019”.Using SPH-GB235-019, VH-GB235-019, CH-GB235-019 genetic fragment as template, 1-1 and 11-1 is primer, and the heavy chain full-length gene fragment for obtaining GB235-019 antibody is expanded by over-lapping PCR methods.With The signal peptide sequence of synthesis is template, and 1-1 and 7-6 are primer, is expanded by PCR (polymerase chain reaction) method and obtains I containing EcoR The genetic fragment of restriction enzyme site, it is named as " SPH-GB235-042 "；With the weight chain variabl area sequence SEQ ID NO of synthesis:12 are Template, 8-6 and 9-1 are primer, and the amplification of PCR methods obtains heavy chain variable region gene fragment, is named as " VH-GB235-042 "；Simultaneously With the heavy chain constant region sequence SEQ ID NO of synthesis:7 be template, and 10-1 and 11-1 are primer, and the amplification of PCR methods obtains whole containing TGA The only weight chain constant area gene fragment of codon and BamH I restriction enzyme sites, is named as " CH-GB235-042 ".With SPH- GB235-042, VH-GB235-042, CH-GB235-042 genetic fragment are template, and 1-1 and 11-1 are primer, pass through over- The amplification of lapping PCR methods obtains the heavy chain full-length gene fragment of GB235-042 antibody.

Above heavy chain and light chain full-length gene fragment are cloned into pGEM-T carriers and (are purchased from Promega companies, article No.： A3600), the end of genetic fragment 5 ' is made to contain EcoR I restriction enzyme sites, TGA terminator codons and BamH I digestions are contained in 3 ' ends Site.After DNA sequencing, by sequencing, correctly clone (is purchased from NEB companies, article No. with EcoR I：R0101S) (purchased with BamH I From NEB companies, article No.：R0136S) double digested (37 DEG C, 4 hours), target gene fragment is reclaimed.Simultaneously by 293 carriers (it is purchased from Invitrogen companies, article No.：K8300-01 EcoR I and BamH I double digested (37 DEG C, 4 hours)) are used, is reclaimed 293-EcoRI/BamHI carrier segments.

The heavy chain of antibody full-length gene fragment and light chain full-length gene fragment that above-mentioned digestion is obtained respectively with 293- EcoRI/BamHI carrier segments (are purchased from NEB companies, article No. with T4DNA ligases：M0202S) it is attached that (16 DEG C, 16 is small When), (42 DEG C, 90 seconds) conversion Escherichia coli of heat shock, bed board (Amp⁺LB culture mediums), picked clones, EcoRI/BamHI pairs (37 DEG C, 2 hours) progress evaluation and screenings of digestions, screening obtain carrying containing the full length antibody heavy chain eukaryotic expression successfully constructed The clone of body or full length antibody light chain carrier for expression of eukaryon.

Figure 1A is the structural representation of anti-human HER2 heavy chain of antibody (293-VH-CH) expression vector of recombinant full-lenght；Figure 1B is The structural representation of anti-human HER2 antibody light chains (293-VL-CL) expression vector of recombinant full-lenght.

The eukaryotic of embodiment 6GB235-019 and GB235-042 recombinant full-lenght IgG1 type antibody transiently transfect expression and Purifying

The expression of constructed GB235-019 and GB235-042 recombinant vectors, can use cotransfection in embodiment 5 FreeStyle 293F cells (are purchased from Invitrogen, article No.：R790-07, the U.S.) method., will 24 hours before transfection FreeStyle 293F cells press 6 × 10⁵The passage of individual cell/ml, in 135 revs/min of constant-temperature table, 37 DEG C, 8%CO₂Under the conditions of train Support so that the cell density (blood cell plate counting method) for transfecting the same day is 1.2-1.5 × 10⁶Individual cell/ml.Use FreeStyle 293 culture mediums (are purchased from Invitrogen companies, article No.：12338-018, the U.S.) diluting cells are 1 × 10 to density⁶It is individual thin Born of the same parents/ml.To ensure optimal transfection, cell viability (trypan blue staining) should be greater than 95%.

Transfection (is purchased from Invitrogen companies, article No. with reagent FreeStyle Max Reagent：16447-500, The U.S.) slightly overturn mixing 4 times.Each 315 μ g heavy chains and light chain expression vector plasmid are separately added into transfection nutrient solution OptiPRO SFM (are purchased from Invitrogen companies, article No.：12309-050, the U.S.) in, and supplement volume with OptiPRO SFM To 10ml, mix.A centrifuge tube separately is taken, dilutes 625 μ l FreeStyle Max Reagent extremely with OptiPRO SFM 10ml, slight reverse mixing.The plasmid of dilution and the FreeStyle Max Reagent of dilution are mixed, are incubated at room temperature 15 points Clock.The 20ml mixed liquors of gained are slowly added to (public purchased from Invitrogen equipped with 500ml FreeStyle 293F culture mediums Department, article No.：12338-018, the U.S.) shaking flask in.Shaking flask in constant-temperature table culture 7 days (135 revs/min, 37 DEG C, 8%CO₂)。 9000 revs/min of refrigerated centrifuge centrifuges 20 minutes, collects supernatant and carries out next step protein purification.

The FreeStyle 293F cell supernatants of above-mentioned antibody containing GB235-019 or GB235-042 antibody, after centrifugation IgG1 type antibody is captured using albumin A (Protein A) post (being purchased from GE Healthcare Bio-Sciences companies), is used 50mM citric acid-sodium citrate buffer solutions (pH=3.3) elute, and collect eluate (0.5ml), add 100 μ l 1M trihydroxy methyls Aminomethane-hydrochloric acid (Tris-HCL) buffer solution (pH=11.0) is neutralized to neutrality, (is given birth to through 10K dialysis membranes purchased from Shanghai JaRa Thing Engineering Co., Ltd, article No.：M1915) in phosphate buffer PBS (0.01M Na₂HPO₄·12H₂O+0.002M KH₂PO₄+ 0.14M NaCl+0.002M KCl, pH=7.2) in dialyse after, OD280nm measure protein content.(it is purchased from through 0.22 μm of filter Millipore companies) -80 DEG C of preservations after filtration sterilization.Obtained GB235-019 and GB235-042 antibody will be purified dense eventually Spend under the dithiothreitol (DTT) reducing condition for 50mM, detect its purity through 10% polyacrylamide gel electrophoresis and molecular weight is big It is small.

Fig. 2A, Fig. 2 B result show that under conditions of complete reduction, GB235-019 antibody and GB235-042 antibody are each Two bands that molecular weight is 50KDa and 25KDa are presented, its be respectively antibody heavy chain and light chain bands (Trastuzumab is positive right According to purchased from Roche companies).These results indicate that GB235-019 the and GB235-042 antibody structures constructed by us are correct, Its molecular size range is consistent with theoretical value.

The immunologic competence identification of the anti-human HER2GB235-019 and GB235-042 antibody of the recombinant full-lenght of embodiment 7

With the binding ability of ELISA Binding experiments checking GB235-019 and GB235-042 antibody and people's HER2 antigens.Side Method is as follows：People HER2 antigens (are purchased from Sino Biological companies, article No.：10004-H08H) antigen PBS is dilute Release to 1 μ g/ml, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ of 5%BSA 300 are added after PBST board-washings 4 times L/ holes (are purchased from Amresco, article No.：0332-100g, solution PBS), room temperature is closed 1 hour., will after PBST board-washings 4 times GB235-019, GB235-042 antibody and Trastuzumab (being purchased from Roche companies) five doubling dilutions totally 7 since 10 μ g/ml respectively Individual gradient, add in ELISA Plate according to 100 μ l/ holes, be incubated 1 hour at ambient temperature.PBST board-washings 4 times, by HRP marks Goat anti-human igg Fc antibody (being purchased from CalBiochem companies) is with PBS with 1:10000 dilutions, are added according to 100 μ l/ holes In ELISA Plate, it is incubated at room temperature 1 hour.PBST board-washings 4 times, 100 μ l/ holes nitrite ions are added, be incubated at room temperature 15 minutes and develop the color, add 50 μ l/ holes terminate liquids, light absorption value is read on M5 multi-function microplate readers under 450/630nm wavelength.

(Sino is purchased from ELISA Binding experiments checking GB235-019 and GB235-042 antibody with monkey HER2 respectively Biological companies, article No.：90295-C08H), mouse HER2 (is purchased from Sino Biological companies, article No.：50714- M08H), people HER1 (is purchased from Sino Biological companies, article No.：10001-H08H), people HER3 (is purchased from Sino Biological companies, article No.：10201-H08H-10), people HER4 (is purchased from Sino Biological companies, article No.：10201- H08H) the cross reaction of antigen.Method is as follows：Monkey HER2, mouse HER2, people HER1, people HER3 or people's HER4 antigens are dilute with PBS Release to 1 μ g/ml, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ of 5%BSA 300 are added after PBST board-washings 4 times L/ holes (are purchased from Amresco, article No.：0332-100g, solution PBS), room temperature is closed 1 hour., will after PBST board-washings 4 times GB235-019 and GB235-042 antibody respectively with PBS since 10 μ g/ml five doubling dilutions totally 8 gradients, according to 100 μ l/ holes are added in ELISA Plate, are incubated 1 hour at ambient temperature.PBST board-washings 4 times, the goat anti-human igg that HRP is marked Fc antibody PBSs are with 1:10000 dilutions, are added in ELISA Plate according to 100 μ l/ holes, are incubated at room temperature 1 hour.PBST is washed Plate 4 times, 100 μ l/ holes nitrite ions are added, be incubated at room temperature 15 minutes and develop the color, 50 μ l/ holes terminate liquids are added, in M5 multifunctional enzyme marks On instrument light absorption value is read under 450/630nm wavelength.

Fig. 3 A, Fig. 3 B result show that GB235-019, GB235-042 antibody has special with people HER2 and monkey HER2 antigens The binding ability of the opposite sex, Fig. 3 C result show that GB235-019, GB235-042 antibody has and the specific knots of mouse HER2 Conjunction ability；Fig. 3 D result shows that GB235-019, GB235-042 antibody does not have with people HER1, people HER3, people HER4 antigens Binding ability, shows GB235-019, and GB235-042 antibody does not have cross reaction with the other family members of people HER2.

The Inhibition ELISA of embodiment 8 identify the anti-human HER2 antibody GB235-019 of recombinant full-lenght and GB235-042 respectively with The epitope competition result of Trastuzumab

People HER2 antigens (are purchased from Sino Biological companies, article No.：10004-H08H) diluted with PBS To 1 μ g/ml, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ l/ of 5%BSA 300 are added after PBST board-washings 4 times Hole (is purchased from Amresco, article No.：0332-100g, solution PBS), room temperature is closed 1 hour.By GB235-019 and GB235-042 Antibody ten doubling dilutions totally 8 gradients since 10 μ g/ml respectively, respectively with 0.005 μ g/ml biotin labelings (by Shanghai friend Bio tech ltd of section mark) Trastuzumab incubation at room temperature 2 hours, according to 100 μ l/ holes add ELISA Plate in, room temperature It is incubated 1 hour；PBST board-washings 4 times, the HRP anti-biotin antibodies (being purchased from Invitrogen companies) marked are used into PBS With 1:10000 dilutions, are added in ELISA Plate according to 100 μ l/ holes, are incubated at room temperature 1 hour.PBST board-washings 4 times, add 100 μ l/ holes Nitrite ion, it is incubated at room temperature 15 minutes and develops the color, 50 μ l/ holes terminate liquids are added, on M5 multi-function microplate readers under 450/570nm wavelength Read light absorption value.

Fig. 4 results show that GB235-019 and GB235-042 antibody does not all compete with Trastuzumab, show that it combines table Position is outside the combination epitope of Trastuzumab.

The Inhibition ELISA of embodiment 9 identifies the anti-human HER2 antibody GB235-019 of recombinant full-lenght and the epitope competition of the appropriate pearl of pa As a result

People HER2 antigens (are purchased from Sino Biological companies, article No.：10004-H08H) diluted with PBS To 1 μ g/ml, added according to 50 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ l/ holes of 2%BSA 200 are added after PBST board-washings 4 times (it is purchased from Amresco, article No.：0332-100g, solution PBS), room temperature is closed 2 hours.By the appropriate pearl of pa (being purchased from Roche companies) With the GB235-019 antibody of unmarked biotin since 30 μ g/ml ten doubling dilutions, 3 gradients and ten since 10 μ g/ml 3 gradients of doubling dilution, (it is purchased from Invitrogen companies, APEX Biotin kits with 0.1 μ g/ml biotin labelings respectively Mark, article No.：A10495 GB235-019 antibody) is being incubated at room temperature 2 hours, is added according to 100 μ l/ holes in ELISA Plate, room temperature It is incubated 1 hour；PBST board-washings 4 times, the HRP Streptavidin antibody (being purchased from Invitrogen companies) marked is used into 1%BSA (it is purchased from Amresco, article No.：0332-100g, solution PBS) with 1:10000 dilutions, are added in ELISA Plate according to 100 μ l/ holes, Incubation at room temperature 1 hour.PBST board-washings 4 times, 100 μ l/ holes nitrite ions are added, be incubated at room temperature 15 minutes and develop the color, it is whole to add 50 μ l/ holes Only liquid, light absorption value is read under 450/630nm wavelength on M5 multi-function microplate readers (Molecular Devices companies).

Fig. 5 results show that GB235-019 antibody does not compete with the appropriate pearl of pa, show that it combines epitope in the appropriate pearl of pa Outside epitope.

The anti-human HER2 antibody GB235-019 of the recombinant full-lenght of embodiment 10 cell in vitro binding activity measure

Breast cancer cell BT-474 (is purchased from American type culture collection, accession number：HTB-20) medium level HER2 and medium level HER3, while high-caliber P-HER2 is expressed, but P-HER3 (Richard are not expressed M.Neve.Acollectionof breast cancer cell lines for the study of functionally Distinct cancer subtypes.CANCER CELL, 2006,515-527.).BT-474 cells are with 2.0 × 10⁵/100μ L is inoculated with 96 hole U-shaped boards.Simultaneously by the antibody GB235-019 of the present invention and Trastuzumab (being purchased from Roche companies), the appropriate pearl of pa (is purchased from Roche companies), respectively since 20 μ g/ml, (Invitrogen companies, article No. are purchased from containing 0.1% hyclone with PBS： 10099-141) buffer solution carries out three doubling dilutions totally 7 gradients, respectively 20,6.6,2.2,0.74,0.25,0.08,0.03 μ g/ml。

Supernatant is abandoned after cell 1000rpm, the 5min centrifugation of 96 hole U-shaped boards, the GB235-019 antibody after dilution, Trastuzumab BT-474 cells are separately added into according to 100 μ l/ holes with the appropriate pearl of pa, are incubated 1 hour at 4 DEG C.Supernatant is abandoned after centrifuging again, with 200 μ L PBS-0.1%FBS buffer solutions wash 2 times, and the sheep anti-human Fc antibodies for adding FITC marks (are purchased from Abcam companies, Britain, goods Number：Ab97224), 100 μ l/ holes (contain 0.1% hyclone buffer solution 1 with PBS:10000 dilutions), and it is incubated 45 points at 4 DEG C Clock.After cell centrifugation, washed 2 times containing 0.1% hyclone buffer solution with 200 μ l/ hole PBS, add 200 μ l PBS and contain 0.1% Hyclone buffer solution, and it is transferred to the sample containing streaming pipes of the 300 μ l PBS containing 0.1% hyclone buffer solution together with cell QC (Beckman), the cell in sample cell, flow cytomery (FC500, Beckman) detection FITC fluorescent values is resuspended. Corresponding antibodies and BT-474 cellular affinities are represented by the curve of analysis of fluorescence value and antibody concentration.

Fig. 6 result shows that GB235-019 antibody can be combined in expression HER2 BT- as Trastuzumab, the appropriate pearl of pa 474 cell surfaces, and concentration dependent and saturability are showed, show that GB235-019 antibody has high selectivity to HER2. GB235-019 antibody and the BT-474 cells quasi integration concentration corresponding when Percentage bound is 50% are 0.77 μ g/ml, Trastuzumab The quasi integration concentration corresponding when Percentage bound is 50% is 0.48 μ g/ml, the appropriate pearl of pa and BT-474 cells with BT-474 cells The quasi integration concentration (Percentage bound when being 50% corresponding concentration) corresponding when Percentage bound is 50% be 1.62 μ g/ml. The GB235-019 antibody of the present invention is similar with Trastuzumab with the binding activity of BT-474 cells, better than the appropriate pearl of pa.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 11 suppresses SK-BR-3 cell-proliferation activities

The HER2 of the breast cancer SK-BR-3 cells express high levels and HER3 of medium level, while express high-caliber P- The HER2 and P-HER3 of medium level (Richard M.Neve.Acollectionof breast cancer cell lines for the study of functionally distinct cancer subtypes.CANCER CELL,2006:515- 527.).SK-BR-3 cells in exponential phase (are purchased from American type culture collection, accession number：HTB-30) With 5000 cell per wells (Invitrogen companies, article No. are purchased from RPMI1640：A10491) (it is purchased from containing 10% hyclone Invitrogen companies, article No.：Culture is to 96 well culture plates in complete medium 10099-141), 37 DEG C, 5%CO₂Middle training Support 24 hours.GB235-019 antibody independent medication and with Trastuzumab drug combination suppress test.Independent medication group is separately added into GB235-019 antibody and Trastuzumab (work final concentration of 75,18.8,4.7,1.2,0.29,0.07,0.018,0.005, 0.0011,0μg/ml).37 DEG C, 5%CO₂In continue culture 72 hours.Addition AlamarBlue (Invitrogen companies are purchased from, Article No.：DAL1100 SK-BR-3 cytoactives) are detected, on M5 multi-function microplate readers (Molecular Devices companies) Fluorescent value is read under 544/590nm wavelength.

Heregulin α are added in complete medium and (are purchased from R＆D companies, article No.：296-HR) the suppression experiment of proliferative induction In, independent medication group be separately added into GB235-019 antibody and Trastuzumab (work final concentration of 75,18.8,4.7,1.2,0.29, 0.07,0.018,0.005,0.0011,0 μ g/ml), while drug combination group is added and resisted with the GB235-019 of above-mentioned each dosage Body and Trastuzumab.In above-mentioned GB235-019 antibody independent medication and with after Trastuzumab drug combination processing 2 hours, adding work Final concentration of 100ng/ml Heregulin α solution, set plus Heregulin α solution hole, 37 DEG C, 5%CO₂Middle continuation Culture 72 hours.Add AlamarBlue and (be purchased from Invitrogen companies, article No.：DAL1100) SK-BR-3 cells are detected to live Property, read fluorescent value under 544/590nm wavelength on M5 multi-function microplate readers (Molecular Devices companies).

Fig. 7 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses SK-BR-3 cell-proliferation activities Experimental result.As a result show, Trastuzumab can suppress SK-BR-3 cells propagation in complete medium, and show concentration dependant Property.GB235-019 antibody can not suppress SK-BR-3 cells propagation in complete medium.

Fig. 7 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght reverses Heregulin α inductions SK- Experimental result of the BR-3 cells to Trastuzumab drug-resistant effect.As a result show, Heregulin α added in complete medium, Propagation of the Heregulin α induction of SK-BR-3.SK-BR-3 is administered alone to Trastuzumab becomes insensitive, GB235-019 antibody Being administered alone does not have inhibitory action yet, and GB235-019 antibody and Trastuzumab administering drug combinations inhibit Heregulin α induction Proliferation function, and show concentration dependent.The HER2 of breast cancer SK-BR-3 cells express high levels and medium level HER3, while express high-caliber P-HER2 and the P-HER3 of medium level.Trastuzumab suppresses SK-BR-3 cells P-HER2 drivings Growth, but can not suppress Heregulin α induction SK-BR-3 cells growth.Growth factor Heregulin α make SK-BR-3 cells generate the drug resistance to Trastuzumab, and GB235-019 antibody and Trastuzumab administering drug combinations inhibit growth factor Heregulin α are acted on the induced growth of SK-BR-3 cells.

The suppression of the anti-human HER2GB235-019 antibodies on breast cancer SK-BR-3 cell signallings of the recombinant full-lenght of embodiment 12 Make and use

By the SK-BR-3 cells in exponential phase with 1.8 × 10⁵Cell per well (is purchased from RPMI1640 Invitrogen companies, article No.：A10491) (Invitrogen companies, article No. are purchased from containing 10% hyclone：10099-141) Culture is to 6 well culture plates in complete medium, 37 DEG C, 5%CO₂Middle culture 24 hours.Second day, discard culture medium and change into 0.1% hyclone (is purchased from Invitrogen companies, article No.：Low blood serum medium culture 10099-141) 24 hours.Then The μ g/ml of GB235-019 antibody 20 are added, the μ g/ml of Trastuzumab 20 are administered alone, and the connection of GB235-019 antibody and Trastuzumab Administration is closed, antibody handled SK-BR-3 cells after 6 hours, and the Heregulin α for adding final concentration of 100ng/ml are (public purchased from R＆D Department, article No.：296-HR) induce 15 minutes, the blank control wells for not adding Heregulin α are set.The PBS of 4 DEG C of precoolings washed once Terminating reaction afterwards, 120 μ l LDS of addition (are purchased from Invitrogen companies, article No.：NP0007), place and collect rapidly thin on ice Cellular lysate liquid, -80 DEG C save backup.

Dithiothreitol (DTT) of the cell pyrolysis liquid of collection in final concentration of 50mM (is purchased from Sangon companies, article No.：D0281) Under reducing condition, analyze detection antibody through Western-blot and (R＆D companies, article No. are purchased to Heregulin α：296-HR) lure Lead HER-3 in SK-BR-3 cells, the influence of Akt and ERK1/2 phosphorylations.Western-blot methods are as follows：After electrophoresis Glue is transferred on NC films by the method for electrotransfer (300mA, 80 minutes) and (is purchased from Pall companies, article No.：S80209), 5% is de- Fat milk powder (is purchased from Sangon companies, article No.：NB0669 it is separately added into after) closing with 1:The rabbit primary antibody P- of 1000 dilutions HER3Y1289 (is purchased from Cell Signaling Technology companies, article No.：8017), 1:The rabbit primary antibody P- of 1000 dilutions AktS473 (is purchased from Cell Signaling Technology companies, article No.：4060),1:The rabbit primary antibody Akt (purchases of 1000 dilutions From Cell Signaling Technology companies, article No.：4691), 1:The rabbit primary antibody P-ERK1/2 of 500 dilutions (is purchased from Cell Signaling Technology companies, article No.：4370),1:The rabbit primary antibody ERK1/2 of 1000 dilutions (is purchased from Cell Signaling Technology companies, article No.：4695),1:Rabbit primary antibody GAPDH (the Cell Signaling of 5000 dilutions Technology companies, article No.：5174), 4 DEG C of overnight incubations.Washed three times with 1 × TBST, 1 is added after washing film:10000 dilutions HRP mark goat anti-rabbit antibody (be purchased from MERCK companies, article No.：401315), washed three times with 1 × TBST, after add ECL (it is purchased from PerkinElmer companies, article No.：NEL104001EA) show, exposure tracer signal (is purchased from Kodak Company, goods Number：FF057).

Fig. 8 result is shown, is compared and is not added with Heregulin α control group, and Heregulin α cause SK-BR-3 cells The up-regulation effect of HER3 phosphorylations.Each independent medication slightly inhibits Heregulin α couple to GB235-019 antibody with Trastuzumab The up-regulation effect of HER3 phosphorylations, compares and is administered alone, GB235-019 antibody is combined with Trastuzumab in SK-BR-3 cells Medication, up-regulation effects of the Heregulin α to HER3 phosphorylations has been reversed completely.Meanwhile GB235-019 antibody and Trastuzumab list Private medicine, do not suppress Heregulin α to Akt phosphorylation up-regulation effect, compare and be administered alone, GB235-019 antibody with The drug combination of Trastuzumab substantially inhibits up-regulation effects of the Heregulin α to Akt phosphorylation.GB235-019 antibody and He Sai Spit of fland independent medication, also substantially inhibits up-regulation effects of the Heregulin α to ERK1/2 phosphorylations, and GB235-019 antibody with it is conspicuous Match spit of fland drug combination has reversed up-regulation effects of the Heregulin α to ERK1/2 phosphorylations completely.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 13 suppresses breast cancer BT-474 cell-proliferation activities

The HER2 of the breast cancer BT-474 cells expression medium level and HER3 of medium level, while express high-caliber P- HER2, but P-HER3 (Richard M.Neve.Acollectionof breast cancer cell lines for are not expressed the study of functionally distinct cancer subtypes.CANCER CELL,2006:515-527)。 BT-474 cells in exponential phase (are purchased from Invitrogen companies, article No. with 5000 cell per wells in RPMI1640： A10491) (Invitrogen companies, article No. are purchased from containing 10% hyclone：10099-141) cultivated in complete medium to 96 Well culture plate, 37 DEG C, 5%CO₂Middle culture 24 hours.GB235-019 antibody independent medication and with Trastuzumab drug combination suppress Experiment.Independent medication group be separately added into GB235-019 antibody and Trastuzumab (work final concentration of 75,18.8,4.7,1.2, 0.29,0.07,0.018,0.005,0.0011,0 μ g/ml), while drug combination group is added with the GB235- of above-mentioned each dosage 019 antibody and Trastuzumab.37 DEG C, 5%CO₂In continue culture 72 hours.It is (public purchased from Invitrogen to add AlamarBlue Department, article No.：DAL1100 BT-474 cytoactives) are detected, on M5 multi-function microplate readers (Molecular Devices companies) Fluorescent value is read under 544/590nm wavelength.

Heregulin α are added in complete medium and (are purchased from R＆D companies, article No.：In Proliferation Ability experiment 296-HR), In above-mentioned GB235-019 antibody independent medication and with after Trastuzumab drug combination processing 2 hours, it is final concentration of to add work 100ng/ml Heregulin α solution, set plus Heregulin α solution hole, 37 DEG C, 5%CO₂In continue culture 6 days. Add AlamarBlue and (be purchased from Invitrogen companies, article No.：DAL1100 BT-474 cytoactives) are detected, it is multi-functional in M5 On ELIASA (Molecular Devices companies) fluorescent value is read under 544/590nm wavelength.

Fig. 9 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses the reality of BT-474 cell-proliferation activities Test result.As a result show, Trastuzumab can suppress BT-474 cells propagation in complete medium, and show concentration dependent. GB235-019 antibody can not suppress BT-474 cells propagation in complete medium.GB235-019 antibody combines use with Trastuzumab Medicine, the inhibitory action of Trastuzumab is not increased.

Fig. 9 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght reverses Heregulin α inductions BT- Experimental result of 474 cells to Trastuzumab drug-resistant effect.As a result show, Heregulin α added in complete medium, Propagation of the Heregulin α induction of BT-474 cells.BT-474 cells are administered alone to Trastuzumab becomes insensitive, GB235- 019 antibody, which is administered alone, does not have inhibitory action yet.And GB235-019 antibody and Trastuzumab administering drug combinations inhibit Heregulin α The proliferation function of induction.GB235-019 antibody and Trastuzumab administering drug combinations not only to inhibit Heregulin α to induce BT- The effect of 474 cells propagation, and the level before being induced less than Heregulin α is substantially suppressed to, and show concentration dependent.

The HER2 of the breast cancer BT-474 cells expression medium level and HER3 of medium level, while express high-caliber P- HER2, but do not express P-HER3.Trastuzumab suppresses the growth of P-HER2 drivings, but can not suppress Heregulin α inductions The growth of BT-474 cells.Growth factor Heregulin α make BT-474 cells generate the drug resistance to Trastuzumab, GB235-019 antibody and Trastuzumab administering drug combinations inhibit growth factor Heregulin α to make the induced growth of BT-474 cells With, and the level before being induced less than Heregulin α is substantially suppressed to, GB235-019 antibody and Trastuzumab administering drug combinations are not only The growth of HER2 signal paths driving is closed, has been also switched off the growth of HER3 signal paths driving, produces collaboration Inhibitory action.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 14 is to breast cancer BT-474 cell signallings Inhibitory action

By the BT-474 cells 1.8 × 10 in exponential phase⁵Cell per well is trained in RPMI1640 complete mediums Support to 6 well culture plates, 37 DEG C, 5%CO₂Middle culture 24 hours.Second day, discard culture medium and change the low blood containing 0.1% serum into The clear hungry culture of culture medium 24 hours.Then the μ g/ml of addition GB235-019 antibody 20, the μ g/ml of Trastuzumab 20 are administered alone, with And the administering drug combinations of GB235-019 antibody and Trastuzumab, antibody handled BT-474 cells after 6 hours, addition is final concentration of 100ng/ml Heregulin α (are purchased from R＆D companies, article No.：296-HR) induce 10 minutes, set and do not add Heregulin α's Blank control wells.The PBS of 4 DEG C of precoolings washed once rear terminating reaction, and 120 μ l LDS of addition (are purchased from Invitrogen companies, goods Number：NP0007), place on ice and collect cell pyrolysis liquid rapidly, -80 DEG C save backup.

Dithiothreitol (DTT) of the cell pyrolysis liquid of collection in final concentration of 50mM (is purchased from Sangon companies, article No.：D0281) Under reducing condition, shadow of the detection antibody to Heregulin α induction BT-474 cell HER3 phosphorylations is analyzed through Western-blot Ring, and the influence to HER3 downstreams Akt and ERK1/2 phosphorylations.Western-blot methods are the same as embodiment 12.

The P-HER2 of breast cancer BT-474 cells express high levels, but P-HER3 is not expressed, it is to the thin of Trastuzumab sensitivity Born of the same parents' strain.Figure 10 result is shown, is compared and is not added with Heregulin α control group, and Heregulin α cause BT-474 cells HER3 The up-regulation effect of phosphorylation.Each independent medication substantially inhibits Heregulin α to BT- to GB235-019 antibody with Trastuzumab The up-regulation effect of HER3 phosphorylations, compares and is administered alone in 474 cells, the drug combination of GB235-019 antibody and Trastuzumab, Up-regulation effects of the Heregulin α to HER3 phosphorylations has been reversed completely.Meanwhile GB235-019 antibody is individually used with Trastuzumab Medicine, do not suppress up-regulation effects of the Heregulin α to Akt phosphorylation, compare and be administered alone, GB235-019 antibody and He Sai The drug combination in spit of fland it is faint inhibit up-regulation effects of the Heregulin α to Akt phosphorylation.GB235-019 antibody and Trastuzumab Independent medication it is faint inhibit up-regulation effects of the Heregulin α to ERK1/2 phosphorylations, and GB235-019 antibody and He Sai Spit of fland drug combination has reversed up-regulation effects of the Heregulin α to ERK1/2 phosphorylations completely.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 15 suppresses the cells of breast cancer MDA-MB-175 VII Proliferation activity

The HER2 of the cells of the breast cancer MDA-MB-175 VII expression medium level and HER3 of medium level.MDA-MB- simultaneously 175 VII cells are a part Heregulin α of endogenous excretion HER 3 and the cell line of dependence, so MDA-MB-175 VII The P-HER3 of cells express high levels, but P-HER2 (Richard M.Neve.Acollectionof breast are not expressed cancer cell lines for the study of functionally distinct cancer subtypes.CANCER CELL,2006:515-527.).MDA-MB-175 VII in exponential phase (is purchased from U.S.'s allusion quotation Type culture collection, accession number：HTB-25) cell 2 × 10⁴Cell per well (is purchased from Invitrogen in 100 μ l L-15 Company, article No.：11415-064) (Invitrogen companies, article No. are purchased from containing 10% hyclone：10099-141) in culture medium Cultivate to 96 well culture plates, 37 DEG C, cultivated 24 hours in air.GB235-019 antibody independent medication and combine use with Trastuzumab Medicine suppresses experiment.Independent medication group is separately added into GB235-019 antibody and Trastuzumab, work it is final concentration of (75,18.8,4.7, 1.2,0.29,0.07,0.018,0.005,0.0011,0 μ g/ml), while drug combination group adds above-mentioned each dosage GB235-019 antibody and Trastuzumab.37 DEG C, 5%CO₂In continue culture 6 days.Add AlamarBlue and (be purchased from Invitrogen Company, article No.：DAL1100 the cytoactives of MDA-MB-175 VII) are detected, in M5 multi-function microplate readers (Molecular Devices Company) on read fluorescent value under 544/590nm wavelength.

Figure 11 shows that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght suppresses the cells of MDA-MB-175 VII propagation and lived The experimental result of property.As a result show, GB235-019 antibody is administered alone the suppression that energy is faint in complete medium with Trastuzumab The cells of MDA-MB-175 VII are bred.GB235-019 antibody and Trastuzumab drug combination, hence it is evident that coordinate repression is added, and Show concentration dependent.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 16 is being cultivated the cells of breast cancer MCF 7 completely The influence of proliferation activity in base

The cells of breast cancer MCF 7 express the HER2 and high-level HER3 of reduced levels, but do not express P-HER2 and P-HER3 (Richard M.Neve.Acollectionof breast cancer cell lines for the study of functionally distinct cancer subtypes.CANCER CELL,2006:515-527.).Logarithm will be in give birth to Long-term MCF 7 (is purchased from American type culture collection, accession number：HTB-22) cell per well of cell 6000 is in RPMI 1640 (are purchased from Invitrogen companies, article No.：A10491) (Invitrogen companies, article No. are purchased from containing 10% hyclone： Culture is to 96 well culture plates in complete medium 10099-141), 37 DEG C, 5%CO₂Middle culture 24 hours.GB235-019 resists Body independent medication and with Trastuzumab drug combination suppress test.Independent medication group is separately added into GB235-019 antibody and Trastuzumab (final concentration of 75,18.8,4.7,1.2,0.29,0.07,0.018,0.005,0.0011, the 0 μ g/ml of work), while combine use Medicine group adds GB235-019 antibody and Trastuzumab (work final concentration is 75,18.8,4.7,1.2,0.29,0 μ g/ml).37 DEG C, 5%CO₂In continue culture 72 hours.Add AlamarBlue and (be purchased from Invitrogen companies, article No.：DAL1100) detect The cytoactives of MCF 7, read on M5 multi-function microplate readers (Molecular Devices companies) under 544/590nm wavelength glimmering Light value.

Heregulin α are added in complete medium and (are purchased from R＆D companies, article No.：Proliferative induction 296-HR) suppresses experiment In, in above-mentioned GB235-019 antibody independent medication and with after Trastuzumab drug combination processing 2 hours, it is final concentration of to add work 100ng/ml Heregulin α solution, set plus Heregulin α solution hole, 37 DEG C, 5%CO₂In continue culture 3 days. Add AlamarBlue and (be purchased from Invitrogen companies, article No.：DAL1100 the cytoactives of MCF 7) are detected, in M5 multifunctional enzymes On mark instrument (Molecular Devices companies) fluorescent value is read under 544/590nm wavelength.

Figure 12 A show that the anti-human HER2GB235-019 antibody in vitro of recombinant full-lenght is thin to suppressing MCF 7 in complete medium The experimental result of born of the same parents' proliferation activity.As a result show, Trastuzumab and GB235-019 antibody are administered alone in complete medium not The cells of MCF 7 propagation can be suppressed, Trastuzumab in complete medium, can not suppress MCF with the antibody combined administrations of GB235-019 7 cells are bred.

Figure 12 B show the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght in complete medium Heregulin α induce the experimental result of the cell-proliferation activities of MCF 7.As a result show, Heregulin is added in complete medium The faint propagation induction of the cells of MCF 7 of α, Heregulin α.Trastuzumab, which is administered alone, inhibits Heregulin α to MCF 7 The proliferative induction effect of cell, and concentration dependent is showed, GB235-019 antibody is administered alone no inhibitory action.And GB235-019 antibody and Trastuzumab administering drug combinations do not increase the inhibitory action of Trastuzumab.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 17 is trained to the cells of breast cancer MCF 7 in low serum The inhibitory action of Heregulin α induced growths in supporting

The cells of breast cancer MCF 7 express the HER2 and high-level HER3 of reduced levels, but do not express P-HER2 and P-HER3 (Richard M.Neve.Acollectionof breast cancer cell lines for the study of Functionally distinct cancer subtypes.CANCER CELL, 2006:515-527.).Logarithm will be in give birth to The long-term cells 1 × 10 of MCF 7⁴Cell per well (is purchased from Invitrogen companies, article No. in 100 μ l RPMI1640：A10491) (Invitrogen companies, article No. are purchased from containing 10% hyclone：10099-141) culture is cultivated to 96 holes in complete medium Plate, 37 DEG C, 5%CO₂Middle culture 24 hours.After sucking culture medium, the RPMI1640 cultures containing 0.1% hyclone are changed into per hole Base, starvation culture 24 hours.GB235-019 antibody independent medication suppresses experiment, sucks culture medium, adds GB235-019 antibody, Work final concentration of (the μ g/ml of 30,6.0,1.2,0.24,0.048,0.009 6,0.001 9,0.000 4,0).Drug combination presses down In system experiment, the GB235-019 antibody of above-mentioned each dosage, the above-mentioned each dosage of GB235-019 antibody respectively with 10ng/ml and The drug combination group of 100ng/ml Trastuzumab.37 DEG C, 5%CO₂After middle culture 2 hours, the final concentration of 100ng/ of work is added Ml Heregulin α solution (is purchased from R＆D companies, article No.：296-HR), set plus Heregulin α solution control wells, 37 DEG C, 5%CO₂In continue culture 72 hours.Add AlamarBlue and (be purchased from Invitrogen companies, article No.：DAL1100) detect The cytoactives of MCF 7, read on M5 multi-function microplate readers (Molecular Devices companies) under 544/590nm wavelength glimmering Light value, 100% is set to be not added with the control group of the cytoactive of Heregulin α inductions when cell growth multiple calculates.

Figure 13 A and Figure 13 B show that the anti-human HER2 antibody GB235-019 antibody in vitro of recombinant full-lenght is trained to low hyclone Support the experimental result of the Heregulin α inductions cell-proliferation activities of MCF 7 in base.As a result show, add in low hyclone culture medium Add Heregulin α, propagation of the Heregulin α induction of the cells of MCF 7.GB235-019 antibody, which is administered alone, to be inhibited Heregulin α induce the propagation of the cells of MCF 7, and show concentration dependent.GB235-019 antibody and 10ng/ml Trastuzumabs Administering drug combinations, collaboration inhibit the propagation of the Heregulin α induction cells of MCF 7.GB235-019 antibody and 100ng/ml He Sai Spit of fland administering drug combinations, collaboration inhibit the propagation of the Heregulin α induction cells of MCF 7, add maximum suppression effect.

The anti-human HER2GB235-019 antibody in vitro of the recombinant full-lenght of embodiment 18 is to the cell signallings of breast cancer MCF 7 Inhibitory action

The cells of breast cancer MCF 7 express the HER2 and high-level HER3 of reduced levels, but do not express P-HER2 and P-HER3. It has rated GB235-019 antibody independent medication or the HER3 signal paths activated with Trastuzumab drug combination to Heregulin α Inhibitory action.

By the cells 1.0 × 10 of MCF 7 in exponential phase⁵Cell per well (is purchased from Invitrogen in RPMI1640 Company, article No.：A10491) (Invitrogen companies, article No. are purchased from containing 10% hyclone：10099-141) complete medium Middle culture is cultivated 24 hours into 12 orifice plates.Second day, discard culture medium and change the low blood serum medium famine containing 0.1% tire serum into Starve culture 24 hours.The then RPMI-0.1% tire serum of the GB235-019 antibody containing 20 μ g/ml and 20 μ g/ml Trastuzumab The processing of culture medium independent medication or drug combination processing MCF 7 cells 6 hours, then add the final concentration of 100ng/ of work Ml Heregulin α (are purchased from R＆D companies, article No.：296-HR) induce 10 minutes.The blank pair for not adding Heregulin α is set According to hole.The PBS of 4 DEG C of precoolings washed once rear terminating reaction, and 120 μ l LDS of addition (are purchased from Invitrogen companies, article No.： NP0007), rapid collection cell pyrolysis liquid is placed on ice, and -80 DEG C save backup.

The cell pyrolysis liquid of collection is under final concentration of 50mM dithiothreitol (DTT) reducing condition, through Western-blot points Analysis detection antibody induces Heregulin α the influence of the cell HER3 phosphorylations of MCF 7, and to HER3 downstreams Akt and ERK1/2 The influence of phosphorylation.Western-blot methods are the same as embodiment 12.

Figure 14 shows the inhibitory action of the cell signallings of GB235-019 antibodies on breast cancer MCF 7.Figure 14 result It has been shown that, compares and is not added with Heregulin α control group, Heregulin α cause the up-regulation of the cell HER3 phosphorylations of MCF 7 to be made With.Each independent medication substantially inhibits Heregulin α to HER3 phosphoric acid in the cells of MCF 7 to GB235-019 antibody with Trastuzumab The up-regulation effect of change, compares and is administered alone, the drug combination of GB235-019 antibody and Trastuzumab, reverse completely Up-regulation effects of the Heregulin α to HER3 phosphorylations.Meanwhile GB235-019 antibody and Trastuzumab independent medication, hence it is evident that suppress Up-regulation effects of the Heregulin α to Akt phosphorylation, compares and is administered alone, GB235-019 antibody combines use with Trastuzumab Medicine has reversed up-regulation effects of the Heregulin α to Akt phosphorylation completely.GB235-019 antibody and Trastuzumab independent medication are obvious Up-regulation effects of the Heregulin α to ERK1/2 phosphorylations is inhibited, and GB235-019 antibody and Trastuzumab drug combination are complete Up-regulation effects of the Heregulin α to ERK1/2 phosphorylations is reversed.

HER3 acceptors in the breast cancer that HER2 is over-expressed HER2 mediate conversion and tumour progression and to HER2 press down In the acquired resistance of preparation for treating, vital effect is played.HER3 targeted inhibition agent is in the multiple of HER2 dependences Drug effect (the Joan T.Garrett.Dual Blockade of HER2in of HER2 acceptor inhibitors are added in breast cancer model HER2-Overexpressing Tumor Cells Does Not Completely Eliminate HER3Function.Clin Cancer Res 2013(19):610-619.).GB235-019 antibody is in low blood serum medium It is administered alone the proliferation activity for inhibiting the HER3 part Heregulin α induction cells of MCF 7, GB235-019 antibody and 10ng/ Ml Trastuzumabs drug combination can produce collaboration suppression Heregulin α induction MCF7 breast cancer cells and (express reduced levels HER2 and high-level HER3, but do not express P-HER2 and P-HER3) proliferation activity, GB235-019 antibody is conspicuous with 100ng/ml Match spit of fland drug combination can strengthen the maximum suppression effect that Trastuzumab suppresses the Heregulin α induction cell-proliferation activities of MCF 7. Meanwhile the drug combination in complete medium can suppress HER3 part Heregulin α and lures GB235-019 antibody with Trastuzumab Lead breast cancer SK-BR-3 cells (express high-caliber HER2 and the HER3 of medium level, at the same express high-caliber P-HER2 and The P-HER3 of medium level) proliferation function part, drug combination is not only in complete medium for GB235-019 antibody and Trastuzumab The HER3 part Heregulin α induced breast cancer BT-474 cells (HER2 and medium level of expression medium level can be suppressed HER3, while high-caliber P-HER2 is expressed, but do not express P-HER3) proliferation function part, and be simultaneously substantially suppressed to and be less than Level before Heregulin α inductions.GB235-019 antibody is administered alone in complete medium faint inhibits breast cancer The cells of MDA-MB-175 VII (HER2 of expression medium level and the HER3 of medium level, while the cells of MDA-MB-175 VII are one The individual part Heregulin of endogenous excretion HER 3 and dependence cell line, so the cells express high levels of MDA-MB-175 VII P-HER3, but do not express P-HER2) proliferation activity, GB235-019 antibody combines use with Trastuzumab in complete medium Medicine can completely inhibit the proliferation function of the cells of breast cancer MDA-MB-175 VII, and show concentration dependent.In signal path Research in, the μ g/ml of GB235-019 antibody 20 be administered alone part inhibits the part Heregulin α of HER 3 induce SK-BR-3 Cell HER3 phosphorylation, the μ g/ml of GB235-019 antibody 20 completely inhibit part with the μ g/ml drug combinations of Trastuzumab 20 The HER3 signal paths of Heregulin α activation.The μ g/ml of GB235-019 antibody 20, which are administered alone, substantially inhibits the parts of HER 3 Heregulin α induction BT-474 cells HER3 phosphorylation, the μ g/ml of GB235-019 antibody 20 combine with the μ g/ml of Trastuzumab 20 Medication also completely inhibit the HER3 signal paths of part Heregulin α activation.Equally, the μ g/ml of GB235-019 antibody 20 are mono- The solely obvious phosphorylation for inhibiting the part Heregulin α of HER 3 induction MCF 7 cell HER3 of administration, the μ of GB235-019 antibody 20 G/ml also completely inhibit the HER3 signal paths of part Heregulin α activation with the μ g/ml drug combinations of Trastuzumab 20.These As a result show, GB235-019 antibody is by suppressing HER-3 signal paths, with Trastuzumab drug combination in the high breasts expressed of HER2 Coordinate repression is played in adenocarcinoma cell.

Anti-human HER2GB235-019 antibody on human breast cancer (KPL-4) the cell mouse transplantable tumor of the recombinant full-lenght of embodiment 19 Growth inhibition effect

P-HER2 (the Werner Scheuer.Strongly Enhanced of human breast carcinoma KPL-4 cells express high levels Antitumor Activity of Trastuzumab and Pertuzumab Combination Treatment on HER2-Positive Human Xenograft Tumor Models.Cancer Res,2009(69):9330-9336.).Weight Growth inhibition effect (the experiment of group anti-human HER2GB235-019 antibody on human breast cancer (KPL-4) the cell mouse transplantable tumor of total length Nanjing Genscript Biotechnology Co., Ltd. is entrusted to complete, contract number:GRBI-2013-057).Amplification cultivation KPL-4 cells (south Jing Jinsirui bio tech ltd preserves), by 5 × 10⁶(cell suspension and Matrigel are (public purchased from BD for a cell/mouse Department) volume ratio be 1:1) it is second from the bottom that 38 SCID Beige mouse (purchased from Beijing dimension tonneau China) right side of body is seeded to respectively Under being padded to breast.When gross tumor volume reaches 100-200mm³When, choose 24 mouse according to gross tumor volume size and body weight and divide at random For 4 groups, every group of 6 animals.

Trastuzumab group (30mg/kg Trastuzumabs), GB235-019 antibodyomes (30mg/kg GB235-019 antibody), joint are used Medicine group (30mg/kg Trastuzumab+30mg/kg GB235-019 antibody) and blank control group (PBS), all drug administration approach are Intraperitoneal injection, weekly, is administered surrounding altogether.Gross tumor volume is measured twice a week and carries out weighing mouse weight.

Such as Figure 15, Trastuzumab 30mg/kg independent medications can partly suppress the growth of KPL-4 tumours；GB235-019 antibody 30mg/kg independent medications can not suppress the growth of KPL-4 tumours；GB235-019 antibody 30mg/kg and Trastuzumab 30mg/kg joins The growth that medicine completely inhibit KPL-4 tumours is shared, significantly collaboration is embodied and suppresses the effect of KPL-4 tumour growths.

The P-HER2 of KPL-4 cells express high levels, but drug-resistant effect is shown to the Trastuzumab of low dosage.Trastuzumab 30mg/kg independent medications can substantially suppress the growth of KPL-4 tumours, but GB235-019 antibody 30mg/kg and Trastuzumab 30mg/kg drug combinations completely inhibit the growth of KPL-4 tumours, and the suppression that illustrating GB235-019 antibody has different mechanism is made With with reference to above GB235-019 antibody in vitro cytology research data, GB235-019 antibody can suppress HER-3 signals and lead to Road.By suppressing HER-3 signal paths, drug combination can cooperate with suppression swollen to prompting GB235-019 antibody in vivo with Trastuzumab The growth of knurl.

Claims (15)

1. a kind of HER2 antibody in full people source, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:1, light chain variable district Amino acid sequence be SEQ ID NO:2.

2. the full people source HER2 antibody of claim 1, it is Fab, Fab ', F (ab ')₂, Fv or scFv form.

3. the full people source HER2 antibody of claim 1, include the heavy chain constant region and constant region of light chain of human IgG.

4. the full people source HER2 antibody of claim 3, wherein the human IgG is IgG1.

5. the full people source HER2 antibody of claim 4, wherein the amino acid sequence of the human IgG heavy chain constant region is SEQ ID NO:5, the amino acid sequence of the human IgG constant region of light chain is SEQ ID NO:6.

6. encode the nucleotide sequence of the full people source HER2 antibody of claim 1.

7. the nucleotide sequence of the full people source HER2 antibody of coding of claim 6, wherein in the nucleotide sequence, encodes institute The nucleotides sequence for stating weight chain variable district is classified as SEQ ID NO:3, the nucleotides sequence for encoding the light chain variable district is classified as SEQ ID NO:4。

8. the nucleotide sequence of the full people source HER2 antibody of coding of claim 6, wherein when the full people source HRE2 antibody includes When heavy chain constant region and constant region of light chain, the nucleotides sequence for encoding the heavy chain constant region is classified as SEQ ID NO:7, described in coding The nucleotides sequence of constant region of light chain is classified as SEQ ID NO:8.

9. a kind of expression vector of the nucleotide sequence comprising claim 6, the nucleotide sequence and the expression vector Expression control sequence is operably connected.

10. the expression vector of claim 9, wherein the expression vector is pGEM-T carriers or 293 carriers.

11. a kind of pharmaceutical composition, it includes full the people source HER2 antibody and pharmaceutical acceptable carrier of claim 1.

12. a kind of combination medicine, it includes the full people source HER2 antibody of claim 1 and other HER2 positive tumor therapeutic agents, Other described HER2 positive tumors therapeutic agents are Trastuzumab or the appropriate pearl of pa.

13. a kind of kit for detecting people HER2, it includes the full people source HER2 antibody of claim 1 or 2.

14. the full people source HER2 antibody of claim 1 is used to prepare the positive breast cancer of the HER2 being used to treat in subject The purposes of medicine.

15. the purposes of claim 14, wherein the subject is the people with breast cancer positive HER2.