CN1044720C - Modified human granulocyte macrophagecolony stimulating factor gene and expression thereof in yeast - Google Patents

Abstract

The present invention relates to a modified human granulocyte macrophage colony stimulating factor group which is used for the mass production of hGM-CSF in yeast and contains a gene expression carrier. The present invention also relates to a method for converting yeast cells by the carrier and producing hGM-CSF by the yeast cells. The modified hGM-CSF gene has codons of optimized yeast, and can deactivate two N-interlocked glycosylated recognizing position points existing in natural GM-CSF.

Description

Human granulocyte-macrophage-G CFS the gene and the expression in yeast thereof of modifying

The present invention relates to human granulocyte macrophage colony stimulating factor (" hGM-CSF ") gene and its expression of a kind of modification; Relate in particular to a kind of hGM-CSF that is used in the modification of yeast mass production hGM-CSF, a kind of this expression carrier that contains, the described expression vector transformed yeast cells of a kind of usefulness and the method for producing described hGM-CSF with this yeast cell.

G CFS (CSF) is gang's lymphocyte factor (lymphokines), and it induces progenitor cell (progenitor) to be divided into the special type cell of mature blood cell.The mature blood cell that derives from the specific type of progenitor cell depends on the type of existing CSF.Known CSF type comprises G-CSF (Nicola et al., J.Biol.Chem.258 9017-9021 (1983)), M-CSF (Standley et al., J.Biol.Chem.252,4045-4052 (1977)), GM-CSF (Burgess et al., J, Biol.Chem.2521991-2033 (1977)) and multi-CSF (Burgess et.al., Biochem.J.185,341-343 (1980)).

The GM-CSF that known stimulation granulocyte-macrophage colony generates can produce in various cells, and this class cell comprises such as epithelial cell, scavenger cell and lymphocyte, and be used for the regeneration of hematopoietic cell, treatment exogenous infection and marrow sample leukemia.

1985, (Michael et al., P.N.A.S.826250-6254 (1984) separate the cDNA clone of the hGM-CSF that selects among whole cDNA clones of the mRNA preparation that obtains to obtain to encode from the T-lymphocyte of HUT-102 zooblast with mouse GM-CSF cDNA.With the yeast expression system that contains alpha factor promotor and alpha factor leading (leader) sequence, secreting, expressing goes out hGM-CSF from a kind of yeast cell.

Simultaneously, Nicholas etc. and Gordon etc. have also reported result (Nicholas etal., EMBO4, the 645-653 (1985) that expresses the hGM-CSF gene in the COS-1 zooblast respectively; And Gordon et al, Science 228,810-815 (1985)).

In addition, GM-CSF comprises the glycosylation recognition site that two N-connect, be aspartic acid-X-Serine and aspartic acid-X-Threonine (Asn-X-Ser and Asn-X-Thr, wherein X is any amino acid), therefore, it can the glycosylation form produce in zooblast or yeast cell between 35 to 100Kd with molecular weight, and this is the reason owing to the N-glycosylation of heterology.(Joachim?et?al.,Bio/Technology?5,831-834(1987))。

Thereby, be difficult to the glycosylated GM-CSF that produces in purifying animal or the yeast cell; Therefore yield poorly.

In addition, it is reported that the GM-CSF gene of mouse is identical with the nucleotide sequence of human GM-CSF about 50%, but the codon that also comprises the glycosylation recognition site that two N-of coding connect, this gene comes out at expression in escherichia coli, and have identical biological activity with natural mouse GM-CSF, although the GM-CSF for preparing is not by glycosylation.(DeLamarter?et?al.,EMBO4,2575-2581(1985))。

Yet, to compare as host cell with yeast, intestinal bacteria have weak point, and the hGM-CSF that promptly prepares in intestinal bacteria may be by intestinal bacteria native protein such as contaminated with endotoxins, and is although after being purifying, also possible.And yeast does not produce any harmful material, fact proved: yeast has been used several centuries in food-processing industry.Therefore, a large amount of glycosylated hGM-CSF of nothing-N-that produce are desirable in yeast.

According to the present invention, discovery can be expressed the hGM-CSF gene after a kind of the modification in yeast, have the hGM-CSF of the high yield of molecular weight much at one with preparation.The nucleotide sequence of the hGM-CSF gene after the modification is modified to the codon with yeast preferred (Yeast-preferred), this codon tends to the yeast genes of strong expression, such as, glyceraldehyde-3-phosphate (ester) dehydrogenase gene and alcohol dehydrogenase gene (Bennetzen, J.M.﹠amp; Hall, B.D., J.Biol.Chem.257,3026 (1982)) and do not change wherein aminoacid sequence, and, keep the biological activity of described hGM-CSF simultaneously by aminoacid replacement deactivation N-glycosylation site.

Therefore, the object of the present invention is to provide the hGM-CSF gene after a kind of effective modification, it is used in the glycosylated hGM-CSF of a large amount of preparation nothing-N-in the yeast.

Another object of the present invention is to provide a kind of contains described hGM-CSF expression carrier and uses the expression vector transformed yeast cells.

Further purpose of the present invention is to provide a kind of not to be had-method of N-glycosylation hGM-CSF with Yeast transformant production.

Therefore, one aspect of the present invention provides a kind of hGM-CSF gene with the nucleotide sequence as shown in Fig. 1-a or Fig. 1-b, comes a large amount of glycosylated hGM-CSF of nothing-N-of preparation in yeast with this gene.

On the other hand, provide a kind of yeast cell that contains after this carrier of described hGM-CSF expression carrier and a kind of usefulness transforms.

One side more of the present invention provides a kind of under the culture condition of suitable expression hGM-CSF, in containing the yeast of cultivating this Yeast transformant, prepares the methods of the glycosylated hGM-CSF of nothing-N-in a large number.

Brief Description Of Drawings:

Fig. 1-a and 1-b represent the nucleotide sequence of the hGM-CSF gene that the present invention modifies and the aminoacid sequence in its source.

Fig. 2 has described the nucleotide sequence of coding for alpha factor leader sequence and the aminoacid sequence in its source.

Fig. 3 represents that structure contains the hGM-CSF gene, to express the schema (Strategy) of the hGM-CSF expression carrier of modifying in yeast.

Fig. 4 is illustrated under the felicity condition of expressing the hGM-CSF gene, the result of the SDS-polyacrylamide gel electrophoresis of culturing yeast transformant.

The hGM-CSF gene of modification of the present invention is designed to have ferment Female preferred codon (yeast-preferred codons), and two N of deactivation The glycosylation recognition site of-connection, this gene has such as Fig. 1-a or Fig. 1 The nucleotide sequence of-b, this sequence can or be passed through with dna synthesizer The direct mutagenesis in site (P.N.A.S.82 488 (1985) for Kunkel, TA.), Adopt the hGM-CSF gene of having cloned to come chemical synthesis.

For example, available M13 mp18-GM-CSF carrier (KFCC-10711; See Korean Patent Appln.No.90-21308) hGM-after preparation is modified The CSF gene. This carrier contains to be modified into and has yeast preferred codon HGM-CSF gene (Bennetzen J.M.and Hall B.D.J.of Bio. Chem.257 3026-3031 (1982)). Adopt the direct mutagenesis technology in site, The codon that replaces on the site with other amino acid code comes deactivation hGM-Two N-of CSF connect the glycosylation recognition site, use subsequently suitable limit again HGM-CSF gene after the modification that property restriction endonuclease digestion processed obtains is made and is repaiied HGM-CSF behind the decorations.

Can for the expression vector of the present invention of expressing described hGM-CSF gene Be prepared with the various expression systems that can in yeast, operate by use. Press According to the preferred embodiment of the invention, through containing the carrier of A/G hybrid promoter HGM-CSF after middle clone modifies (sees Korean Patent appln.No. 89-20200, the applicant's application case) the preparation expression vector, wherein, In the preparation process, with GAPDH (glyceraldehyde-3-phosphate (ester) dehydrogenase) " the TATA box " of promoter, a strongest Yeast promoter, and ADH2 The upstream activating sequence of (Alcohol Dehydrogenase 2) (the upstream activation Sequence. " UAS ") connect.

Preferably, the hGM-CSF gene after the modification can be with one of coding The dna fragmentation of α factor targeting sequencing is connected, because described hGM formerly The α factor targeting sequencing of-CSF front makes hGM-CSF be secreted into cultivation In the base, before secretion, described targeting sequencing (leader sequence) quilt Cut off, thereby in culture medium, can easily be purified into hGM-CSF.

For example, expressing the expression vector of the hGM-CSF after described the present invention's the modification can be through following method preparation:

Synthetic two primer AL1 and AL2 are to prepare the egg that produces in yeast The dna fragmentation of the coding for alpha factor targeting sequencing in the white excretory system. Primer AL1 is designed to have restriction enzyme Bst B I recognition site, to connect Be positioned at the Bst B I recognition site of heterozygosis A/G promoter 3 ' one end; And primer AL2 is designed to have a restriction enzyme Xba I recognition site; It Be positioned at away from from targeting sequencing to 3 ' one end that connects with other dna fragmentation 10 base-pairs. Adopt above-mentioned primer AL1 and AL2, from whole yeast Nucleic acid zooms into the α factor targeting sequencing with about 240 base-pairs. (see Janet Kurjan and Ira Herskowitz, Cell 30,933-943 (1982)).

Be connected through 5 ' one petiolarea of the postdigestive A/G promotor of restriction enzyme Bst B I 3 '-petiolarea with the described alpha factor leader sequence of coding, obtain (Segment A) fragment of about 1300 base pairs, this fragment is being limited property restriction endonuclease BamH I and the digestion of Xba I then.

On the other hand, the M13mp18-GM-CSF that is modified into two N-glycosylations of deactivation recognition site through special mutagenesis obtains a hGM-CSF gene fragment of modifying with restriction endonuclease Xba I and the digestion of Sal I.

The hGM-CSF fragment cloning that will contain the Segment A of A/G promotor and alpha factor leader sequence and modification is to pYLBC-A/G-UB-HGH (ATCC74071), between a kind of restriction enzyme BamH I of Yeast expression carrier and the recognition site of Sal I, contain hGM-CSF gene after the modification with preparation.

The employing ordinary method (Beggs, Nature 275,104 (1987); AndHinnen et al., Proc.Natl.Aca.Sci.U.S.A.75,1929 (1978)) with expression vector transformed yeast cell of the present invention.

According to the present invention, obtain an expression vector, it contains just like the hGM-CSF gene after the modification shown in Fig. 1-a, this carrier is called as LUCK-GM-CSF-1Y, S. cervisiae (Saccharomyces cerevisiae) LUCK-GM-SCF-1Y that transforms with this carrier is deposited in Chinese Wuhan CCTCC on June 24th, 1993, and preserving number is 93031.Also be deposited in Korea S microorganism culturing preservation mechanism (Korean Federation of Culture Collections ofMicroorganisms) in addition in December 12 nineteen ninety.Its preserving number is KFCC-10716, in addition, on May 20th, 1992 this bacterial strain is transferred to the preservation of the budapest treaty approval of the microbial preservation that relates in the international monopoly program again, and its preserving number is KCCM-10028.

With the hGM-CSF expression carrier transformed yeast cells that contains after the modification, can under the condition of expressing this gene, cultivate, this condition depends on the feature of carrier and its host's yeast cell.The glycosylated hGM-CSF of nothing-N-that produce or that be secreted in the substratum can be separated at Yeast transformant, and with conventional the whole bag of tricks purifying it, for example, the cell rupture method, centrifuging, dialysis, salting-out process, chromatography, gel filtration method, electrophoretic method and electroelution method (electroelution).

The biological activity of the hGM-CSF that makes can adopt ELISA (enzymelinkedimmunoad sorbent assay) method to measure.

The productive rate of hGM-CSF after the modification is to contain the 50 μ g that have an appointment in the supernatant liquor of every ml cells nutrient solution, and this is all higher than productive rate well known in the prior art.

Following embodiment is used to specify the present invention, and unrestricted its scope; The visible following reference example of the experimental technique that adopts among the embodiment.

Unless have except the specified otherwise person, following solid and solid mixture, the per-cent of liquid and liquid and solid and liquid is wt/wt, vol/vol, wt/vol.

Reference example 1 digestion with restriction enzyme DNA

Restriction enzyme that adopts in this example and reaction buffer are all buied from NEB (New England Biolabs.U.S.A.).

Usually react in the Eppendorf test tube of the sterilization of 1.5ml, its reaction volume is 50-100 μ l, 37 ℃ 1 to 2 hours.Subsequently, 65 ℃ of heat treated reaction mixtures 15 minutes (perhaps using ethanol sedimentation with phenol extraction or in the thermotolerance restriction endonuclease) are with the deactivation restriction enzyme.

10x reaction buffer in order to restriction enzyme reaction has following component:

1,10xNEB reaction buffer 1:100mMbisTris propane-HCl, 100mM MgCl ₂, 10mM dithiothreitol (DTT) (DTT), pH7.0;

2,10xNEB reaction buffer 2:100mM Tris-HCl, 100mMMgCl ₂, 500mM NaCl, 10mM DTT, pH7.0;

3,10xNEB reaction buffer 3:100mM Tris-HCl, 100mMMgCl ₂, 10mM DTT, pH7.0;

4,10xNEB reaction buffer 4:100mM Tris-acetate, 100mM manganous acetate, 500mM potassium acetate, 10mM DTT, pH7.0;

Reference example 2 phenol extractions and ethanol sedimentation

After enzyme reaction is finished, use the phenol extraction reaction mixture, its objective is for inactivator, or the DNA in the recovery reaction mixture, wherein, with the phenol that contains 10mM Tris-HCl (pH8.0) and 1mM edta buffer liquid reequilibrate.Shake isometric sample of mixed phase and phenol strongly and carry out phenol extraction; 15,000rpm, 5 minutes centrifugal described mixtures; With water layer transfer to one in vitro new.Above-mentioned step two or three times repeatedly.

Then, use the chloroformic solution (chloroform: primary isoamyl alcohol=24: 1) extract water layer, separate water layer again of same volume again; The 3M sodium acetate and the 2.5 volumetrical ethanol that add 0.1 (volume); And deposited 30 minutes or placed-20 ℃ after following 12 hours at-70 ℃, with 15,4 ℃ of 00rpm rotating speeds are centrifugal these mixtures 20 minutes down, therefrom reclaim nucleic acid.

Reference example 3 ligations (Ligation Reaction)

Adopt T4DNA ligase enzyme and 10x ligation damping fluid (0.5M Tris-HCl, 0.1M MgCl ₂, 0.2M DTT, 10Mm ATP, 0.5mg/ml bSA (BSA)) reagent all bought from NEB carries out DNA and connects.Reaction volume is generally 20 μ l, connects the sticky end of DNA with the T4 ligase enzyme of 10 units, and connects the passivity end of DNA with the T4 ligase enzyme of 100 units.

Under 16 ℃, reacted 5 hours, or under 4 ℃, reaction is more than 14 hours; After reaction finishes, with 65 ℃ of these reaction mixtures of heating 15 minutes, with deactivation T4DNA ligase enzyme.

Reference example 4 colibacillary conversions

The coli strain that is used for the embodiment of the invention comprises E.coli HB101 (ATCC 33694), E.coli W3110 (ATCC 27325), and E.coliJM105 (ATCC 47016).

At liquid substratum (the 1% bacterium tryptones (Bactotyptone) of the LB of 100ml, 0.5% bacterium yeast extract (Bacto yeast extract), cultivate host cell 0.5%NaCl), culture temperature is 37 ℃, up to the suitable optical density value (O.D) that reaches at the 650nm place between about 0.25-0.5.The centrifugal separating cell culture is used 50ml0.1MgCl then ₂The solution flushing.The 0.1M CaCl that adds 50ml in the centrifugal cell precipitation that obtains ₂With 0.05M MgCl ₂Solution, left standstill in the ice bath then 30 minutes.Use centrifugal separating cell, then it is suspended in the 0.1M CaCl of 5ml ₂With 0.05M MgCl ₂In the solution.The material of above-mentioned used reagent will be cooled to 0 ℃ before use.

The ligation mixture that in the cell suspension of 0.2ml, adds 10 μ l; 0 ℃ left standstill this reaction mixture 40 minutes, and 42 ℃ were heated 1 minute then.To the liquid substratum of the LB that wherein adds 2.0ml; The cell that 37 ℃ of following cultivations were so handled 1 hour.Then culture is moved into and contain in the culture dish (Petri dish) of LB solid medium, contain suitable microbiotic in this substratum, as penbritin, 37 ℃ of following incubated overnight obtain the transformant colony.

With M13 carrier transformed into escherichia coli the time, JM105 cell suspension to M13 carrier DNA (the connection gene) adding 100 μ l, 10mM isopropyl ss-thio-galactose pyran-glucoside of 15 μ l (isopropyl β-thioglacto-pyranoside), 25 μ l4%X-Gal and 3ml 2xXYT soft solid substratum (1%NaCl, 10% yeast extract, 1.6% bacterium tryptones (Bacto tryptone), 0.7% bacteria Agr (Bacto agar)), mentioned component all is heated to 38 ℃ of substratum in advance.Stir this mixture, change 2xYT solid medium (1%NaCl, 1% yeast extract, 1.6% bacterium tryptones, 1.5% bacteria Agr) again over to, and 37 ℃ of overnight incubation, bacterial plaque obtained.

Synthesizing of reference example 5 oligonucleotides

With automatic solid phase phosphamide chemical dna synthesizer (AppliedBiosystems Inc., 380B, U.S.A) synthetic oligonucleotide.

Polyacrylamide gel (2M urea, 12% acrylamide and bis acrylamide (29: 1), 40mM Tris, 50mM boric acid, 1mM EDTA-Na with sex change ₂) electrophoresis and with acetonitrile and water (50: 50) mixture as the SEP-PAK post layer chromatography of eluent (Waters Inc., U.S.A), purifying synthetic oligonucleotide.The O.D. value at 260nm place is judged its quantity after measured.

The direct site mutagenesis of embodiment 1 hGM-CSF gene

Step 1: the structure of primer

Two N-of hGM-CSF connect the 23rd to 42 aminoacid sequence that glycosylation site (Asn-Leu-Thr andAsn-Glu-Ser) is positioned at following hGM-CSF, and it is encoded by following corresponding nucleotide sequences: 5 ＇--AGAAGATTGTTGAACCTATCAAGAGACACTGCTGCTGAAATGAACGAAACTGTTGA AGTT-3 ＇ 3 ＇---TCTTCTAACAACTTGGATAGTTCTCTGTGACGACGACTTTACTTGCTTTGACAACT TCAA-5 ＇

ArgArgLeuLeuAsuLeuSerArgAspThrAlaAlaGluMetAsnGluThrValGluVal

Two N-connect glycosylation site for deactivation, prepare two primer CSF1 and CSF2 with following coding following amino acid sequences:

The CSF1 primer (is used for replacing respectively with Ala the Ser of two glycosylation sites

Thr) 5 ＇--AGAAGATTGTTGAACCTAGCAAGAGACACTGCTGCTGAAATGAACGAAGCTGTTGA AGTT-3 ＇ 3 ＇---TCTTCTAACAACTTGGATCGTTCTCTGTGACGACGACTTTACTTGCTTCGACAACT TCAA-5 ＇

ArgArgLeuLeuAsnLeuAlaArgAspThrAlaAlaGluMetAsnGluAlaValGl uYalCSF2 primer (being used for replacing respectively the Asn in two sites) 5 ＇ AGAAGATTGTTGGCCCTATCAAGAGACACTGCTGCTGAAATGGCCGAAACTGTTGA AGTT-3 ＇ 3 ＇---TCTTCTAACAACCGGGATAGTTCTCTGTGACGACGACTTTACCGGCTTTGACAACT TCAA-5 ＇ with Ala

ArgArgLeuLeuAlaLeuSerArgAspThrAlaAlaGluMetAlaGluThrValGluVal

Step 2: directly site mutagenesis

Adopt two primer CSF1 and CSF2, carry out following direct site mutagenesis:

(USA), and 37 ℃ cultivated 6 hours the intestinal bacteria CJ236 of inoculation 1 μ l in the 20ml of the paraxin that contains 30 μ g/ml LB liquid nutrient medium for Cat#170-3571, Bio-Rad Lad.With 10 ⁸M13mp18-GM-CSF M13 phage is inoculated in this culture, further 37 ℃ of overnight incubation.After centrifugal culture is removed cell precipitation, in the supernatant liquor that obtains, add the RNaseA of 100 μ g; Resultant continues reaction 30 minutes./ 5th volumetrical 20%PEG (polyethylene glycol) solution is added in the throw out M13 phage; Throw out is dissolved in the 100 μ l TE solution (10mM Tris-HCl1mM EDTA, pH7.5).Extract the solution that obtains with phenol or phenol/chloroform.Ethanol sedimentation then must contain the water of phage single-chain nucleic acid.To the nucleic acid mixture of the about 100ng that obtains, 10x damping fluid (200mM Tris-HCl, pH7.4, the 20mM MgCl of the primer CSF1 of 2 to 3 picomole (pmoles) or CSF2 and 1 μ l ₂, 50mM NaCl) in add distilled water and make 10 μ l volumes; Reaction mixture was heated 5 minutes down at 70 ℃, be cooled to 30 ℃ then gradually.

The 10x damping fluid (every kind of each 5mMdATP, dCTP, TTP and dGTP, 100mM Tris, pH7.4, the 5mM MgCl that in reaction mixture, add 1 μ l ₂, 20mM DTT) and the T4DNA polysaccharase of 1 μ l (1 unit/ml); With following program reaction 5 minutes, 25 ℃ were reacted 5 minutes the mixture that obtains in ice bath, and 37 ℃ were reacted 90 minutes.

After reaction is finished, add remaining on 90 ℃ TE solution and this mixture-20 ℃ being preserved down of 90 μ l.

By the method described in the reference example 4 of the present invention, with the product mixture transformed into escherichia coli JM105 of 2-3 μ l.

Second day, be chosen in the hickie that occurs on the YT substratum, and go up cultivation at YT broth culture (YT brothe medium); Therefrom separate (two strands) DNA that duplicates and digest it with restriction enzyme Pst I, electrophoresis confirms the size of the dna fragmentation of digestion then.The patch that selection contains the dna fragmentation of about 300bp length obtains the transformant through the GM-CSF gene of primer CDF1 and CSF2 modified, and this transformant is called as mGM-CSF1 and mGM-CSF2.

Use Sanger ' s dideoxy method (P.N.A.S.74 5463 (1997)) to measure its nucleotide sequence, it the results are shown in Figure 1-a and Fig. 1-b.

The reagent that present method is used, enzyme and cell all come the direct site mutagenesis medicine box (Cat.#170-3571) bought since BIO-RAD Lab.

Embodiment 2

The separation of yeast total nucleic acid

At the YEPD of 50ml substratum (1% yeast extract, 2% peptone, 2% glucose) cultivate yeast saccharomyces cerevisiae DC04 (Yeast Genetic StockCenter in, University of California, Berkeley, CA, U.S.A) 24 hours, with Dynatec Clinical whizzer, with centrifugal 5 minutes sedimentation cells of 5000rpm.Sedimentary cytolysis in the 1M of 10ml Sorbitol Powder, was obtained cell in centrifugal 5 minutes with 5000rpm then.The SD solution (1M Sorbitol Powder, 50mM potassium phosphate buffer, the 1M DTT of pH7.5 and 5 μ l that in throw out, add 5ml.The uniform mixing reactant; Again to the zymolase that wherein adds 1mg (zymolase) (Miles Inc., U.S.A).The mixture that obtains kept 30 minutes down at 30 ℃, with 16,000 * G centrifugal 5 minutes again, obtained the cell precipitation thing.

The cell precipitation thing that generates is dissolved in the TE damping fluid (1mM Tris, pH7.5,1Mm EDTA) of 5ml, adds the 0.5M DETA of 0.5ml and the 10%SDS of 0.25ml then.Reaction mixture remains on 65 ℃ at thing, and 30 minutes, then to the 5M Potassium ethanoate that wherein adds 1ml.The mixture that generates reacted in ice bath 1 hour, more centrifugal 25 minutes separation of supernatant of 20,000 * G.The ethanol sedimentation supernatant gets the total nucleic acid throw out.

Dry sediment also is dissolved in it in TE damping fluid of 50ml again.(U.S.A), 37 ℃ kept this mixture 30 minutes to the RNase I of adding 20 μ l in the solution that obtains for 10mg/ml, BRL.

Use phenol: chloroform: twice in primary isoamyl alcohol (25: 24: 1 volumes) abstraction reaction mixture; In supernatant liquor, add 2 volumetrical ethanol, be settled out total nucleic acid.

The throw out that obtains is dissolved in the TE damping fluid of 0.5ml with further use.Embodiment 3

The DNA of coding for alpha factor leader sequence and A/G hybrid promoter

With the synthetic known alpha factor leader sequence of PCR method, this sequence participates in yeast cell to cell exocrine albumen (seeing Cell 30 933-943 (1982)).

Synthetic primer AL1 with following nucleotide sequences, have restriction enzyme Bst B I recognition site so that the alpha factor leader sequence is connected 3 ' the one end place of heterozygosis A/G promotor of (5 '-TTCGAA-3 ').

Synthetic primer AL2 to 23-mers with following nucleotide sequences, this 23mers contain 3 ' end of a restriction enzyme Xba I recognition site and alpha factor leader sequence encoding gene.

Primer AL1:

Bst?BⅠ5＇-AGT-TTCGAA-TAAACACACATAAACAAACACC-ATGAGATTTCCTTCAATTT-3＇

3＇-end?of?GAPDH?promoter?5＇-end?of?alpha?factor

Primer AL2:5 ＇-TCTCTTA-TCTAGA-GATACTTCTT-3 ＇

XbsⅠ

To 1 μ l from the cerevisiae dna among the embodiment 2 in add 10x Taq damping fluid (100mM Tris, pH8.3,500mM KCl, the 15MmMgCl of 10 μ l ₂, 0.1% gelatin), the dNTP ' s of 10 μ l (following each material of 1.25mM: dGTP, dATP, TTP and dCTP), the primer AL1 of 2 μ g, the primer AL2 of 2 μ g, the Ampli TaqDNA polysaccharase of the distilled water of 68.5 μ l and 0.5 μ l (5 units/μ l); The solution that thorough mixing is made.After adding the mineral oil of 50 μ l, carry out 25 PCR reactions with thermal cycling, temperature is: 95 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 1 minute, be reflected at 72 ℃ and continue reaction 10 minutes again.Extract the PCR product with phenol/chloroform.Ethanol sedimentation; The throw out that generates is dissolved in the TE damping fluid of 20 μ l.The nucleic acid fragment of gained is referred to as " Segment A ".

Embodiment 4

The preparation of expression vectors of secrete GM-CSF from yeast

＜step 1 〉

Use restriction enzyme Bst B I and Xba I simultaneously, digestion separates the big fragment that is referred to as " Segment A-B/X " through the Segment A that embodiment 3 obtains about 1 μ g in NEB buffered soln 4.

In addition, with the M13mp18 DNA that contains mGM-CSF1 (or mGM-CSF2) that obtains among restriction enzyme Xba I and the Sal I digestion embodiment 1, to isolate the fragment of about 410bp, the 13bp of alpha factor of carboxyl petiolarea of wherein encoding is connected on the mGM-CSF1 (or mGM-CSF2), and this fragment is referred to as " fragment mGM-CSF1-X/L (or mGM-CSF2-X/L) ".

＜step 2 〉

With restriction enzyme Pst I and Sal I digested plasmid pYLBC-A/G-UB-HGH (ATCC 74071), acquisition contains the 9750bp fragment of the terminal signaling sequence of glyceraldehyde-3-phosphate dehydrogenase, and this fragment is referred to as " fragment PL ".Digest described plasmid with restriction enzyme Pst I and Bst B I, acquisition is referred to as the fragment of the 3400bp of " fragment PB ".

Two above-mentioned fragments connect as follows:

10x to 2 μ l connects damping fluid (600mM Tris, pH7.5,10mMDTT, 100mM MgCl ₂), the 10mM ATP of 2 μ l, the T of 1 unit ₄Add distilled water in the mixture that the mGM-CSF1-X/L of dna ligase and 100ng (or mGM-CSF2-X/L) and the Segment A-B/X that obtains through step 1 form and make cubic capacity 20 μ l.

Reaction mixture left standstill 6 hours for 16 ℃.Subsequently, adopt this connection mixture to carry out the conversion of intestinal bacteria HB101 (ATCC33694) by reference example 4.Select transformant in containing the agar plate of penbritin, separation from then on contains the hGM-CSF expression carrier after alpha factor leader sequence and the modification.This carrier is referred to as " LUCK-GM-CSF-1Y (or LUCK-GM-CSF-2Y).

Use the nucleotide sequence of the isolated carrier of Sanger ' s dideoxy method sequencing.All schemas that make up above-mentioned expression vector as shown in Figure 3.

Embodiment 5

With the expression vector transformed yeast and through its expression of SDS-polyacrylamide gel determination

According to people such as Hinnen (P.N.A.S79,1929 (1978)) method of Pi Luing, with expression vector transformed saccharomyces cerevisiae DC04 (the Saccharomyces cerevisiae DC04 that obtains through embodiment 4, Yeast Genetic Stock Center, University of California, Berkeley, CA, USA).

(6.7g does not have amino acid yeast nitrogen (yeastnitrogen base without amino acid) to the agar plate that lacks at leucine, the 182g Sorbitol Powder, 2% glucose, 0.25%Leu-amino acid complement, the 20g bacteria Agr) selects transformant, and it is seeded to YEPD substratum (2% peptone, 1% yeast extract of 20ml, 2% glucose), cultivated 3 days for 30 ℃.

When the O.D of 650nm place value reaches approximately 25 the time, get the culture of 1ml, centrifugal removal yeast cell.In substratum, add 5 times of protein concentrate precipitation solutions of 250 μ l (50% trichoroacetic acid(TCA) and 2% Septochol); The mixture of making left standstill in ice bath 10 minutes, with 20,000 * G centrifugal 10 minutes.With the throw out that 1ml acetone wash-out obtains, 20,000 * G is centrifugal 10 minutes again, and then washes twice with acetone.Throw out is dissolved in the TE damping fluid of 20 μ l (10mM Tris-Cl, pH7.5,1ml EDTA); Pour the mixture that obtains 3 times of spissated Laemmli sample buffers (Laemmli DK., Nature 227,680 (1970)) of 10 μ l into, 100 ℃ boil and boil 3 minutes.The mixture of making is measured with the 15%SDS-polyacrylamide gel electrophoresis, and it the results are shown in Figure 4.

In Fig. 4, swimming lane 1 illustrates the mark (Bio-Rad Lab.USA) of standard protein size, and its expression molecular weight is respectively 43,000 from top to bottom; 29,000; 18,400; 14,300; 6,200 and 3,000 dalton, swimming lane 2 illustrates the substratum of the yeast cell culture that contains expression vector LUCK-GM-CSF-1Y; Swimming lane 3 illustrates the substratum of the zymic cell culture that contains expression vector LUCK-GM-CSF-2Y; Swimming lane 4 illustrates the yeast cell extract that contains expression vector LUCK-GM-CSF-1Y; Swimming lane 5 is showed the yeast cell extract that contains expression vector LUCK-GM-CSF-2Y.

Demonstrate among its swimming lane 2 and 3 the result one dark-coloured be 14 corresponding to molecular weight, 000 band, verified, this expresses justacrine in substratum (every milliliter of about 50 μ ghGM-CSF of substratum) in yeast cell, have the hGM-CSF albumen of molecular weight much at one.The result who draws from swimming lane 4 and 5 shows, proves the hGM-CSF albumen that also remains with a small amount of generation in yeast cell.

Therefore, GM-CSF albumen of the present invention can be expressed, and secretes yeast cell, has higher productive rate than original hGM-CSF gene.Further confirm the biological activity of oozy hGM-CSF from yeast with the ELISA method.

In the above-mentioned embodiment that elaboration the present invention relates to, will be appreciated that for those skilled in the art and can carry out various improvement and change, but also be to fall within the scope of claim of the present invention it.

Claims (6)

1, a kind of human rHuGM-CSF gene, its nucleotide sequence is modified to the glycosylation recognition site of the N-connection that has the preferred codon of yeast and have two deactivations, this site is arranged in human rHuGM-CSF, and described gene has following nucleotide sequence:

mGH-CSF1

- - 30 - - 605＇-ATGGCTCCAGCTAGATCTCCATCTCCATCTACTCAACCTTGGGAACACGTTAACGCTATC

- - 90 - - 120

CAAGAAGCTAGAAGATTGTTGAACCTAGCAAGAGACACTGCTGCTGAAATGAACGAAGCT

- - 150 - - 180

GTTGAAGTTATCTCTGAAATGTTCGACTTGCAAGAACCAACTTGTTTGCAAACTAGATTG

- - 210 - - 240

GAGCTCTATAAGCAAGGTTTGAGAGGTTCATTGACTAAGTTGAAGGGTCCATTGACTATG

- - 270 - - 300

ATGGCTTCTCACTACAAGCAACACTGTCCACCAACTCCAGAAACTTCTTGTGCTACTCAA

- - 330 - - 360

ATCATTACTTTCGAATCTTTCAAGGAAAACCTAAAAGACTTCTTGTTGGTTATTCCATTC

- - 390

GACTGTTGGGAACCAGTTCAAGAATAATAG-3 ＇ or

mGM-CSF2

- - 30 - - 60 5′-ATGGCTCCAGCTAGATCTCCATCTCCATCTACTCAACCTTGGGAACACGTTAACGCTATC

- - 90 - - 120

CAAGAAGCTAGAAGATTGTTGGCCCTAGCAAGAGACACTGCTGCTGAAATGGCCGAAGCT

- - 150 - - 180

GTTGAAGTTATCTCTGAAATGTTCGACTTGCAAGAACCAACTTGTTTGCAAACTAGATTG

- - 210 - - 240

GAGCTCTATAAGCAAGGTTTGAGAGGTTCATTCACTAAGTTGAAGGGTCCATTGACTATG

- - 270 - - 300

ATGGCTTCTCACTACAAGCAACACTGTCCACCAACTCCAGAAACTTCTTGTGCTACTCAA

- - 330 - - 360

ATCATTACTTTCGAATCTTTCAAGGAAAACCTAAAAGACTTCTTGTTGGTTATTCCATTC

- - 390

GACTGTTGGGAACCAGTTCAAGAATAATAG-3′

2, a kind of expression vector that can in yeast cell, operate, the human granulocyte macrophage colony stimulating factor gene that comprises A/G hybrid promoter and the described modification of claim 1, described A/G hybrid promoter contain the TATA frame of GAPDH promotor and the UAS of ADHZ promotor.

3, expression vector as claimed in claim 2, this expression vector are LUCK-GM-SCF-1Y or LUCK-GM-SCF-2Y shown in Figure 3.

4, a kind of yeast cell that transformed with the described expression vector of claim 3.

5, yeast cell as claimed in claim 4, this yeast cell are yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) LUCK-GM-CSF-1Y, CCTCC No93031.

6, a kind of production method of human rHuGM-CSF comprises and cultivating as claim 4 or 5 described yeast cell.

Images