CN104650228B - A kind of full people source HER2 antibody, its encoding gene and application - Google Patents

Abstract

The present invention relates to medicinal chemistry art, and in particular to a kind of full people source HER2 antibody, its encoding gene and application.The invention provides a kind of full people source HER2 antibody, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:1, the amino acid sequence of light chain variable district is SEQ ID NO:2.Full people source HER2 antibody can reduce infusion reaction and immunogenicity, improve drug safety, have more preferable pharmacokinetic characteristic.

Description

A kind of full people source HER2 antibody, its encoding gene and application

Technical field

The present invention relates to antibody technique field, and in particular to a kind of full people source HER2 antibody, its encoding gene and application.

Background technology

HER2/neu (Human Epidermal Growth Factor Receptor 2, human epidermal growth factor acceptor 2), also known as erbB-2, it is one of growth factor receptors family member.This receptor albumen is generally only expressed in fetal period, adult The later only low expression level in only a few normal structure, but (such as breast cancer, stomach cancer, ovum in a variety of mankind tumor tissues Nest cancer, lung cancer, Primary Renal Cell Carcinoma, carcinoma of endometrium etc.) but over-express, and prompt prognosis mala.HER2/neu mistake Degree expression can cause the formation of tumour cell hyper-proliferative and new vessels, cause tumour high relapse rate, the high rate of transform and height dead Die rate.Research shows that HER2/neu overexpression is appeared in about 30% breast cancer and 16% patients with gastric cancer, is breast The indication of adenocarcinoma patients' poor prognosis, while also played an important role on the generation in stomach cancer, development and invasion/metastatic.

Monoclonal antibody drug treatment for HER2/neu target spots is to be treated after performing the operation with more effective after Radiotherapy chemotherapy Means.Trastuzumab (Herceptin) be Genentech companies of the U.S. (Xian Shu Roche companies) develop, in 1998 listing with HER2/neu is the Antagonism Humanized monoclonal antibodies medicine of target spot, be approved for the high expression of HER2/neu breast cancer and The treatment of stomach cancer.The antibody inhibits HER2/neu information transmission activity, so as to block downstream signal transduction, causes cancer thin The suppression that born of the same parents' arrest proliferation and new vessels are formed.Trastuzumab shares as fiest-tire medication in Mammary cancer with chemotherapy to be faced In bed it is proved that patient's life span extension can be made, and recurrence rate is declined 50%.

The molecule pharmacological mechanism of Trastuzumab be typically considered by suppress HER2 phosphorylations, block cell generation cycle, Accelerate the common knot of the effector effect (such as antibody-mediated killing functions of immunocytes, ADCC) of receptor internalisation and antibody Fc section induction Fruit.

Although considerable HER2 positive breast cancers patient has well in the initial period that Trastuzumab is treated to antibody drug Reaction, but final disease can also be in progress and deteriorate, and have about 70% case invalid to Trastuzumab treatment and produce status of drug resistance.Cause This, seeks the problem of more efficiently anti-HER2/neu antibody is current clinical in the urgent need to address.

The resistance mechanism of Trastuzumab is not fully understood at present, is had HER2 acceptor signals below transmission path abnormal, is such as held The PI3K approach of continuous activation, phosphorylation PTEN are ineffective etc..For that can suppress caused by epitope different on HER2 molecules HER2 and HER3 forms the monoclonal antibody handkerchief trastuzumab (Pertuzumab) and Trastuzumab use in conjunction of heterologous dimer, It is proved that its extension to patient's life cycle plays the role of more obvious compared with alone Trastuzumab in nearest clinical trial, Illustrate that antibody can produce the Antagonizing different from Trastuzumab by the binding site beyond Trastuzumab epitope, so that and He Sai Spit of fland produces addition or cooperative effect.T-DM1 is immune antiboidy conjugate (antibody-drug conjugate, ADC), be by High-titer cytotoxin DM1 and monoclonal antibody Herceptin (Trastuzumab, i.e. Trastuzumab) by Covalent bonding together, Using the acceptor endocytosis after antibody binding HER2, toxin is brought into HER2 positive tumour cells, so as to play to tumour The lethal effect of cell.In Trastuzumab and the HER2 positive late periods of chemotherapy or metastatic breast cancer patient was received before, with Standard care is used in combination, and T-DM1 can significantly extend progression free survival phase.The clinical laboratory data shows, utilizes HER2 antibody To the specific immune reactivity of HER2 positive tumor cells, carry cytotoxin and enter cancer cell, it may be possible to overcome Trastuzumab medicine Imitate the effective way of deficiency.Preclinical laboratory also shows, the Herceptin for removing fucose prepared using cell engineering method, By the combination of Fc acceptors on reinforcement and effector cell, stronger antibody-mediated killing functions of immunocytes is obtained, in correlation The effect of the suppression tumour more stronger than Trastuzumab is illustrated in animal model.The research result is prompted, and is strengthened antibody-mediated Killing functions of immunocytes, it is also possible to optimize one of possible approaches of Anti-HER 2.

Trastuzumab is the antibody medicine product of humanization, is restricted by technology development.Patient produces after receiving Antybody therapy Anti- medicine antibody, it may be possible to one of mechanism of antibody resistance.The clinical common side effect of humanized antibody is infusion reaction.Gao Rong Human antibody single chain variable fragment (scFv) phage display library is measured, is in recent ten years by international major bio-pharmaceuticals Company utilizes one of platform to screen human antibody.Past for over ten years, has and screens to obtain high-affinity using this article storehouse The precedent (adalimumab (Humira) of such as Abbott companies) and rich experiences of human antibody.Human antibody can reduce Infusion reaction and immunogenicity, drug safety is improved, there are more preferable Pharmacokinetic Characteristics.

The content of the invention

The invention provides a kind of HER2 antibody in full people source, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:1, the amino acid sequence of light chain variable district is SEQ ID NO:2.

The present invention full people source HER2 antibody, it is Fab, Fab ', F (ab ')₂, Fv or scFv form.The Fab, Fab’、F(ab’)₂, Fv or scFv there is the implication that this area usually understands.

The full people source HER2 antibody of the present invention, the heavy chain constant region and constant region of light chain of human IgG can also be included.At one In specific embodiment, the human IgG is IgG1.In a specific embodiment, the human IgG heavy chain constant region Amino acid sequence is SEQ ID NO:5, the amino acid sequence of the human IgG constant region of light chain is SEQ ID NO:6.

The invention provides the nucleotide sequence of the full people source HER2 antibody of the coding present invention.

In a specific embodiment, the nucleotides sequence for encoding the weight chain variable district is classified as SEQ ID NO:3, compile The nucleotides sequence of the code light chain variable district is classified as SEQ ID NO:4.In a specific embodiment, when the present invention it is complete When people source HER2 antibody is full length antibody, in the nucleotide sequence of the present invention, the nucleotides sequence of the heavy chain constant region is encoded It is classified as SEQ ID NO:7, the nucleotides sequence for encoding the constant region of light chain is classified as SEQ ID NO:8.

The invention provides a kind of expression vector, wherein the expression control sequence of the nucleotide sequence of the present invention and expression vector Row are operably connected.In specific embodiments, the expression vector is pGEM-T carriers or 293 carriers.

The invention provides a kind of cell, and it includes the expression vector of the present invention.The cell can be protokaryon or eucaryon 's.In specific embodiments, the cell can be with mammalian cell, such as FreeStyle 293F cells.

The invention provides a kind of pharmaceutical composition, and it includes full the people source HER2 antibody and pharmaceutical acceptable carrier of the present invention.

In addition inventor also found, full people source HER2 antibody of the invention is different from the mechanism of action of Trastuzumab, therefore this The full people source HER2 antibody of invention can be used for Trastuzumab resistance or to the unresponsive patient of Trastuzumab.

The invention provides a kind of combination medicine, and it includes full the people source HER2 antibody and Trastuzumab of the present invention.

The invention provides a kind of kit, and it includes the full people source HER2 antibody of the present invention.The kit can be used for Detect the HER2 albumen in sample.The kit can also include other usual components in this area detection HER2 kits.

It is used to prepare the HER2 sun being used to treat in subject present invention also offers the full people source HER2 antibody of the present invention The purposes of the medicine of property tumour.

" the HER2 positive tumors " refers to if IHC (Immunohistochemical Method) inspection result is 3 plus siges (+++), i.e. big Complete strong coloring is presented in the after birth of 30% tumour cell, indicates that as the HER2 positives；If 2 plus siges (++), i.e. At least 10% tumour cell presents weak to the complete after birth dyeing of moderate, then is further FISH (fluorescence in situ hybridization) Or CISH (colour developing hybridization in situ) is checked, if result is positive (producer amplification), it is possible to be diagnosed as the HER2 positives. Preferably, HER2 positive tumors testing result is the detection kit using the certification of food and medicine supervision and management general bureau of China The result that (IHC, FISH and CISH detection kit) obtains.How medical practitioner is known judges whether tumour is HER2 positive swollen Knurl.

The tumour positive HER2 is selected from the positive breast cancer of HER2, stomach cancer, lung cancer, non-small cell lung cancer, osteocarcinoma, pancreas Gland cancer, cutaneum carcinoma, head or neck cancer, skin or intraocular melanoma, uterine cancer, oophoroma, the carcinoma of the rectum, anal region cancer, colon cancer, son Palace cancer, carcinoma of fallopian tube, carcinoma of endometrium, cervical carcinoma, carcinoma of vagina, carcinoma of vulva, Hodgkin's disease, cancer of the esophagus, carcinoma of small intestine, endocrine system Unite cancer, thyroid cancer, parathyroid carcinoma, adrenal, soft tissue cancer, carcinoma of urethra, carcinoma of penis, prostate cancer, carcinoma of urinary bladder, kidney or Carcinoma of urethra, clear-cell carcinoma, carcinoma of renal pelvis, celiothelioma, hepatocellular carcinoma, gallbladder cancer, chronic or acute leukemia, lymphocyte lymph Knurl, central nervous system (CNS) cancer, tumor of spine, brain stem glioma, glioblastoma multiforme (glioblastoma multiforme), astrocytoma, neurinoma, ependymoma, medulloblastoma, meningioma, Squamous cytoma, pituitary adenoma.

Preferably, the subject is people.

Preferably, the subject is to Trastuzumab resistance or to the unresponsive people of Trastuzumab.

Brief description of the drawings

Figure 1A shows the structure of the anti-human HER2 antibody GB235-094 heavy chain expression vectors (293-VH-CH) of recombinant full-lenght Schematic diagram；Figure 1B shows that the structure of the anti-human HER2 antibody GB235-094 light chain expression vectors (293-VL-CL) of recombinant full-lenght is shown It is intended to.With PCR method, the letter containing 5 ' end EcoRI restriction enzyme sites is obtained respectively using corresponding template and primer (detailed in Example 5) Number peptide (Signal Peptide), weight chain variable district (VH), the heavy chain of terminator codon containing TGA and 3 ' end BamH I restriction enzyme sites Constant region (CH) genetic fragment, and coupled three sections with over-lapping PCR methods, obtain the heavy chain of GB235-094 antibody Full-length gene fragment.GB235-094 antibody is obtained in the same way containing signal peptide (Signal Peptide), light chain variable district (VL) and constant region of light chain (CL) light chain full-length gene fragment.The cohesive end point formed using EcoR I and BamH I digestions Heavy chain and light chain full-length gene fragment pGEM-T carriers are not cloned into.

Fig. 2 shows the anti-human HER2 antibody GB235-094 of recombinant full-lenght SDS-PAGE electrophoresis result figures.Purifying is obtained GB235-094 antibody and Trastuzumab control sample under 50mM dithiothreitol (DTT) reducing conditions through 10% polyacrylamide gel Electrophoresis parses, and as a result shows that two bands that molecular weight is 50KDa and 25KDa are presented in GB235-094 antibody and Trastuzumab, respectively For the heavy chain and light chain of antibody.

Fig. 3 shows the combination result figure of the anti-human HER2 antibody GB235-094 of recombinant full-lenght and people's HER2 antigens.With restructuring People's HER2 antigen coat elisa plates, with the GB235-094 antibody and Trastuzumab of various concentrations and the antigen molecule being coated on plate With reference to, and the antibody combined with the goat anti-human igg Fc TPPAs of HRP marks.As a result display is as Trastuzumab, GB235- 094 antibody can be combined in people HER2, and show concentration dependent and saturability.

Fig. 4 A show the combination result figure of the anti-human HER2 antibody GB235-094 of recombinant full-lenght and monkey HER2 antigens.With weight Group monkey HER2 antigen coat elisa plates, with the GB235-094 antibody and Trastuzumab of various concentrations and the antigen being coated on plate point Son combines, and the antibody combined with the goat anti-human igg Fc TPPAs of HRP marks.As a result show as Trastuzumab, GB235-094 antibody can be combined in monkey HER2, and show concentration dependent and saturability.

Fig. 4 B show that the anti-human HER2 antibody GB235-094 of recombinant full-lenght lacks immunoreactivity with mouse HER2 antigens. While GB235-094 antibody is determined with monkey HER2 immunoreactivities with ELISA, with recombined small-mouse HER2 antigen coats Elisa plate, combined with the antigen molecule being coated on plate with the GB235-094 antibody and Trastuzumab of various concentrations, and marked with HRP The antibody that the goat anti-human igg Fc TPPAs of note combine.As a result Trastuzumab and mouse HER2 no cross reactions are shown, and GB235-094 antibody can be combined in mouse HER2 under 10 μ g/mL concentration conditions.

Fig. 5 show the anti-human HER2 antibody GB235-094 of recombinant full-lenght and the other member people HER1, HER3 of people HER families, HER4 Binding experiment result figure.Elisa plate is coated with recombined human HER1, HER2, HER3 and HER4 antigen respectively, with GB235- 094 antibody and Trastuzumab (being 10 μ g/mL) are combined with the antigen molecule being coated on plate, and the goat anti-human igg marked with HRP The antibody that Fc TPPAs combine.As a result display is as Trastuzumab, and GB235-094 antibody can be combined in the HER2 of people, with it He does not have immunoreactivity by HER family member's molecules.

Fig. 6 shows the anti-human HER2 antibody GB235-094 of recombinant full-lenght and Trastuzumab epitope competition result figure.With ELISA method, with recombined human HER2 antigen coat elisa plates, with the GB235-094 antibody and Trastuzumab of various concentrations respectively with The Trastuzumab (0.005 μ g/mL fixed concentrations) of biotin labeling is jointly after incubation at room temperature 2 hours and the coated hardened conjunctions of HER2, And the antibody combined is detected with the anti-biotin antibodies of HRP marks.As a result show, with the increase of Trastuzumab concentration, biotin labeling Combination of the Trastuzumab on HER2 be suppressed.Under the maximum concentration (10 μ g/mL) that experiment is related to, GB235-094 antibody Be combined with part of the biotin labeling Trastuzumab on HER2 is suppressed.

Fig. 7 shows the anti-human HER2 antibody GB235-094 of recombinant full-lenght and BT-474 cells binding curve result figure.Will The HER2 for expressing medium level and express high-caliber P-HER2 BT-474 breast cancer cells in the U-shaped board of 96- holes respectively with The GB235-094 antibody and Trastuzumab of various concentrations are incubated, after abundant washing, with goat-anti people's Fc antibody tests of HRP marks Binding antibody.As a result show, GB235-094 antibody can be combined in expression HER2 cell surface as Trastuzumab, and present Go out concentration dependent and saturability, prompt GB235-094 antibody to have high selectivity to HER2.

Fig. 8 A show that the anti-human HER2 antibody GB235-094 of recombinant full-lenght suppresses the reality of BT-474 cell-proliferation activities in vitro Test result.By the BT-474 breast cancer cells of the high expression of HER2 in the U-shaped board of 96- holes the GB235- with 4 and 20 μ g/mL respectively 094 antibody and Trastuzumab use Alarmar Blue measure cytoactives after being incubated 72 hours.As a result show, two antibody are at two kinds It can substantially suppress BT-474 cells propagation under concentration, and two concentration inhibitory action are suitable.

Fig. 8 B show that the anti-human HER2 antibody GB235-094 of recombinant full-lenght suppresses the amount of BT-474 cell-proliferation activities in vitro Effect relation.The HER2 for expressing medium level and the BT-474 breast cancer cells for expressing high-caliber P-HER2 is flat in 96- holes It is thin with Alarmar Blue measure after being incubated 72 hours with 2 and 10 μ g/mL GB235-094 antibody and Trastuzumab respectively in template Cytoactive.As a result show, GB235-094 antibody and Trastuzumab show concentration dependant to the Proliferation Ability of BT-474 cells Property, the inhibitory action of GB235-094 antibody is slightly weaker than Trastuzumab.

Fig. 9 show the anti-human HER2 antibody GB235-094 of recombinant full-lenght suppress in vitro BT-474 cells propagation activity can Overturn by soluble human HER2 antigens.The HER2 of medium level will be expressed and express high-caliber P-HER2 BT-474 breast cancer GB235-094 antibody and Trastuzumab of the cell respectively with various concentrations in the flat underside of 96- holes are incubated 72 hours, or in each antibody 100 μ g/mL recombined human HER2 antigens are added under concentration conditions, and are incubated 72 hours, are lived with Alarmar Blue measure cells Property.As a result show, compared with blank control, can substantially suppress BT-474 cells propagation under two kinds of concentration in two antibody, And two concentration inhibitory action are suitable.Under conditions of it soluble human HER2 antigens be present, high concentration antibody cell proliferation Inhibitory action part is reversed, and the effect of low concentration antibody on cell propagation is reversed completely, prompts antibodies on tumor cell to increase The inhibitory action grown is HER2 specific.

Figure 10 A, Figure 10 B, Figure 10 C respectively illustrate the anti-human HER2 antibody GB235-094 interaction in vitro BT- of recombinant full-lenght 474 cells 2 hours, 24 hours, P-HER2, P-Akt, P-ERK1/2 protein expression result figure after 72 hours.It will express medium Horizontal HER2 and express high-caliber P-HER2 breast cancer cell BT-474 in containing 10% hyclone culture medium with 2 and 20 μ g/mL Trastuzumabs and GB235-094 antibody incubations, and sampled respectively at 2,24 and 72 hours.Done with cell pyrolysis liquid immune Trace, HER2, ERK1/2 and Akt of whole and phosphorylation are separately detected with corresponding antibodies.Figure 10 A result is shown, in antibody Act on 2 it is small in the case of, compared with control group, 20 μ g/ml and 2 μ g/ml Trastuzumab can cause P-HER2's and P-Akt Lower, and downward effect unobvious of the GB235-094 antibody to P-Akt, there is slight up-regulation effect to P-HER2.Figure 10 B's As a result show, under the action condition of 24 hours, downward effect of the Trastuzumab to P-HER2 and P-Akt is consistent with 2 hours, and GB235-094 antibody has up-regulation effect to P-HER2, but to P-Akt without obvious effect.Figure 10 C result is shown, in effect 72 Under conditions of hour, 20 μ g/ml and 2 μ g/ml Trastuzumab P-HER2, P-Akt and P-ERK1/2 are generated it is obvious under Tune acts on.And GB235-094 antibody is not acted on significantly P-Akt, there is obvious up-regulation to act on to P-HER2, either exist 20 μ g/ml or 2 μ g/ml, the downward effect to P-ERK1/2 are all apparent.

Embodiment

Term " antibody " used herein is can be by least one antigen recognition site, and target molecule is (including sugar, more Polynucleic acid, lipid, polypeptide etc.) specific bond immunoglobulin.Complete antibody is by two identical light chains (L) and two phases Same heavy chain (H) composition.Every light chain is connected by a covalent disulfide bonds with heavy chain, and different Immunoglobulin Isotypes Disulfide bond number between heavy chain is different.The intrachain disulfide bond at every heavy chain and light chain also regular interval.One end of every heavy chain There is variable region (VH), be followed by multiple constant regions.There is variable region (VL) one end of every light chain, and the other end has constant region；Light chain Constant region and heavy chain first constant region it is relative, the variable region of light chain and the variable region of heavy chain are relative.Special amino acid Residue forms interface between the variable region of the heavy chain of light chain.

Term " variable region " used herein represents that some parts of variable region in antibody are different in sequence, its shape The combination to its specific antigen and specificity into various specific antibodies.However, changeability and being unevenly distributed over entirely may be used Become in area.It, which is concentrated in light chain and weight chain variable district, is referred to as in three fragments in complementary determining region (CDR) or hypervariable region.Can Become the more conservative part in area and be referred to as framework region (FR).Each include four FR areas in the variable region of native heavy and light chain, they Generally it is in beta sheet configuration, is connected by three CDR regions for forming connection ring, part β-pleated sheet knot can be formed in some cases Structure.CDR in every chain is by FR areas firmly against the antigen-binding portion for forming antibody together and together with the CDR of another chain (referring to Kabat etc., NIH Publ.No.91-3242, roll up I, 647-669 pages (1991) in position.Constant region directly participate in antibody with The combination of antigen, but they show different effector functions, such as participate in the cytotoxicity dependent on antibody of antibody.

" light chain " of vertebrate antibodies (immunoglobulin) can be classified as substantially not according to the amino acid sequence of its constant region One kind in same two classes (being referred to as κ and λ).According to the amino acid sequence of its heavy chain constant region, immunoglobulin can be divided into not Same species, mainly there is 5 immunoglobulin like protein：IgA, IgD, IgE, IgG and IgM, some of them can also be further divided into subclass (same type), such as IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2.Distinguish corresponding to different immunoglobulin heavy chain constant regions Referred to as α, β, ε, μ, γ.The subunit structure and 3-d modelling of different immunoglobulins are well-known.

" human antibody " used herein refers to the antibody of the antibody gene origin mankind.

Herein, so-called " antibody " not only includes complete polyclonal or monoclonal antibody, also including various antibody pieces Section (such as Fab, Fab ', F (ab ')₂, Fv), single-chain antibody (scFv), the multi-specificity antibody formed by antibody fragment, containing anti- The fusion protein of body fragment, and it is any by transforming but including the immunoglobulin molecules of required specific recognition site.It is anti- The source of body or preparation method are not restricted by, such as pass through hybridoma, phage selection, recombination expression, transgenic animals Deng.

The present invention is described in further detail below in conjunction with embodiment, however, it is to be appreciated that enumerating these embodiments only It is in order to illustrate the present invention, rather than for limiting the present invention.The concentration not specialized in the following example is quality percentage Specific concentration；The experimental method of unreceipted actual conditions, generally according to normal condition, such as Sambrook et al.,《Molecular cloning is real Test guide》(New York：Cold Spring Harbor LaboratoryPress, 1989) condition described in, or according to Condition proposed by manufacturer.It is common commercially available product that the solvent in source and reagent are not specified in the present invention.

Embodiment 1 screens scFv positive colony from Quan Renyuan scFv phage libraries

People HER2 (extracellular domain)-Fc fusion proteins (hereinafter referred to as hHER2-Fc) antigen is (public purchased from Sino Biological Department, article No.：10004-H02H) use phosphate buffer PBS (0.01M Na₂HPO₄·12H₂O+0.002M KH₂PO₄+0.14M NaCl+0.002M KCl, pH=8.6) 5 μ g/ml are diluted to, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight. 5%BSA (bovine serum albumin(BSA), article No. are added after PBST the PBS of 0.05% polysorbas20 (contain) board-washing 4 times：A7030, purchase From Sigma companies) 300 μ l/ holes, 37 DEG C are closed 1 hour.PBST board-washings are used again 2 times.7 × 10 will be contained¹⁰Individual independent cloning it is complete (this antibody library is by (Beijing) Bioisystech Co., Ltd of You Rui sections with multiple Healthy People lymphs for people source scFv phage antibody libraries The antibody variable gene of cell and the artificial synthesized heavy chain CDR3 assortments of genes are built-up) suspension add according to 100 μ l/ holes Enter in ELISA Plate, be incubated 2 hours under the conditions of 37 DEG C.Phage suspensions are suctioned out, PBST is added and fully blows and beats 5 minutes.First Take turns in panning process, PBST is blown and beaten one time, and in the second wheel and third round elutriation, PBST carries out five time and ten times and blown respectively Beat, to remove nonspecific combination.0.2M glycine-HCIs (pH=2.2) eluent containing 0.1%BSA is added, room temperature is incubated After educating 10 minutes, fully blow and beat, elute the bacteriophage of positive colony.By the phage suspensions 1M of the positive colony under eluting Tris-HCL (pH=9.1) buffer solution is neutralized to neutrality, and the Escherichia coli for infecting logarithmic phase (are purchased from Lucigen companies, article No.： 60502-1) and expand, for next round elutriation (first and second wheel).During third round elutriation, eluent need to be subjected to gradient dilution And logarithmic phase Host Strains are infected, monoclonal is isolated on the LB agar plates with ammonia benzyl (Amp) resistance, for monoclonal Identification and plasmid preserve.

Enzyme linked immunosorbent assay (ELISA) identification of embodiment 2scFv bacteriophage positive colonies

HHER2-Fc antigens are diluted to 2 μ g/ml with PBS (pH=8.6), are added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of bags Stayed overnight.The μ l/ holes of 5%BSA 300 are added after PBST board-washings 4 times, 37 DEG C are closed 1 hour.PBST board-washings are used again 2 times, add 100 μ l/ holes bacteriophage positive colony suspension, it is incubated 2 hours under the conditions of 37 DEG C.PBST board-washings 4 times, add HRP (horseradish peroxidating Thing enzyme) mark anti-M13 phage antibodies (be purchased from GE companies, article No.：27-9421-01, PBST press 1:5000 dilutions, 100 μ l/ Hole), it is incubated at room temperature 1 hour.PBST board-washings 4 times, adding 100 μ l/ holes nitrite ions, (soluble type one pack system tmb substrate solution, is purchased from Tiangen companies, article No.：PA107-01), it is incubated at room temperature 15 minutes and develops the color, 50 μ l/ holes terminate liquids (1M sulfuric acid) is added, more On function ELIASA (Model 680Micro reader, purchased from Bio-Rad companies) light absorption value is read under 450/630nm wavelength.

As a result show, screened by three-wheel, obtain 1312 kinds of full people source scFv altogether, can be with hHER2-Fc antigentic specificity knots The scFv bacteriophage positive colonies of conjunction have 499 kinds.Through DNA sequencing, there is 102 kinds of nucleotides/amino acid sequence in these positive colonies Arrange the scFv (as shown in table 1) differed.

Table 1.

Embodiment 3ELISA methods detect 102 scFv bacteriophages positive colonies and monkey HER2-Fc (hereinafter referred to as mkHER2- Fc, purchased from Sino Biological companies, article No.：90295-C02H), mouse HER2-Fc (hereinafter referred to as moHER2-Fc, purchase From Sino Biological companies, article No.：50714-M02H), people HER1-Fc (hereinafter referred to as hHER1-Fc, purchased from Sino Biological companies, article No.：10001-H02H), people HER3-Fc (hereinafter referred to as hHER3-Fc, purchased from Sino Biological companies, article No.：10201-H05H) and people HER4-Fc (hereinafter referred to as hHER4-Fc, purchased from Sino Biological companies, article No.：10363-H02H) the cross reaction of antigen.

Method with embodiment 2, only by coated hHER2-Fc antigens change into respectively mkHER2-Fc, moHER2-Fc, HHER1-Fc, hHER3-Fc and hHER4-Fc antigen.

As a result show, the positive colony and mkHER2-Fc antigens for there are 96 scFv bacteriophages have cross reaction, there are 20 The positive colonies of scFv bacteriophages and moHER2-Fc antigens have a cross reaction, all 102 positive colonies and hHER1-Fc, The equal no cross reaction of hHER3-Fc and hHER4-Fc antigens (as shown in table 2).

Table 2

The affinity sequence (ELISA method) of 4102 scFv bacteriophage positive colonies of embodiment

By hHER2 antigens PBS since 25 μ g/ml ten doubling dilutions totally 8 gradients, respectively with positive colony Phage suspensions incubation at room temperature 4 hours with reach balance；Resulting mixed liquor is added in advance with 2 μ g/mlhHER2- Fc antigens (pH=8.6PBS, 4 DEG C overnight, 100 μ l/ holes) coated ELISA Plate, to combine scFv antibody at large.Add The anti-M13 phage antibodies (1 of HRP marks:5000 dilutions, 100 μ l/ holes), detected in method same as Example 2.With half Number inhibition concentration IC₅₀Value is ranked up (IC to the affinity of 102 positive colonies₅₀Value is lower, and affinity is higher).

The result of table 3 shows the IC50 Distribution value scopes of 102 scFv bacteriophage positive colonies.

Table 3.

IC50(nM)	≤2.0	2.0-10.0	10.0-100.0	＞ 100.0	Do not measure
						Clone number	4	21	37	25	15

The structure of the carrier for expression of eukaryon of the GB235-094 recombinant full-lenght IgG1 type antibody of embodiment 5

In obtained positive colony is screened from Quan Renyuan scFv phage libraries, based on being named as the single-stranded of WG1-094 Antibody positive clones (IC₅₀For 0.768 μ g/ml) structure GB235-094 recombinant full-lenght IgG1 type antibody carrier for expression of eukaryon. (single-chain antibody positive colony scFv nucleotides sequence is classified as SEQ ID NO for the sequencing of WG1-094 single-chain antibody positive colonies: 22, its amino acid sequence is SEQ ID NO:23).As a result show, the weight chain variable district of the single-chain antibody and light chain variable district Nucleotide sequence is respectively SEQ ID NO:3 and SEQ ID NO:4.

Signal peptide amino acid sequence is (SEQ ID NO:9)：MELGLSWIFLLAILKGVQC；Nucleotide sequence (SEQ ID NO:10) it is：

ATGGAGTTGGGACTGTCTTGGATTTTCCTGTTGGCTATTCTGAAAGGTGTGCAGTGT(by Shanghai JaRa Bioengineering Co., Ltd synthesizes)。

Heavy chain and chain constant region nucleotide sequence are respectively SEQ ID NO:7 and SEQ ID NO:8 (are given birth to by Shanghai JaRa Thing Engineering Co., Ltd synthesizes).

Design primer is used for the carrier for expression of eukaryon for building GB235-094 recombinant full-lenghts IgG1 types heavy chain of antibody and light chain, Primer sequence is as follows：

1-1(SEQ ID NO:11):5’-GAATTCGCGGCCGCATGGAGTTGGGACTG-3’

1-2(SEQ ID NO:12)：5’-GCACCAGCTGGACCTC ACACTGCACACCTTTC-3’

2-1(SEQ ID NO:13)：5’-GAAAGGTGTGCAGTGTGAGGTCCAGCTGGTGC-3’

2-2(SEQ ID NO:14)：

5’-GATGGGCCCTTGGTGGAGGCTGAGGAGACGGTCAC-3’

3-1(SEQ ID NO:15)：5’-ACCGTCTCCTCAGCCTCCACCAAGGGCCCATC-3’

3-2( SEQ ID NO:16)：

5’-GTTTAAACGGATCCTCATTTACCGGGAGACAGGGAG-3’

4-1(SEQ ID NO:17)：5’-CTGAGTCACCACAGTCTGACACTGCACACCTTTC-3’

5-1( SEQ ID NO:18)：5’-GAAAGGTGTGCAGTGTCAGACTGTGGTGACTCAG-3’

5-2(SEQ ID NO:19)：

5’-GATGGTGCAGCCACAGTACCTAGGACGGTCAGCTTG-3’

6-1(SEQ ID NO:20)：5’-ACCGTCCTAGGTACTGTGGCTGCACCATC-3’

6-2(SEQ ID NO:21)：5’-GTTTAAACGGATCCCTAACACTCTCCCCTGTTG-3’

Using the signal peptide sequence of synthesis as template, 1-1 and 1-2 are primer, are expanded by PCR (PCR) method The genetic fragment of the restriction enzyme sites of I containing EcoR is obtained, is named as " SPH "；With the weight chain variabl area sequence SEQ ID NO of synthesis:3 For template, 2-1 and 2-2 are primer, and the amplification of PCR methods obtains heavy chain variable region gene fragment, is named as " VH "；Simultaneously with synthesis Heavy chain constant region sequence SEQ ID NO:7 be template, and 3-1 and 3-2 are primer, the amplification of PCR methods obtain terminator codon containing TGA with The weight chain constant area gene fragment of BamH I restriction enzyme sites, is named as " CH ".Using SPH, VH, CH genetic fragment as template, 1-1 and 3-2 is primer, passes through over-lapping PCR methods (Higuchi R, et al.A general method of in vitro preparation and specific mutagenesis of DNA fragments:study of protein and DNA interactions.Nucleic Acids Research,1988,16(15):7351-67.) amplification obtains The heavy chain full-length gene fragment of GB235-094 antibody.

Same method, using the signal peptide sequence of synthesis as template, 1-1 and 4-1 are primer, are expanded and obtained by PCR method The genetic fragment of the restriction enzyme sites of I containing EcoR, is named as " SPL "；With the light-chain variable sequence SEQ ID NO of synthesis:4 be mould Plate, 5-1 and 5-2 are primer, and the amplification of PCR methods obtains chain variable region gene fragment, is named as " VL "；Simultaneously with the light chain of synthesis Constant-region sequences SEQ ID NO:8 be template, and 6-1 and 6-2 are primer, and the amplification of PCR methods obtains terminator codon containing TGA and BamH The light chain constant region gene fragment of I restriction enzyme sites, is named as " CL ".Using SPL, VL, CL genetic fragment as template, 1-1 and 6-2 are Primer, the light chain full-length gene fragment for obtaining GB235-094 antibody is expanded by over-lapping PCR methods.

Above heavy chain and light chain full-length gene fragment are cloned into pGEM-T carriers respectively and (are purchased from Promega companies, goods Number：A3600), the end of genetic fragment 5 ' is made to contain EcoR I restriction enzyme sites, TGA terminator codons and BamH I are contained in 3 ' ends Restriction enzyme site.After DNA sequencing, by sequencing, correctly clone (is purchased from NEB companies, article No. with EcoR I：) and BamH R0101S The double enzymes of I (are purchased from NEB companies, article No.：R0136S (37 DEG C, 4 hours)) are digested, reclaim target gene fragment.Simultaneously by 293 carriers (it is purchased from Invitrogen companies, article No.：K8300-01 EcoR I and BamH I double digested (37 DEG C, 4 hours)) are used, is reclaimed 293-EcoRI/BamHI carrier segments.

The heavy chain of antibody full-length gene fragment and light chain full-length gene fragment that above-mentioned digestion is obtained respectively with 293- EcoRI/BamHI carrier segments (are purchased from NEB companies, article No. with T4DNA ligases：M0202S) it is attached that (16 DEG C, 16 is small When), (42 DEG C, 90 seconds) conversion Escherichia coli of heat shock, bed board (Amp⁺LB culture mediums), picked clones, EcoRI/BamHI pairs (37 DEG C, 2 hours) progress evaluation and screenings of enzymic digestion, screening are obtained containing the full length antibody heavy chain carrier for expression of eukaryon successfully constructed (293-VH-CH) or full length antibody light chain carrier for expression of eukaryon (293-VL-CL) clone.

Figure 1A is the structural representation of anti-human HER2 heavy chain of antibody (293-VH-CH) expression vector of GB235-094 recombinant full-lenghts Figure；Figure 1B is the structural representation of anti-human HER2 antibody light chains (293-VL-CL) expression vector of GB235-094 recombinant full-lenghts.

The eukaryotic of embodiment 6GB235-094 recombinant full-lenght IgG1 type antibody transiently transfects expression and purifying

The expression of constructed GB235-094 recombinant vectors in embodiment 5, cotransfection FreeStyle 293F can be used thin Born of the same parents (are purchased from Invitrogen companies, article No.：R790-07 method).

24 hours before transfection, FreeStyle 293F cells are pressed 6 × 10⁵Individual cell/ml passages, in constant-temperature table 135 Rev/min, 37 DEG C, 8%CO₂Under the conditions of cultivate so that transfect the same day cell density (blood cell plate counting method) be 1.2-1.5 × 10⁶ Individual cell/ml.(Invitrogen companies, article No. are purchased from the culture mediums of FreeStyle 293：12338-018) diluting cells, extremely Density is 1 × 10⁶Individual cell/ml.To ensure optimal transfection, cell viability (trypan blue staining) should be greater than 95%.

Transfection (is purchased from Invitrogen companies, article No. with reagent FreeStyle Max Reagent：16447-500) Slight overturn mixes 4 times.Each 315 μ g heavy chains and light chain expression vector plasmid are separately added into transfection nutrient solution OptiPRO SFM (is purchased from Invitrogen companies, article No.：In 12309-050), and volume is supplemented to 10ml with OptiPRO SFM, mix. A centrifuge tube separately is taken, dilutes 625 μ l FreeStyle Max Reagent to 10ml with OptiPRO SFM, it is slight reverse mixed It is even.The plasmid of dilution and the FreeStyle Max Reagent of dilution are mixed, are incubated at room temperature 15 minutes.By the 20ml of gained Mixed liquor is slowly added to (be purchased from Invitrogen companies, article No. equipped with 500ml FreeStyle 293F culture mediums：12338- 018) in shaking flask.Shaking flask in constant-temperature table culture 7 days (135 revs/min, 37 DEG C, 8%CO₂).9000 revs/min of refrigerated centrifuge Centrifugation 20 minutes, collect supernatant and carry out next step protein purification.

The FreeStyle 293F cell supernatants of the above-mentioned antibody containing GB235-094, use albumin A after centrifugation (Protein A) post (is purchased from GE Healthcare Bio-Sciences companies, article No.：17-5080-02) capture IgG1 types resist Body, eluted with 50mM citric acid-sodium citrate buffer solutions (pH=3.3), collect eluate (0.5ml), add the hydroxyls of 100 μ l1M tri- Aminomethane-hydrochloric acid (Tris-HCL) buffer solution (pH=11.0) is neutralized to neutrality, (prompt purchased from Shanghai through 10K dialysis membranes Auspicious bioengineering Co., Ltd, article No.：M1915) in phosphate buffer PBS (0.01M Na₂HPO₄·12H₂O+0.002M KH₂PO₄+ 0.14M NaCl+0.002M KCl, pH=7.2) in dialyse after, OD280nm measure protein content.Through 0.22 μm of filter (it is purchased from Millipore companies, article No.：GVHP01300) -80 DEG C of preservations after filtration sterilization.

The anti-human HER2 antibody GB235-094 of the recombinant full-lenght of embodiment 7 SDS-PAGE electrophoresis detections

Obtained GB235-094 antibody will be purified under final concentration of 50mM dithiothreitol (DTT) reducing condition, through 10% Polyacrylamide gel electrophoresis detects its purity and molecular size range.

Fig. 2 result shows, under conditions of complete reduction, GB235-094 antibody present molecular weight be 50KDa and 25KDa two bands, it is respectively the heavy chain and light chain bands of antibody (Trastuzumab is positive control, purchased from Roche companies).This A little results show that the GB235-094 antibody structures constructed by us are correct, and its molecular size range is consistent with theoretical value.

The anti-human HER2 antibody GB235-094 of the recombinant full-lenght of embodiment 8 immunologic competence identification

With the binding ability of ELISA Binding experiments checking GB235-094 antibody and people's HER2 antigens.Method is as follows：By people HER2 antigens (are purchased from Sino Biological companies, article No.：1 μ g/ml 10004-H08H) are diluted to PBS, according to 100 μ l/ holes are added in ELISA Plate, and 4 DEG C of coatings are overnight.5%BSA300 μ l/ holes are added after PBST board-washings 4 times, room temperature closing 1 is small When.After PBST board-washings 4 times, by GB235-094 antibody and Trastuzumab (being purchased from Roche companies) respectively five times since 10 μ g/ml Than diluting totally 7 gradients, add in ELISA Plate according to 100 μ l/ holes, be incubated 1 hour at ambient temperature.PBST board-washings 4 times, will The goat anti-human igg Fc antibody of HRP marks (is purchased from CalBiochem companies, article No.：AP113A-K) with PBS with 1: 10000 dilutions, are added in ELISA Plate according to 100 μ l/ holes, are incubated at room temperature 1 hour.PBST board-washings 4 times, add the colour developing of 100 μ l/ holes Liquid, it is incubated at room temperature 15 minutes and develops the color, add 50 μ l/ holes terminate liquids, read on M5 multi-function microplate readers under 450/630nm wavelength Light absorption value.

Fig. 3 result is shown, consistent with Trastuzumab, and GB235-094 antibody has and the combination of people's HER2 antigentic specificities Ability.

Across the kind immunoreactivity of GB235-094 antibody is verified with the ELISA method of embodiment 8, i.e., (is purchased with monkey HER2 From Sino Biological companies, article No.：90295-C08H), mouse HER2 (is purchased from Sino Biological companies, article No.： 50714-M08H) the cross reaction of antigen.Method is as follows：Monkey HER2 or mouse HER2 antigens are diluted to 1 μ g/ml with PBS, according to 100 μ l/ holes are added in ELISA Plate, and 4 DEG C of coatings are overnight.The μ l/ holes of 5%BSA 300 are added after PBST board-washings 4 times, room temperature closing 1 is small When.After PBST board-washings 4 times, by GB235-094 antibody and Trastuzumab, with PBS, five multiple proportions are dilute since 10 μ g/ml respectively Totally 7 gradients are released, are added according to 100 μ l/ holes in ELISA Plate, are incubated 1 hour at ambient temperature.PBST board-washings 4 times, by HRP The goat anti-human igg Fc antibody of mark (is purchased from CalBiochem companies, article No.：AP113A-K) with PBS with 1:10000 Dilution, add in ELISA Plate, be incubated at room temperature 1 hour according to 100 μ l/ holes.PBST board-washings 4 times, add 100 μ l/ holes nitrite ions, room Temperature, which is incubated 15 minutes, to develop the color, and adds 50 μ l/ holes terminate liquids, extinction is read under 450/630nm wavelength on M5 multi-function microplate readers Value.

Fig. 4 A result shows that GB235-094 antibody has cross reaction with monkey HER2 antigens；And Fig. 4 B result then shows Show, GB235-094 antibody shows cross reaction with mouse HER2 antigens under the conditions of 10 μ g/mL.

In family member alternative experimentally, ELISA method is as follows：People HER1 (Sino Biological companies are purchased from, Article No.：10001-H08H), people HER3 (is purchased from Sino Biological companies, article No.：10201-H08H-10) or people HER4 (it is purchased from Sino Biological companies, article No.：10201-H08H) antigen and people HER2 antigens (are purchased from Sino Biological Company, article No.：10004-H08H, as positive control) with PBS 1 μ g/ml are diluted to, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ l/ holes of 5%BSA 300 are added after PBST board-washings 4 times, room temperature is closed 1 hour., will after PBST board-washings 4 times GB235-094 antibody and Trastuzumab are diluted to 10 μ g/ml with PBS respectively, are added according to 100 μ l/ holes in ELISA Plate, room It is incubated 1 hour under the conditions of temperature.PBST board-washings 4 times, the goat anti-human igg Fc antibody that HRP is marked (CalBiochem companies are purchased from, Article No.：AP113A-K) with PBS with 1:10000 dilutions, are added in ELISA Plate according to 100 μ l/ holes, and incubation at room temperature 1 is small When.PBST board-washings 4 times, 100 μ l/ holes nitrite ions are added, be incubated at room temperature 15 minutes and develop the color, add 50 μ l/ holes terminate liquids, it is more in M5 On function ELIASA light absorption value is read under 450/630nm wavelength.

Fig. 5 result shows, GB235-094 antibody and the other members of people HER families, including people HER1, people HER3 and people The equal no cross reaction of HER4 antigens.

The anti-human HER2 antibody GB235-094 of the Inhibition ELISA of embodiment 9 identification recombinant full-lenght and Trastuzumab epitope competition As a result

People HER2 antigens (are purchased from Sino Biological companies, article No.：10004-H08H) diluted with PBS To 1 μ g/ml, added according to 100 μ l/ holes in ELISA Plate, 4 DEG C of coatings are overnight.The μ l/ of 5%BSA 300 are added after PBST board-washings 4 times Hole, room temperature are closed 1 hour.By GB235-094 antibody and Trastuzumab (being purchased from Roche companies) respectively ten times since 10 μ g/ml Than diluting totally 8 gradients, respectively with 0.005 μ g/ml biotin labelings (being marked by Shanghai Youke Biological Technology Co., Ltd.) Trastuzumab is being incubated at room temperature 2 hours, is added according to 100 μ l/ holes in ELISA Plate, is incubated at room temperature 1 hour；PBST board-washings 4 times, will The anti-biotin antibodies of HRP marks (are purchased from Invitrogen companies, article No.：SA100-01) with PBS with 1:10000 is dilute Release, added according to 100 μ l/ holes in ELISA Plate, is incubated at room temperature 1 hour.PBST board-washings 4 times, add 100 μ l/ holes nitrite ions, room temperature It is incubated 15 minutes and develops the color, adds 50 μ l/ holes terminate liquids, light absorption value is read under 450/570nm wavelength on M5 multi-function microplate readers.

Fig. 6 result shows that unmarked Trastuzumab antibody is shown to biotin mark in 1 to 10 μ g/mL concentration ranges The Trastuzumab of note is combined with obvious inhibiting effect on HER2, and has concentration-dependent relation.GB235-094 antibody and biotin The Trastuzumab of mark display portion inhibitory action only under the maximum concentration (10 μ g/mL) that experiment is related to, prompts it to combine epitope It may approach or partially overlap in the combination epitope of Trastuzumab.

The anti-human HER2 antibody GB235-094 of the recombinant full-lenght of embodiment 10 cell in vitro binding activity measure

The HER2 and the high-caliber P-HER2 of expression of human breast cancer cell BT-474 expression medium levels are (purchased from U.S. typical case Culture collection, accession number：HTB-20) with 2.0 × 10⁵Cells/well (100 μ l) is inoculated with 96 hole U-shaped boards.This is sent out simultaneously Bright antibody GB235-094 carries out four doubling dilutions totally 7 gradients since 10 μ g/ml, with PBS.

Supernatant is abandoned after the cell centrifugation of 96 hole U-shaped boards, the GB235-094 antibody added according to 100 μ l/ holes after dilution, 4 DEG C be incubated 2 hours.Supernatant is abandoned after centrifuging again, is washed 2 times with 200 μ l PBSs, the goat-anti people Fc for adding HRP marks resists Body (is purchased from CalBiochem companies, article No.：AP113A-K), 100 μ l/ holes (1:10000 dilutions), and be incubated 45 minutes at 4 DEG C. After cell centrifugation, washed 3 times with 200 μ l/ holes PBSs, add 100 μ l/ holes nitrite ions, be incubated at room temperature 15 minutes and develop the color, 50 μ l/ holes terminate liquids are added, light absorption value is read under 450/570nm.

Fig. 7 result shows that GB235-094 antibody of the invention can specifically bind to BT-474 as Trastuzumab Cell surface, there are concentration-dependent relation and saturability.

The anti-human HER2 antibody GB235-094 of the recombinant full-lenght of embodiment 11 external BT-474 cell inhibitory effects determination of activity

BT-474 cells are with 2.0 × 10⁴Cells/well (100 μ l) is inoculated in the flat Tissue Culture Plate in 96 holes, and 37 DEG C were cultivated Night.Antibody (is purchased from Invitrogen companies, article No. with 1640 culture mediums：A10491) (it is purchased from containing 10% hyclone Invitrogen companies, article No.：It is respectively 20 μ g/ml and 4 μ g/ml 10099-141) to be diluted to final concentration, and control wells are sample Dilution.Cell abandons supernatant, sample diluting liquid is added per hole by 100 μ l, 37 DEG C are incubated 72 hours.Add and examine according to 10 μ l/ holes Test agent Alarmarblue (is purchased from Invitrogen companies, article No.：DAL1100), 37 DEG C are incubated 2.5 hours, M5 multifunctional enzymes Mark instrument reading (Flu544/590).

Fig. 8 A result shows that GB235-094 antibody and Trastuzumab show essentially identical suppression under two concentration The activity of BT-474 cells propagation.

The research for being used as dose-effect relationship, GB235- further are made to the BT-474 cell inhibitory effects of GB235-094 antibody 094 antibody and Trastuzumab antibody (are purchased from Invitrogen companies, article No. with 1640 culture mediums respectively：A10491 10% tire ox) is contained Serum (is purchased from Invitrogen companies, article No.：10099-141) it is diluted to 1,0.7,0.4,0.1,0.08,0.04,0.01 and 0.005 μ g/ml totally 9 concentration, equally with BT-474 cell incubations 72 hours.Fig. 8 B result shows, Trastuzumab and GB235- 094 antibody suppresses the effect of BT-474 cells propagation with being respectively provided with concentration gradient dependence, and the latter's effect is slightly weaker than Trastuzumab.By Detected in the cell-bound activity of GB235-094 antibody in the case of without affinity maturation, therefore prompt this anti- For body in after affinity maturation (affinity that antibody can be improved by point mutation or strand displacement), it suppresses cell propagation Ability is possible will be stronger, is expected to turn into potential breast cancer treatment medicine of the effect more than Trastuzumab antibody.

12 soluble HER2 of embodiment is to the upset to BT-474 cell inhibitory effects activity in vitro of GB235-094 antibody Effect

Method is with embodiment 11, and BT-474 cells are with 2.0 × 10⁴Cells/well (100 μ l) is inoculated in the flat cell training in 96 holes Support plate, 37 DEG C of overnight incubations.Antibody (is purchased from Invitrogen companies, article No. with 1640 culture mediums：A10491 10% tire) is contained Cow's serum (is purchased from Invitrogen companies, article No.：It is respectively 20 μ g/ml and 4 μ g/ml 10099-141) to be diluted to final concentration, right It is sample diluting liquid according to hole.Cell abandons supernatant, and sample diluting liquid is added per hole by 100 μ l；In the orifice plate of upset experiment, 20 μ The hHER2 antigen proteins that final concentration of 100 μ g/ml are added in g/ml and 4 μ g/ml antibody (are purchased from Sino Biological Company, article No.：10004-H08H).37 DEG C are incubated 72 hours.Detection reagent Alarmarblue is added according to 10 μ l/ holes (to be purchased from Invitrogen companies, article No.：DAL1100), 37 DEG C are incubated 2.5 hours, M5 multi-function microplate readers reading (Flu544/590).

Fig. 9 result is shown, compared with blank control, can substantially suppress BT-474 under two kinds of concentration in two antibody Cell is bred, and two concentration inhibitory action are suitable.Under the conditions of having existing for soluble human HER2 antigens, high concentration antibody pair The inhibitory action part of cell propagation is reversed, and the effect of low concentration antibody on cell propagation is reversed completely, prompts antibody pair The inhibitory action of tumor cell proliferation is HER2 specific.

The anti-human HER2 antibody GB235-094 of the recombinant full-lenght of embodiment 13 to BT-474 cell-signaling pathways inhibitory action to grinding Study carefully

BT-474 cells are seeded to 6 orifice plates, 37 DEG C of overnight incubations make its adherent.Trastuzumab and GB235- are prepared with PBS 094 antibody mother liquor, add in cell, respectively make its final concentration of 20 μ g/ml and 2 μ g/ml (two kinds of antibody are all provided with two concentration, Control group only adds PBS), 37 DEG C act on 2 hours, 24 hours and 72 hours with phosphorylation in observation of cell signal path approach respectively HER2 (P-HER2), phosphorylation Akt (P-Akt) and phosphorylated CREB 1/2 (P-ERK1/2) albumen content.

After antibody effect terminates, Tissue Culture Plate is put on ice, washed twice with the PBS of precooling, add 170 μ l cells (RIPA+PMSF+Phosphatase Inhibitor Cocktail 2, wherein RIPA and PMSF are purchased from Beyotime to lysate Company, Phosphatase Inhibitor Cocktail 2 are purchased from Sigma companies, article No.：P5726), 20 minutes are incubated to split Solve cell.Scraped with cell and the cell suspension after cracking is transferred to 1.5ml centrifuge tubes, 13,000 revs/min 4 DEG C centrifuge 10 minutes, Supernatant is transferred to new centrifuge tube, and -80 DEG C of preservations are stand-by.

After OD280nm protein quantifications, the dithiothreitol (DTT) that the albumen of equivalent is added to the final concentration of 50mM of reducing agent (is purchased from Sangon companies, article No.：D0281), sample boils 5 minutes, and 13,000 revs/min centrifuge 10 minutes, respectively take 8 μ g as electrophoresis sample Product.

Electrophoresis method is carried out according to the operating process of the Plays of embodiment 7.By the glue after electrophoresis by electrotransfer (300mA, 80 minutes) method be transferred on pvdf membrane, 5% skimmed milk power (is purchased from Sangon companies, article No.：NB0669) it is incubated at room temperature 1 Hour with the non-specific binding in close membrane, adds P-HER2 and (is purchased from Cell Signal Technology companies, article No.： 2247), P-Akt (is purchased from Cell Signal Technology companies, article No.：4060) and P-ERK1/2 (is purchased from Cell Signal Technology companies, article No.：4376) antibody (is 1:1000 dilutions), 4 DEG C of overnight incubations.PBST (contains The PBS of 0.05% polysorbas20) wash film twice.Now, the secondary antibody (article No. of HRP marks is added：401215,1:10000 is dilute Release, purchased from Cell Signal Technology companies), it is incubated at room temperature 1 hour.Chemoluminescence method ECLL (is purchased from PerkinElmer companies, article No.：NEL104001EA) detect.

Figure 10 A (GB235-094 antibody effect BT474 cells the influence to HER2 signal paths in 2 hours) result shows, In the case of antibody effect 2 is small, compared with control group, 20 μ g/ml and 2 μ g/ml Trastuzumab can cause P-HER2 and P-Akt downward, and downward effect unobvious of the GB235-094 antibody to P-Akt, there is slight up-regulation effect to P-HER2.

Figure 10 B (influence to HER2 signal paths in 24 hours of GB235-094 antibody effect BT474 cells) result shows Show, under the action condition of 24 hours, downward effect of the Trastuzumab to P-HER2 and P-Akt is consistent with 2 hours, and GB235- 094 antibody has up-regulation effect to P-HER2, but to P-Akt without obvious effect.

Figure 10 C (GB235-094 antibody acts on influence of the BT4-7472 hours to HER2 signal paths) result shows, Under conditions of effect 72 hours, it is seen that 20 μ g/ml and 2 μ g/ml Trastuzumab is to P-HER2, P-Akt and P-ERK1/2 All generate obvious downward effect.And GB235-094 antibody is not acted on significantly P-Akt, have to P-HER2 significantly Up-regulation acts on, and the downward that its chief active is embodied in P-ERK1/2 uses, either in 20 μ g/ml or 2 μ g/ml, its Downward effect is all apparent.

To sum up result, the molecular mechanism of action of Trastuzumab is typically considered (lowers phosphoric acid by suppressing HER2 phosphorylations The HER2 of change), block the cell generation cycle ERK1/2 of phosphorylation (lower) and promote Apoptosis (downward phosphorylation Akt).According to the result with Trastuzumab epitope competition, GB235-094 antibody is different from the epitope of Trastuzumab；According to external and BT- The result that 474 cells combine, GB235-094 antibody can specifically bind to BT-474 cell surfaces as Trastuzumab, have dense Spend dependence and saturable；According to the external result for suppressing BT-474 cell-proliferation activities, GB235-094 antibody has obvious Suppression BT-474 cells propagation ability, its effect is suitable with Trastuzumab.Further according to antibody on cell signal path Suppression research find that GB235-094 antibody has obvious downward to act on to P-ERK1/2, itself and BT-474 cell inhibitory effects Result it is consistent (P-ERK1/2 is the signal of interest approach on cell propagation path), have slight up-regulation effect to P-HER2 (opposite with the effect of Trastuzumab), without effect on P-Akt (P-Akt is the signal of interest approach on Apoptosis path). These results are prompted, and for antibody GB235-094 of the invention because structure is different from Trastuzumab, epitope is different from Trastuzumab, thus produces The mechanism of raw suppression BT-474 cells propagation is also different with Trastuzumab.

The present invention passes through the total length beyond full people source scFv phage antibody libraries screen to obtain and build Trastuzumab epitope Antibody GB235-094, its it is alone or with Trastuzumab use in conjunction, it is contemplated that can produce and Trastuzumab is added or the effect that cooperates with.Should Antibody will produce therapeutic action to HER2 positive tumors, it is contemplated that can case insensitive to Trastuzumab or resistance have effect.

Claims (16)

1. a kind of HER2 antibody in full people source, the wherein amino acid sequence of weight chain variable district is SEQ ID NO:1, light chain variable district Amino acid sequence be SEQ ID NO:2.

2. the full people source HER2 antibody of claim 1, it is Fab, Fab ', F (ab ')₂, Fv or scFv form.

3. the full people source HER2 antibody of claim 1, include the heavy chain constant region and constant region of light chain of human IgG.

4. the full people source HER2 antibody of claim 3, wherein the human IgG is IgG1.

5. the full people source HER2 antibody of claim 3, wherein the amino acid sequence of the human IgG heavy chain constant region is SEQ ID NO:5, the amino acid sequence of the human IgG constant region of light chain is SEQ ID NO:6.

6. encode the nucleotide sequence of any one of claim 1-5 full people source HER2 antibody.

7. the nucleotide sequence of the full people source HER2 antibody of claim 6, wherein encoding the nucleotides sequence of the weight chain variable district It is classified as SEQ ID NO:3, the nucleotides sequence for encoding the light chain variable district is classified as SEQ ID NO:4.

8. the nucleotide sequence of the full people source HER2 antibody of coding of claim 6 or 7, wherein when the full people source HRE2 antibody bags Containing heavy chain constant region and during constant region of light chain, the nucleotides sequence for encoding the heavy chain constant region is classified as SEQ ID NO:7, encode institute The nucleotides sequence for stating constant region of light chain is classified as SEQ ID NO:8.

9. a kind of expression vector of the nucleotide sequence comprising any one of claim 6-8, the nucleotide sequence with it is described The expression control sequence of expression vector is operably connected.

10. the expression vector of claim 9, wherein the expression vector is pGEM-T carriers or 293 carriers.

11. a kind of pharmaceutical composition, it includes any one of claim 1-5 full people source HER2 antibody and pharmaceutical acceptable carrier.

12. a kind of combination medicine, it includes any one of claim 1-5 full people source HER2 antibody and Trastuzumab.

13. a kind of kit for detecting people HER2, it includes any one of claim 1-5 full people source HER2 antibody.

14. any one of claim 1-5 full people source HER2 antibody is used to prepare the positive breasts of HER2 being used to treat in subject The purposes of the medicine of gland cancer.

15. the purposes of claim 14, wherein the subject is people.

16. the purposes of claim 15, wherein the subject is to Trastuzumab resistance or to the unresponsive people of Trastuzumab.