CN104497110B - Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof - Google Patents
Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof Download PDFInfo
- Publication number
- CN104497110B CN104497110B CN201410697370.5A CN201410697370A CN104497110B CN 104497110 B CN104497110 B CN 104497110B CN 201410697370 A CN201410697370 A CN 201410697370A CN 104497110 B CN104497110 B CN 104497110B
- Authority
- CN
- China
- Prior art keywords
- sequence
- polypeptide
- dna molecular
- concrete
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides six pairs of polypeptides for specific recognition of a swine H11 site and a coding gene and applications thereof. The six pairs of polypeptides provided by the invention are each composed of a polypeptide A and a polypeptide B, the polypeptide A and polypeptide B are each composed of 18 TAL nucleic acid recognition units, and each TAL nucleic acid recognition unit has two repeat-variable diresidues; the polypeptides provided by the invention can knock out or modify a swine H11 gene at a cellular level or at an individual level so as to parse the function of the swine H11 gene and construct a swine H11 gene mutation library, provides the early-stage technical support for breeding excellent-variety pigs, and provides a stable platform for preparation of transgenic pigs.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to 6 to the polypeptide in (2 × 3) specific recognition pig H11 sites and
Its encoding gene and application.
Background technology
2010, the o.11 chromosome of the Simon Hippenmeyer of Stanford University and its research team in mice
Upper separation simultaneously identifies a good gene insertion site, is named as hipp11 sites, abbreviation H11 sites.H11 sites position
In Eif4enif1 and the gap of two genes of Drg1,19 exons and 9 extras of Drg1 genes with Eif4enif1 genes
Adjacent, the size about 5kb of aobvious son.H11 sites are due to being located between two genes, therefore safety is higher, without gene silencing effect,
Cell expression activity with wide spectrum.Experiment confirms that the mice of Hipp11 sites fixed point genetic modification and wild-type mice growth are sent out
Educate indistinction.Similar at present also has Rosa26 sites, but the site is a gene, and its promoter is general wide spectrum table
Reach, it is difficult to accomplish tissue specific expression, but then there is no similar difficulty in H11 sites, because it is located between two genes,
And there is no promoter, it is possible to which the promoter needed for choice experiment completes the Space-time speciality expression of genes of interest, more
Good reaches task object.If positioning the so safely and effectively genetic modification sites of hipp11 in the genome of pig, will have
Beneficial to the technical system for stablizing transgenic pig cultivation.
Find a kind of technology in energy targeting cutting pig H11 sites quite important.Traditional Knockout technology efficiency is very low,
Its homologous recombination for relying primarily on cell interior exchanges at random what is completed, and efficiency is very low.
The main method for developing in recent years is the accurate modification for relying on sequence-specific nuclease to carry out gene.Sequence specific
Nuclease mainly recognize that domain is formed by connecting with the inscribe enzyme domains of an energy Non-specific cleavage DNA by DNA.Its master
Principle is wanted to be first to recognize that domain recognizes and is attached on the DNA fragmentation for needing transformation by DNA, it is then non-specific by what is be connected with DNA
Property inscribe enzyme domains cut to DNA, cause the double-strand break (Double-strand break, DSB) of DNA, DSB meetings
The self-regeneration of activation DNA and cause the mutation of gene to promote the homologous recombination in the site.
Zinc finger nuclease technology (Zinc Finger Nuclease, ZFN) is exactly that the gene described in the last period is accurately modified
Technology, is made up of the DNA identification domains and a non-specific nucleic acid restriction endonuclease of a specificity.In ZFN identification domains, one
Individual zinc fingerses can (typically 3) multiple with specific recognition continuous base, multiple zinc fingerses are capable of identify that a series of
Base.So, in the design process of ZFN, the aminoacid sequence of zinc finger identification domain is emphasis, how particularly be designed will
(Cys2-His2) zinc finger protein of multiple lysine 2- histidine 2 is connected, and how residual by changing 16 aminoacid of α spirals
Base determines the specific triplet base of each zinc finger protein identification.
Feasibility of the ZFN technologies in terms of gene target modification causes it to be widely used in individual level and cellular level
Genetic modification.First people realize the gene directed modification of cellular level by using ZFN technologies.As Sangamo companies in
Realize within 2005 the gene targeting that ZFN is mediated in mankind's cultured cells system first, 2007 using same ZFN by homologous
Recombination realizes gene site-directed insertion.Recently, people realize gene in iPS the and ES cells of people respectively using ZFN
Targeting mutation.
By contrast, transcriptional activation increment effector nuclease (transcription activator-like
Effector nucleases, TALEN) there are more advantages, it has been that the another kind since Zinc finger nuclease technology can be to base
Because group carries out the new technique of efficient pointed decoration.There is a kind of albumen (TALEs) to know in transcription factor activation effector family
Not, DNA is combined.TALE is with DNA sequence specific binding mainly by 34 in TAL structures constant aminoacid sequence mediations.Will
TALEs is connected with the cutting domain of FokI Cobra venom endonucleases, TALEN is formed, such that it is able to realize to genomic DNA double-strand in spy
Anchor point is modified.
A repeat region is there is in the central authorities of TALE, this region typically can by the quantity of 33-35 aminoacid
The repetitives of change are constituted.Repetitive sequence domain (Repeat Domain) is responsible for the DNA sequence of identification specificity.Each weight
Complex sequencess are essentially all the same, except the variable bis-amino acid residue of two variable aminoacid, i.e. repetitive sequence
(Repeat-Variable Diresidues,RVD).The mechanism of TALE identification DNA is that the RVD on a repetitive sequence can
A nucleotide on identification DNA target point, then merge FokI Cobra venom endonucleases, it is combined into TALEN.TALEN is a kind of heterologous two
Polymer molecular (the TALE DNA binding structural domains of two units are fused to the catalytic domain of a unit), can cut two phases
Every nearer sequence, so that specificity strengthens.The efficiency high of the enzyme, small toxicity, short preparation period, the low advantage of cost is got over
Come more obvious.
The content of the invention
It is an object of the present invention to provide being capable of the polypeptide in specific recognition pig H11 sites.
For achieving the above object, according to an aspect of the present invention, first according to the part of the gene order in pig H11 sites
Fragment devises target sequence, sequence 2 of its specific nucleotide sequence as shown in the sequence 1 in sequence table, such as in sequence table
It is shown, as shown in the sequence 3 in sequence table, as shown in the sequence 4 in sequence table and/or as shown in the sequence 5 in sequence table.
Further, the invention provides the polypeptide in six pairs of specific recognition pig H11 sites, the polypeptide is by polypeptide I and many
Peptide second is constituted, and the polypeptide I and polypeptide II are constituted by 18 TAL nucleic acid recognizing units, in each TAL nucleic acid recognizing unit
With the variable bis-amino acid residue of two repetitive sequences；
Further, the specifically sequence of aforementioned polypeptides pair is as follows：
1) sequence of polypeptide I is concrete as shown in the sequence 6 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 7；
2) sequence of polypeptide I is concrete as shown in the sequence 8 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 7；
3) sequence of polypeptide I is concrete as shown in the sequence 9 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 7；
4) sequence of polypeptide I is concrete as shown in the sequence 6 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 10；
5) sequence of polypeptide I is concrete as shown in the sequence 8 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 10；
6) sequence of polypeptide I is concrete as shown in the sequence 9 in sequence table, and the sequence of polypeptide II is concrete as in sequence table
Shown in sequence 10；
Another object of the present invention is to provide the DNA molecular of encoding such polypeptides pair.
Further, above-mentioned DNA molecular includes the DNA molecular first of coded polypeptide first and the DNA molecular second of coded polypeptide second.
Further, the nucleotide sequence of above-mentioned DNA molecular is as follows：
1) in polynucleotide the DNA molecular first of polypeptide shown in sequence 6 particular sequence such as the institute of sequence 11 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in polynucleotide；
2) in polynucleotide the DNA molecular first of polypeptide shown in sequence 8 particular sequence such as the institute of sequence 13 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in polynucleotide；
3) in polynucleotide the DNA molecular first of polypeptide shown in sequence 9 particular sequence such as the institute of sequence 14 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in polynucleotide；
4) in polynucleotide the DNA molecular first of polypeptide shown in sequence 6 particular sequence such as the institute of sequence 11 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in polynucleotide；
5) in polynucleotide the DNA molecular first of polypeptide shown in sequence 8 particular sequence such as the institute of sequence 13 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in polynucleotide；
6) in polynucleotide the DNA molecular first of polypeptide shown in sequence 9 particular sequence such as the institute of sequence 14 in sequence table
Show, the particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in polynucleotide；
7) by 1)～6) described in coded polypeptide DNA molecular the one or several bases of nucleotide sequence Jing replacement
And/or disappearance and/or add and with 1)～6) in nucleotide sequence there is the nucleotide sequence of same encoding function.
It is a further object to provide the polypeptide answering in specific recognition and targeting modification pig H11 genes
With.Described pig H11 genes, its nucleotide sequence is as shown in the sequence 16 in sequence table.
It is also another object of the present invention to provide application of the aforementioned polypeptides in pig H11 gene mutation storehouse is built.Described
Pig H11 genes, its nucleotide sequence is as shown in the sequence 16 in sequence table.
The polypeptide of six pairs of specific recognition pig H11 genes that the present invention is provided, and there is provided the encoding gene of the polypeptide pair.This
Invention is by aforementioned polypeptides to for the identification to pig H11 sites, the genes of interest in cell being made specifically to be cut, in cell
In the presence of itself repair system, the mutation library of genes of interest can be obtained.The polypeptide that the present invention is provided is to can be in cell or individual
In body level pig H11 genes are knocked out or modified, to parse the function of pig H11 genes, build pig H11 gene mutation storehouse,
Pig to cultivate excellent strain provides prior art and supports, the preparation for transgenic pig provides stabilised platform.
Description of the drawings
Fig. 1 is carrier L15 skeleton drawings；
Fig. 2 is carrier R10 skeleton drawings；
Fig. 3 is carrier R12 skeleton drawings；
Fig. 4 is the site structure schematic diagram of TALEN systems cutting；And
Fig. 5 is 6 pairs of polypeptide enzyme action result electrophoretograms.
Specific embodiment
Following examples are used to further illustrate the present invention, but should not be construed as limiting the invention.Without departing substantially from this
On the premise of spirit and essence, modification made for the present invention or replacement belong to scope of the invention.
The structure of embodiment 1TALEN
1st, the structure of target sequence
The present invention is first according to the gene order (particular sequence is as shown in the sequence 16 in sequence table) in pig H11 sites, root
It is used for the polypeptide target spot of gene knockout according to PAM sequence selections, it is as follows：5’-
TACTGAAATGTGACCTACTTTCTTATGTTCCTGGAAGTTTAGATCAGGGTGGGCAGCTCTGGG-3’
2nd, TALEN sites design
At present, TALEN systems interrupt target gene using the endonuclease activity of FokI, because FokI need to form 2 aggressiveness sides
Activity can be played, need to select the target sequence of (interval 14-18 bases) adjacent at two (general in target gene in practical operation
More than ten base) TAL identification module structures are carried out respectively.
According to the site of shot design TALEN systems cutting, schematic diagram is shown in Fig. 4, and particular sequence is as follows：
L1：5 '-TTCTTATGTTCCTGGAAG-3 ' carrier Ts：L15, the structure of the carrier is：cmv-sp6-NLS-TAL-
T-IRES-puro-pA, the skeleton drawing of the carrier is shown in Fig. 1；
L2：5 '-TCTTATGTTCCTGGAAGT-3 ' carrier Ts：L15, the structure of the carrier is：cmv-sp6-NLS-TAL-
T-IRES-puro-pA, the skeleton drawing of the carrier is shown in Fig. 1；
L3：5 '-CTTATGTTCCTGGAAGTT-3 ' carrier Ts：L15, the structure of the carrier is：cmv-sp6-NLS-TAL-
T-IRES-puro-pA, the skeleton drawing of the carrier is shown in Fig. 1；
R1：3 '-GTAGCCTATAAAACCCAG-5 ' A carriers：R10, the structure of the carrier is：cmv-sp6-NLS-TAL-
A-pA, the skeleton drawing of the carrier is shown in Fig. 2；
R2：3 '-AGCCTATAAAACCCAGAG-5 ' C carriers：R12, the structure of the carrier is：cmv-sp6-NLS-TAL-
C-pA, the skeleton drawing of the carrier is shown in Fig. 3；
3rd, using the FastTALETM TALEN rapid build test kits of upper Hemohes Dan Sai Bioisystech Co., Ltd
(Cat.No.1802-030) TALEN is built, is the step of structure：
(1) design, suitable module is selected according to selected site, design result is as follows：
L1：TTCTTATGTTCCTGGAAG carrier Ts：L15
Selected module：TT1 CT2 TA3 TG4 TT5 CC6 TG7 GA8 AG 9
L2：TCTTATGTTCCTGGAAGT carrier Ts：L15
Selected module：TC1 TT2 AT3 GT4 TC5 CT6 GG7 AA8 GT 9
L3：CTTATGTTCCTGGAAGTT carrier Ts：L15
Selected module：CT1 TA2 TG3 TT4 CC5 TG6 GA7 AG8 TT 9
R1：GTAGCCTATAAAACCCAG A carriers：R10
Selected module：GT1 AG2 CC3 TA4 TA5 AA6 AC7 CC8 AG 9
R2：AGCCTATAAAACCCAGAG C carriers：R12
Selected module：AG1 CC2 TA3 TA4 AA5 AC6 CC7 AG8 AG 9
(2) add module
Module according to selecting in the 1st step is sequentially added into required module (totally 5 pipe), module institute in 200ulPCR pipes
Correspondence position is as follows：
Table 1：Module 1
Table 2：Module
| 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | |
| AA7 | CA7 | AA8 | CA8 | AA9 | CA9 | A1 | T1 | C1 | G1 | A | ||
| AT7 | CT7 | AT8 | CT8 | AT9 | CT9 | A2 | T2 | C2 | G2 | B | ||
| AC7 | CC7 | AC8 | CC8 | AC9 | CC9 | A3 | T3 | C3 | G3 | C | ||
| AG7 | CG7 | AG8 | CG8 | AG9 | CG9 | A4 | T4 | C4 | G4 | D | ||
| TA7 | GA7 | TA8 | GA8 | TA9 | GA9 | A5 | T5 | C5 | G5 | E | ||
| TT7 | GT7 | TT8 | GT8 | TT9 | GT9 | A6 | T6 | C6 | G6 | F | ||
| TC7 | GC7 | TC8 | GC8 | TC9 | GC9 | A7 | T7 | C7 | G7 | G | ||
| TG7 | GG7 | TG8 | GG8 | TG9 | GG9 | H |
(3) it is loaded
Other solution in test kit are separately added into according to following system, system is as follows：
Table 3：Reaction system
| System | |
| Module | 1.5μL×9 |
| Solution 1 | 1μL |
| Solution 2 | 1μL |
| Solution 3 | 2μL |
| Carrier | 1.5μL |
| ddH2O | 1μL |
| Cumulative volume | 20μL |
(4) connect
1) above-mentioned mixed liquor is respectively placed in PCR instrument and completes connection, response procedures are as follows：
2) take out and walk reactant liquor, after being separately added into the μ L solution 5 (the μ L of cumulative volume 21.5) of 1 μ L solution 4,0.5, be placed in 37 DEG C
Incubation 60 minutes.
(5) convert
1) competence in test kit is taken out, 10min is placed on ice melts it.
2) in taking the last connection product addition of 10 μ L steps 4, mix.
3) 20min is stood on ice.
4) 42 DEG C of heat shock 60s.
5) ice bath 3min.
6) 500 μ L SOC, 37 DEG C of shaking table recovery 30min are added.
7) 4000rpm, is centrifuged 5min, and supernatant is outwelled most of (staying about 150 μ L).
8) it is thalline is resuspended, it is uniformly coated on the LB flat boards of kan resistances.
9) 37 DEG C of culture 16h.
(6) clone is chosen
10 clones, overnight incubation in 37 DEG C of shaking tables are chosen on cultured flat board (more than 16h).Using primer 305
(5 '-CTCCCCTTCAGCTGGACAC-3 ') are sent to company's sequencing with 306 (5 '-AGCTGGGCCACGATTGAC-3 '), select just
Really clone obtains TALEN：TALEN-H11-L1, TALEN-H11-L2, TALEN-H11-L3, TALEN-H11-R1 and TALEN-
H11-R2, extracts plasmid, completes next step experiment.
The polypeptide of embodiment 2 is verified to cutting efficiency
1st, porcine fetus fibroblastses are separated.
From isolated PEF cells in the pig fetus of miscarriage, (separation method is referring to document：Li Hong, Wei Hongjiang, Xu Chengsheng,
Wang Xia, minister in ancient times's jade ripple, Zeng Yangzhi；The foundation of Banna Minipig Inbred Line fetal fibroblast cell line and its biological property；Hunan
Agriculture university's journal (natural science edition)；The 6th phase of volume 36；In December, 2010；678-682).
2nd, consideration convey dye
By recombiant plasmid TALEN-H11-L1 and TALEN-H11-R1, TALEN-H11-L2 and TALEN-H11-R1,
TALEN-H11-L3 and TALEN-H11-R1, TALEN-H11-L1 and TALEN-H11-R2, TALEN-H11-L2 and TALEN-
H11-R2, TALEN-H11-L3 and TALEN-H11-R2, each 2.5 μ g distinguish cotransfection PEF cells by way of electricity conversion, obtain
To reconstitution cell.What is transfected comprises the concrete steps that：Using consideration convey instrument (Amaxa, model：) and supporting mammal AAD-1001S
Fibroblast transfection reagent box (Amaxa, article No.：VPI-1002) transfected.First by 0.1% trypsin
(Gibco, article No.：610-5300AG) attached cell is digested, with hyclone (Gibco, article No.：16000-044) terminate digestion,
Phosphate buffer (Gibco, article No.：10010-023) washed cell twice, adds transfection reagent, is transfected using program T-016
Cell.
3rd, the extraction of DNA
37 DEG C of two kinds of reconstitution cells that step 2 is obtained are cultivated 48 hours, then collect cell.Comprise the concrete steps that：First
Using 0.1% trypsin Gibco, article No.：610-5300AG) attached cell is digested, with hyclone (Gibco, article No.：
16000-044) terminate digestion, phosphate buffer (Gibco, article No.：10010-023) washed cell twice, adds 200 microlitres
Cell pyrolysis liquid GA (component in TIANGEN companies DNA extraction kit DP304).Reference reagent box description step is distinguished
Extract two kinds of cell STb genes.
4th, PCR digesting efficiencies checking
(1) using primer H11-F (GCGAGAATTCTAAACTGGAG) and primer H11-R
(GATCTGAGGTGACAGTCTCAA) respectively with the cell DNA in step 3 as template, enter performing PCR amplification, reclaim 387bp pieces
Section.Using the only Cobra venom endonuclease I of Shang Lide company's Ts 7 (T7endonuclease I, T7E1) (article No.：#E001L) carry out enzyme action
Identification.Concretely comprise the following steps：
(2) mutant DNA is mixed with the PCR primer of wild type DNA by following system, carries out heat denatured, annealing
Renaturation process (95 DEG C of 5min, naturally cool to room temperature).
Table 4：Pcr amplification reaction system
(3) above-mentioned reaction system is separately added into 0.5ul T7E1 enzymes, after 37 DEG C of reaction 30min, runs 2% agarose gel
Electrophoresis detection analyzes enzyme action result, and the electrophoretogram of enzyme action result is shown in Fig. 5, and 1 is TALEN-H11-L1 and TALEN-H11- in the figure
R1,2 is TALEN-H11-L2 and TALEN-H11-R1, and 3 is TALEN-H11-L3 and TALEN-H11-R1, and 4 is TALEN-H11-
L1 and TALEN-H11-R2,5 is TALEN-H11-L2 and TALEN-H11-R2, and 6 is TALEN-H11-L3 and TALEN-H11-R2,
P is transfection positive Cas9n, and N is blanc cell.If TALEN is effective, target spot will cut out 160bp+230bp bands, target spot 2
170bp+220bp bands will be cut out, from the graph in can see cutting after endonuclease bamhi, and 3,4,5,6 combined sheets compared with
Bright, cutting efficiency is higher than 1,2 groups.
T7EI cleavage maps：1 is TALEN-H11-L1 and TALEN-H11-R1, and 2 is TALEN-H11-L2 and TALEN-H11-
R1,3 is TALEN-H11-L3 and TALEN-H11-R1, and 4 is TALEN-H11-L1 and TALEN-H11-R2, and 5 is TALEN-H11-
L2 and TALEN-H11-R2,6 is that (another patent is situated between for transfection positive Cas9n for TALEN-H11-L3 and TALEN-H11-R2, P
Continue), N is blanc cell.If TALEN is effective, target spot will cut out 160bp+230bp bands, and target spot 2 will cut out 170bp+
220bp bands, from the graph in can see endonuclease bamhi, and 3,4,5,6 combined sheets are brighter, and estimated efficiency is in 2%-3%
Left and right.
Claims (8)
1. the polypeptide in six pairs of specific recognition pig H11 sites, it is characterised in that by polypeptide I and polypeptide II composition, the polypeptide
First and polypeptide II are constituted by 18 TAL nucleic acid recognizing units, can with two repetitive sequences in each TAL nucleic acid recognizing unit
The bis-amino acid residue of change；
Its specifically sequence it is as follows：
1) sequence of polypeptide I is concrete as shown in the sequence 6 in sequence table, the concrete sequence 7 as in sequence table of sequence of polypeptide II
It is shown；
2) sequence of polypeptide I is concrete as shown in the sequence 8 in sequence table, the concrete sequence 7 as in sequence table of sequence of polypeptide II
It is shown；
3) sequence of polypeptide I is concrete as shown in the sequence 9 in sequence table, the concrete sequence 7 as in sequence table of sequence of polypeptide II
It is shown；
4) sequence of polypeptide I is concrete as shown in the sequence 6 in sequence table, the concrete sequence as in sequence table of sequence of polypeptide II
Shown in 10；
5) sequence of polypeptide I is concrete as shown in the sequence 8 in sequence table, the concrete sequence as in sequence table of sequence of polypeptide II
Shown in 10；
6) sequence of polypeptide I is concrete as shown in the sequence 9 in sequence table, the concrete sequence as in sequence table of sequence of polypeptide II
Shown in 10.
2. the polypeptide in the specific recognition pig H11 sites described in claim 1, it is characterised in that designed according to following target site
Obtain：Sequence of its specific sequence as shown in the sequence 1 in sequence table, as shown in the sequence 2 in sequence table, such as in sequence table
Shown in row 3, as shown in the sequence 4 in sequence table and/or as shown in the sequence 5 in sequence table.
3. the DNA molecular of the polypeptide shown in claim 1 is encoded.
4. DNA molecular according to claim 3, it is characterised in that the DNA molecular first and coding including coded polypeptide first is more
The DNA molecular second of peptide second.
5. the nucleotide sequence of the DNA molecular described in claim 3.
6. the nucleotide sequence of DNA molecular according to claim 5, it is characterised in that particular sequence is as follows：
1) in polynucleotide the particular sequence of the DNA molecular first of polypeptide shown in sequence 6 as shown in the sequence 11 in sequence table,
The particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in polynucleotide；
2) particular sequence of the DNA molecular first of polypeptide shown in sequence 8 as shown in the sequence 13 in sequence table, is compiled in polynucleotide
The particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in code sequence table；
3) particular sequence of the DNA molecular first of polypeptide shown in sequence 9 as shown in the sequence 14 in sequence table, is compiled in polynucleotide
The particular sequence of the DNA molecular second of polypeptide shown in sequence 7 is as shown in the sequence 12 in sequence table in code sequence table；
4) particular sequence of the DNA molecular first of polypeptide shown in sequence 6 as shown in the sequence 11 in sequence table, is compiled in polynucleotide
The particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in code sequence table；
5) particular sequence of the DNA molecular first of polypeptide shown in sequence 8 as shown in the sequence 13 in sequence table, is compiled in polynucleotide
The particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in code sequence table；
6) particular sequence of the DNA molecular first of polypeptide shown in sequence 9 as shown in the sequence 14 in sequence table, is compiled in polynucleotide
The particular sequence of the DNA molecular second of polypeptide shown in sequence 10 is as shown in the sequence 15 in sequence table in code sequence table；
7) by 1)～6) described in coded polypeptide DNA molecular the one or several bases of nucleotide sequence Jing replacement and/
Or disappearance and/or add and with 1)～6) in nucleotide sequence there is the nucleotide sequence of same encoding function.
7. application of the six pairs of polypeptides described in claim 1 in specific recognition and targeting modification pig H11 genes.
8. application of the six pairs of polypeptides described in claim 1 in pig H11 gene mutation storehouse is built.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410697370.5A CN104497110B (en) | 2014-11-27 | 2014-11-27 | Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410697370.5A CN104497110B (en) | 2014-11-27 | 2014-11-27 | Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104497110A CN104497110A (en) | 2015-04-08 |
| CN104497110B true CN104497110B (en) | 2017-04-26 |
Family
ID=52938577
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410697370.5A Active CN104497110B (en) | 2014-11-27 | 2014-11-27 | Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104497110B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016082135A1 (en) * | 2014-11-27 | 2016-06-02 | 中国农业科学院北京畜牧兽医研究所 | Method for porcine h11 site-specific insertion by using site-specific cleavage system |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102627692A (en) * | 2012-04-05 | 2012-08-08 | 浙江大学 | A pair of transcription activator-like effector nucleases and coding engines as well as application thereof |
| CN103013954A (en) * | 2012-12-17 | 2013-04-03 | 中国科学院遗传与发育生物学研究所 | Rice gene BADH2 site-directed knockout system and application thereof |
| WO2014089513A1 (en) * | 2012-12-06 | 2014-06-12 | Synthetic Genomics, Inc. | Autonomous replication sequences and episomal dna molecules |
-
2014
- 2014-11-27 CN CN201410697370.5A patent/CN104497110B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102627692A (en) * | 2012-04-05 | 2012-08-08 | 浙江大学 | A pair of transcription activator-like effector nucleases and coding engines as well as application thereof |
| WO2014089513A1 (en) * | 2012-12-06 | 2014-06-12 | Synthetic Genomics, Inc. | Autonomous replication sequences and episomal dna molecules |
| CN103013954A (en) * | 2012-12-17 | 2013-04-03 | 中国科学院遗传与发育生物学研究所 | Rice gene BADH2 site-directed knockout system and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 基因修饰和动物模型;陈雁如等;《科学通报》;20131030;第58卷(第30期);3030-3036 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104497110A (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2016082135A1 (en) | Method for porcine h11 site-specific insertion by using site-specific cleavage system | |
| CN103224947B (en) | Gene targeting system | |
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| CN104531685B (en) | sgRNA specifically recognizing pig H11 site, and coding DNA and application of sgRNA | |
| Yu et al. | Telomere-mediated chromosomal truncation in maize | |
| CN107604003A (en) | One kind knocks out kit and its application based on linearisation CRISPR CAS9 lentiviral vector genomes | |
| JP2005512537A5 (en) | ||
| CN107849562A (en) | Genome editing system and application method | |
| JP2005512535A5 (en) | ||
| JP2005512534A5 (en) | ||
| DK1824970T3 (en) | Thricoderma reesei glycoamylase and its homologs | |
| CN105481955B (en) | Fast-growing water plant nitrate transport protein GeNRT2.1 and its encoding gene and application | |
| CN109136248A (en) | Multiple target point editor carrier and its construction method and application | |
| MX2008000200A (en) | Polynucleotides encoding isoprenoid modifying enzymes and methods of use thereof. | |
| CN113403341A (en) | TALE assembly-based mitochondrial DNA editing system | |
| CN104497110B (en) | Six pairs of polypeptides for specific recognition of swine H11 site and coding gene and applications thereof | |
| DK1585822T3 (en) | Promoter variants for expression of genes in a fungal cell | |
| CN105602962A (en) | Application of SBP-box type transcription factors of switchgrass in aspect of increasing plant biomass and fermentable sugar yields | |
| CN101886087A (en) | Method for efficiently expressing DNA polymerase by using pichia pastoris | |
| CN108559731A (en) | A kind of human embryonic stem cell line of tetracycline-regulated gene expression and its application | |
| CN109722436A (en) | The carrier of the seamless editor of genome based on CRISPR-Cas9 and application | |
| CN102220328B (en) | Mulberry actin MaACT 3 promoter and application thereof | |
| CN101250509B (en) | High-temperature cutinase and gene order thereof | |
| CN103865898B (en) | The polypeptide of a pair of specific recognition sheep MMP2 gene and its encoding gene and application | |
| CN102250937A (en) | Construction method of recombinant plasmid vector p18-kan+/- containing loxP-kanr-loxP segments |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |