CN104450919A - Method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide - Google Patents
Method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide Download PDFInfo
- Publication number
- CN104450919A CN104450919A CN201410768055.7A CN201410768055A CN104450919A CN 104450919 A CN104450919 A CN 104450919A CN 201410768055 A CN201410768055 A CN 201410768055A CN 104450919 A CN104450919 A CN 104450919A
- Authority
- CN
- China
- Prior art keywords
- gene
- tolerance
- nnt
- nucleic acid
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention discloses a method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide. The method comprises the following steps: adding restriction endonuclease sites on the terminals of synthesized NNT and/or NNC strand nucleic fragments, directly connecting vector fragments subjected to restriction enzyme digestion, introducing vectors into host cells, expressing the host cells to generate a series of mutant nucleic acids with unequal lengths and different sequences, and testing the expression activity of the mutant nucleic acids so as to assess the tolerance capability of gene mutation. The method has the advantages including that whether a tested gene has base use bias can be tested; in addition, whether the insertion length of the tested gene is strictly limited can be tested.
Description
Technical field
The present invention relates to technical field of molecular biology, be specifically related to a kind of method target spot assessed and screens, particularly a kind of method utilizing part to wave oligonucleotide insertion detection transgenation tolerance.
Background technology
Zinc finger nuclease (Zinc finger nuclease), to go back to the nest nuclease (meganuclease), the genetically engineered enzymes such as anti-factor nucleic acid enzyme (TAL nuclease) and CRISPR-Cas nuclease, it is all the new enzyme that can carry out gene editing, have a very important role in gene editing, can be used for the transformation of species gene, the preparation of animal model, the preparation of cell strain, and gene therapy studies and clinical application.
But extensively carrying out along with gene therapy research, become increasingly conspicuous to its shear efficiency with the evaluation problem of effect of missing the target, its shear efficiency of gene therapy that gene editing nuclease is used for human diseases is equivalent to traditional small-molecule drug working efficiency, its effect of missing the target then is equivalent to toxic side effect, medicine enter clinical before must be assessed.The effect detection technology of missing the target of the efficient genetically engineered enzyme of current shortage, several targeted effect or the enzyme activity detection technique that comprise high-flux sequence can be used for detecting effect of significantly missing the target, but the miss the target effect lower to occurrence frequency, then cannot detect.
But along with the development of gene therapy research, increasing therapy target needs to carry out assessing and screening, and this is just for the extensive representativeness of gene therapy nuclease appraisal procedure causes difficulty.At present for the assessment of method, be mostly that namely the some target spots of employing inspection are inferred as the working order to all target spots, this kind of working method easily causes the phenomenon Lou commented, and to accomplish comprehensive assessment, then workload is huge.
Therefore be badly in need of exploitation one and there is the extensive representational method of inspection, for the assessment to nuclease appraisal procedure.The present invention comes therefrom.
Summary of the invention
The technical problem of first aspect to be solved by this invention, is to overcome therapy target in prior art and carries out assessing and screening Problems existing, provides a kind of and waves by insertion portion the method that oligonucleotide detects transgenation tolerance.
In order to solve above-mentioned technical problem, the invention provides a kind of method of being waved oligonucleotide detection transgenation tolerance by insertion portion, its feature is, comprises the steps:
(1) adopt NNT and/or the NNC series connection nucleic acid fragment of synthesis, add the restriction enzyme site of restriction enzyme at its end,
(2) directly connection cuts the carrier segments after process through enzyme, by vector introduction host cell,
(3) host cell produces one is length can not wait the mutant nucleic acid different with sequence,
(5) by the expression activity of inspection mutant nucleic acid, assess and detect transgenation tolerance.
An optimal technical scheme of the present invention, NNT and/or the NNC series connection nucleic acid fragment of synthesis in described step (1), its multiplicity is 1-30.
An optimal technical scheme of the present invention, the N in described NNT and/or NNC is selected from A, T, C, G.
An optimal technical scheme of the present invention, described carrier is the carrier with ability to express complete structure, includes but not limited to plasmid vector, the carrier that also can build with virus vector or other target genes.
A second aspect of the present invention, provides a kind of method utilizing part to wave oligonucleotide insertion detection transgenation tolerance to be used for detecting gene tolerance sudden change ability.
An optimal technical scheme of the present invention, described gene tolerance sudden change ability refers to that the ability of specific A, T, C, G is selected at wobble bases position in mutant.
An optimal technical scheme of the present invention, described gene tolerance sudden change ability refers to the changing conditions of the multiplicity of wobble bases in mutant.
In actually operating aspect, be no matter considering of time or economy, all can not verify one by one the target sequence of ten hundreds of genetically engineered enzymes.By sudden change ability detection technique provided by the invention, then can carry out the evaluation of gross mutation tolerance to it.
The present invention adopts NNC and NNT of repetition, avoids TAA, TAG, and TGA, thus reaches the situation avoiding occurring terminator codon.Here N represents A, any one in T, C, G, and this represents that namely NNT or NNC can have 4X4 kind sequence, 16 kinds of codons.If adopt the nucleic acid fragment of NNT or NNC series connection formation as Insert Fragment, then can have (4 in each fragment
4x4)
nplant possibility, also namely can obtain 16 of different aminoacids of encoding at random
nplant codeword triplet.Once our method of assessing does not show any Preference for the insertion of such nucleic acid fragment, then can represent in application from now on that it does not exist singularity Base selection preference for specific target sequence.
In sum, the method has convenient, economic advantage, once experiment can represent multi-pass operations inspection, and the method practicality is wide, not only can be used for the assessment of nuclease appraisal procedure, at other field as in protein research, also single test can cause mass mutation, experiment high-throughput is carried out.
The explanation of relational language and explanation in the present invention
According to the present invention, term " gene " refers to the nucleotide sequence containing specific genetic information, is the minimum working energy unit of genetic material.
According to the present invention, term " transgenation " word refers to unexpected, heritable variation phenomenon that genomic DNA molecule occurs.From molecular level, transgenation refers to the change that gene base pair composition structurally occurs or puts in order.
According to the present invention, term " artificial gene treatment " word refers to and foreign gene is imported target cell, to correct or to compensate because of genetic flaw and the abnormal disease caused, or destroys normal gene, to reach the object of disease therapy.
According to the present invention, what term " gene editing " referred to that development in recent years gets up can complete a kind of technology of accurately modifying to genome, site-directed point mutation can be completed, knock in, multidigit point simultaneous mutation and small segment delete mistake etc.As compared to traditional TALEN with ZFN technology, CRISPR/Cas9 system is more convenient, efficient, and application is also more extensive, at present this technology be successfully applied to human cell, zebra fish, mouse and bacterium genome accurately modify.
According to the present invention, term " genetically engineered enzyme " is the general name being applied to engineered various enzyme.
According to the present invention, term " targeted effect " refers to that the genetically engineered enzyme with gene editing function is to the shearing action of target sequence here.
According to the present invention, term " effect of missing the target " refers to the shearing action of the genetically engineered enzyme pair non-target sequences similar to target sequence with gene editing function here.
According to the present invention, term " base ": the derivative referring to purine and pyrimidine is the composition of nucleic acid, nucleosides, Nucleotide.Also the rare base that some content are little are had in nucleic acid.
According to the present invention, term " carrier ": refer to containing self-replication ability, multiple clone site, the isostructural nonchromosomal DNA of Select gene.
According to the present invention, term " oligonucleotide " is that a class only has the general name of several short nucleotide to dozens of base (comprising the Nucleotide in thymus nucleic acid DNA or RNA (ribonucleic acid)), and its length is generally no more than 100 bases.Oligonucleotide can link, so be commonly used to the structure determining DNA or RNA as probe, through being usually used in the processes such as gene chip, electrophoresis, fluorescence in situ hybridization with their complementary pair easily.
According to the present invention, term " waves " and refers in the nucleic acid molecule set that a group sequence is substantially identical, some particular bases site can be the situation more than a kind of base.
According to the present invention, the base at one or several base position that term " base portion waves oligonucleotide " refers in a specific short nucleotide set can be the base of non-single kind.Although the base at arbitrary position of single molecule is all determined, during short nucleotide set conbined usage with regard to this sequence similarity, may there is the result that same site base is different in correlated response product.
According to the present invention, the base at one or several base position that term " base waves oligonucleotide completely " refers in a specific short nucleotide set can be the base of non-single kind can have A, T, C, G tetra-kinds simultaneously may.
According to the present invention, base N is the one set that representative contains A, T, C, G.
The advantage that the present invention has: (1) can be tested testing gene and whether occur the skewed popularity that base uses; (2) testing gene can be tested and whether have strict restriction to intubating length.If base uses or Insert Fragment length is completely fixed, then illustrate that the sudden change tolerance of gene to be tested is limited.And if on the contrary, then show that its sudden change tolerance is powerful.
Accompanying drawing explanation
Fig. 1 is PZAA Plasmid pattern figure,
Fig. 2 is PZAB Plasmid pattern figure,
Fig. 3 is BaeI site detail drawing in PZAB plasmid,
Fig. 4 is structure PZAA and PZAB sequencer map,
Fig. 5 is that NNT, NNC insert rear section cloning and sequencing figure.
Embodiment
Below in conjunction with specific embodiment, such scheme is described further.Should be understood that these embodiments are not limited to for illustration of the present invention limit the scope of the invention.The implementation condition adopted in embodiment can do further adjustment according to the condition in concrete producer laboratory, and not marked implementation condition is generally the condition in normal experiment.
The oligonucleotide that the present invention adopts base portion to wave, can be used for setting up for screening the transgenation tolerance of reporter gene of effect analysis technology of missing the target.When antibiotic resistance gene is used for missing the target effect analysis, as application examples bleomycin of the present invention, the prokaryotic cell prokaryocyte not with resistant gene and eukaryotic cell can be killed, so just likely detect extremely small effect of missing the target.When target spot similar sequences (one of site of effect of missing the target) the insertion generation one of genetically engineered enzyme does not have activated blasticidin resistance gene; once the above-mentioned sequence of this genetically engineered enzyme to non-target spot produces effect of missing the target; just likely by gene editing, the blasticidin resistance gene of non-activity is activated, thus protection bacterium or eukaryotic cell.In this way, effect of missing the target is determined.
As the reporter gene of screening, (1) needs to have shown nonresistant change to target sequence; (2) preferably there is the tolerance of insertion 20 to 80 bases; (3) do not show some sequence can insert, and the sequence dependent that can not insert of the insertion sequence of other not frameshit or sequence Discrimination Phenomenon.
One, material and reagent: (be purchased from invitrogen company, numbering: 190520), (be purchased from TaKaRa company, numbering: D102A), primer synthesis and order-checking entrust Suzhou Jin Weizhi company to complete to PMD-19 plasmid to pPICZ α A plasmid.Pcr amplification test kit, BaeI enzyme (being purchased from New England Biolabs company), DNA nucleic acid fragment reclaims test kit (being purchased from day root biochemistry).T4 DNA ligase (being purchased from thermoscientific company) all the other be domestic reagent and consumptive material.
Instrument: PCR amplification instrument (ABI company, Sstem 9700), electrophoresis apparatus (Bio-Rad biotech firm).
Two, with PMD-19 and pPIC α A plasmid construction blasticidin resistance reporter gene mutant
1. build bleomycin, the dual anti-plasmid PZAA of penbritin
1.1 design and synthesize Auele Specific Primer carries out Overlap extension PCR and obtains blasticidin resistance gene
1.1.1 with PMD-19 plasmid for masterplate,
Primer 1:5 '-CCTCTGACTTGAGCGTCGATTTTTGTG-3, corresponding Seq No.1;
Primer 2: 5 '-GTCAACTTGGCCATAGCTGTTTCCTGTGTGAAATTGTTATCCG-3 ', corresponding Seq No.2; 25 μ L PCR reaction systems: 10 × Pfu Buffer with MgSO4 of 2.5 μ L, the Pfu Polymerase (2.5U/ μ L) of 0.3 μ L, the dNTP Mix (10mM each) of 0.5 μ L, article two, Auele Specific Primer is respectively 5 μMs, 5 μMs, template 40ng, all the other are water.PCR reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 20S, 58 DEG C of annealing 20S, 72 DEG C extend 30S, totally 35 circulations; Last 72 DEG C of 5min.
1.1.2 with pPIC α A plasmid for masterplate,
Primer 3:5 '-CGGATAACAATTTCACACAGGAAACAGCTATGGCCAAGTTGAC-3 ', corresponding Seq No.3;
Primer 4:
5 '-NNNNGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCT TAATCAGTCCTGCTC-3 ', corresponding Seq No.4, base N be selected from A, T, C, G any one; Carry out pcr amplification;
25 μ L PCR reaction systems: 10 × Pfu Buffer with MgSO4 of 2.5 μ L, the Pfu Polymerase (2.5U/ μ L) of 0.3 μ L, the dNTP Mix (10mM each) of 0.5 μ L, article two, Auele Specific Primer is respectively 5 μMs, 5 μMs, template 40ng, all the other are water.PCR reaction conditions is: 95 DEG C of denaturation 5min; 95 DEG C of sex change 20S, 58 DEG C of annealing 20S, 72 DEG C extend 30S, totally 35 circulations; Last 72 DEG C of 5min.
1.1.3 obtain in step 1.1.1 and step 1.1.2 two groups of product balanced mix divided again and be filled to 25 μ L/ and manage, then carry out taking turns PCR, reaction conditions is the same;
1.1.4 the product obtained using step 1.1.3, as masterplate, carries out pcr amplification with primer 1, primer 4, obtains the nucleic acid fragment that can be used for inserting PMD-19 plasmid containing total length bleomycin gene order.
1.2 prepare Insert Fragment and carrier segments
1.2.1 electrophoretic separation purifying object fragment, cut with DrdI enzyme the PCR primer that PMD-19 and step 1 obtain, sky root DNA purifying reclaims test kit and reclaims object fragment respectively;
20 μ l endonuclease reaction systems are the 10 X FastDigest Green Buffer of 2 μ L, and restriction enzyme DrdI1 μ L, PCR primer or PMD-191 μ g, all the other are water.Reaction conditions is 37 DEG C of 30min, 65 DEG C of 5min; Use sky root DNA purifying to reclaim test kit and reclaim PCR primer endonuclease bamhi and PMD-19 plasmid enzyme restriction large fragment product;
1.2.2 enzyme is cut purified product mixing and build linked system, carry out ligation.Its linked system is: 10 × T4 DNA Ligase Buffer of 1uL, the T4 DNA Ligase of 0.5 μ L, the PMD-19 of 1 μ L, the target product of 0.1pmol ~ 0.3pmol, add water to cumulative volume 10 μ L, 22 DEG C are reacted 60 minutes, obtain the dual anti-plasmid PZAA of bleomycin/penbritin.
1.3 transform and screening
Dual anti-plasmid PZAA obtained above is transformed DH5 α intestinal bacteria, containing ammonia benzyl microbiotic with containing parallelly cultivate on the antibiotic nutrient agar of bleomycin, observe and whether form single bacterium colony, the bacterium colony selecting anti-bleomycin and penbritin simultaneously send order-checking, and screens suitable bacterium colony.
2. build the bleomycin reporter gene with BaeI restriction enzyme site
2.1 with PMD-19 plasmid for masterplate,
Primer 1:5 '-CCTCTGACTTGAGCGTCGATTTTTGTG-3 ';
Primer 5:
5 '-CTGGTCAACTTGGCGAATTCAGATACCGAAGTTGACAAGCTTCATAGCTGTTTCCT GTGTGAAATTGTTATCCG-3 ', corresponding Seq No.5; Carry out pcr amplification, obtain object product fragment 1; 25 μ L PCR reaction systems: the 10X Pfu damping fluid of the containing magnesium sulfate of 2.5 μ L, the Pfu polysaccharase (2.5U/ μ L) of 0.3 μ L, the dNTP mixed solution (often kind of 10mM) of 0.5 μ L, article two, Auele Specific Primer is respectively 5 μMs, 5 μMs, template 40ng, all the other are water.PCR reaction conditions is: 95 DEG C of denaturations 5 minutes; 95 DEG C of sex change 20S, 58 DEG C of annealing 20S, 72 DEG C extend 30S, totally 35 circulations; Last 72 DEG C 5 minutes.
2.2 with pPIC α A plasmid for masterplate,
Primer 6:
5 '-: CGGATAACAATTTCACACAGGAAACAGCTATGAAGCTTGTCAACTTCGGTATCTGA ATTCGCCAAGTTGACCAG-3 ', corresponding Seq No.6;
Primer 4:
5 '-NNNNGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCT TAATCAGTCCTGCTC-3 ' carries out pcr amplification, obtains object product fragment 2;
Wherein, every 25 μ L PCR reaction systems comprise: the 10X Pfu damping fluid of 2.5 μ L containing magnesium sulfates, the Pfu polysaccharase (2.5U/ μ L) of 0.3 μ L, the dNTP mixed solution (often kind of 10mM) of 0.5 μ L, article two, Auele Specific Primer is respectively 5 μMs, 5 μMs, template 40ng, all the other are water.PCR reaction conditions is: 95 DEG C of denaturations 5 minutes; 95 DEG C of sex change 20S, 58 DEG C of annealing 20S, 72 DEG C extend 30S, totally 35 circulations; Last 72 DEG C 5 minutes.
Obtain in step 2.1.1 and step 2.1.2 two groups of product fragment 1 and 2 balanced mix to be divided and are filled to 25 μ L/ and manage by 2.3 again, then carry out taking turns PCR;
2.4 products obtained using step 2.1.3 are as masterplate, and carry out pcr amplification with primer 1, primer 5, reaction conditions is the same, obtain the nucleic acid fragment that can be used for inserting PMD-19 plasmid of the total length bleomycin gene order containing BaeI site.
2.5 electrophoretic separation purifying object fragments, cut with DrdI enzyme the PCR primer that PMD-19 and step 1 obtain, use sky root DNA purifying to reclaim test kit and reclaim object fragment respectively:
2.620 μ l endonuclease reaction systems are the 10 X rapid digestion damping fluids of 2 μ L, and restriction enzyme DrdI1 μ L, PCR primer or PMD-191 μ g, all the other are water.Reaction conditions be 37 DEG C 30 minutes, 65 DEG C 5 minutes; Use sky root DNA purifying to reclaim test kit and reclaim PCR primer endonuclease bamhi and PMD-19 plasmid enzyme restriction large fragment product,
Two digestion products mixing are built linked system by 2.7, carry out ligation.Its linked system is: 10 × T4 DNA ligase damping fluid of 1uL, the T4 DNA ligase of 0.5 μ L, the PMD-19 of 1 μ L, the target product of 0.1pmol ~ 0.3pmol, add water to cumulative volume 10 μ L, 22 DEG C are reacted 60 minutes, obtain the dual anti-plasmid PZAB of bleomycin/penbritin.
2.8 transform and screening
Dual anti-plasmid PZAB obtained above is transformed DH5 α intestinal bacteria, containing ammonia benzyl microbiotic with containing parallelly cultivate on the antibiotic nutrient agar of bleomycin, observe and whether form single bacterium colony, select anti-penbritin and the bacterium colony of not anti-bleomycin send order-checking, and screen suitable clones.
Three, in dual anti-plasmid PZAB, insert nuclease target sequence to be detected, between the initiator codon ATG and codon GCC thereafter of plasmid PZAB blasticidin resistance gene, namely insert the allos target sequence nucleotide fragments of certain length.Concrete steps are as follows:
3.1 extract PZAB plasmid, use BaeI enzyme to cut, and use sky root DNA purifying to reclaim test kit and reclaim large fragment, as carrier.It is 10X cutsmart 5ul that 50ul digests system, and SAM 1ul, BaeI 2ul, PZAB 2ug, all the other are distilled water.Digestion condition is 25 DEG C and hatches 2 hours, hatches 5 minutes for 85 DEG C.Digest rear use sky root DNA purifying and reclaim test kit recovery carrier segments.
3.2 design variable sequence.Design as follows:
NNT+:5’-NNTNNTNNTNNTNNTNNTNNTNNTGCCAA-3’
NNT-:5’-ANNANNANNANNANNANNANNANNCATAG-3’
NNC+:5’-NNCNNCNNCNNCNNCNNCNNCNNCGCCAA-3’
NNC-:5’-GNNGNNGNNGNNGNNGNNGNNGNNCATAG-3’
Oligonucleotide annealing is formed double-stranded DNA by 3.3.NNT+, NNT-, NNC+, NNC-build annealing system respectively between two, and the system of 10ul comprises 1ul 10X annealing buffer, 100pmol oligonucleotide+and 100pmol oligonucleotide-and, all the other are ddH2O.Annealing conditions is for being heated to 95 DEG C and after keeping 5min, by the speed slow cooling to 37 DEG C of 0.5 DEG C/min, taking out, be stored in 4 DEG C of refrigerators.
3.4 nuclease target sequences and vector construction linked system, carry out ligation.Connect PZAB carrier.With PZAB vector construction linked system after annealed product dilutes 10 times.Containing 1ul 10 × T4DNA ligase enzyme damping fluid r in the system of 10ul, the T4 DNA ligase of 0.5 μ L, 1ul annealed product, 0.01 ~ 0.03pmolPZAB carrier, all the other are ddH2O.Condition of contact is 16 DEG C of connections of spending the night.
Wherein, 10 × T4 damping fluid 1ul, PZAB1ul, annealed product 1ul, T41ul, water adds to 10ul, cumulative volume 10ul.
3.5 connect product conversion DH5 α intestinal bacteria, select mono-clonal, can carry out related experiment after qualification is correct with corresponding nuclease recombinant plasmid.
3.6 connect product conversion DH5 α competence intestinal bacteria.Shake the bacterium bacterium liquid that takes a morsel after 40 minutes to be applied on ammonia benzyl substratum, and whole for residue bacterium liquid is laid on incubated overnight on bleomycin substratum.Observe also selected suitable clones in second day and send order-checking.
Four, result
Table 1.NNT group oligonucleotide sequence
The amino acid of table 2.NNT coding
Table 3.NNT Fisher ' exact detects
Chi square test, P is greater than 0.05, statistically there was no significant difference, shows do not have selectivity when insertion sequence position uses base in this experiment, or does not have Discrimination Phenomenon.Its meaning prompting practical situation likely inserts any target sequence.
Table 4.NNC Fisher ' exact detects
Chi square test, P is greater than 0.05, statistically there was no significant difference, shows do not have selectivity when insertion sequence position uses base in this experiment, or does not have Discrimination Phenomenon.Its meaning prompting practical situation likely inserts any target sequence.
Conclusion: one is the detection that the method may be used for mutant target gene tolerance to be measured; Two is that the detectivity of NNT is greater than NNC.Above-mentioned two conclusions are described in example application.
Above-mentioned example, only for technical conceive of the present invention and feature are described, its object is to person skilled in the art can be understood content of the present invention and implement according to this, can not limit the scope of the invention with this.All equivalent transformations of doing according to spirit of the present invention or modification, all should be encompassed within protection scope of the present invention.
Claims (7)
1. wave by insertion portion the method that oligonucleotide detects transgenation tolerance, it is characterized in that, comprise the steps:
(1) adopt NNT and/or the NNC series connection nucleic acid fragment of synthesis, add the restriction enzyme site of restriction enzyme at its end,
(2) directly connection cuts the carrier segments after process through enzyme.By vector introduction host cell,
(3) host cell produces one is length can not wait the mutant nucleic acid different with sequence,
(5) by the expression activity of inspection mutant nucleic acid, assess and detect transgenation tolerance.
2. method according to claim 1, is characterized in that, NNT and/or the NNC series connection nucleic acid fragment of synthesis in described step (1), its multiplicity is 1-30.
3. method according to claim 1, is characterized in that, the N in described NNT and/or NNC is selected from A, T, C, G.
4. method according to claim 1, is characterized in that, described carrier is the carrier with ability to express complete structure.
5. wave by insertion portion the method that oligonucleotide detects transgenation tolerance, be used for detecting gene tolerance sudden change ability.
6. purposes according to claim 1, is characterized in that, described gene tolerance sudden change ability refers to that the ability of specific A, T, C, G is selected at wobble bases position in mutant.
7. purposes according to claim 1, is characterized in that, described gene tolerance sudden change ability refers to the changing conditions of the multiplicity of wobble bases in mutant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410768055.7A CN104450919A (en) | 2014-12-12 | 2014-12-12 | Method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410768055.7A CN104450919A (en) | 2014-12-12 | 2014-12-12 | Method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104450919A true CN104450919A (en) | 2015-03-25 |
Family
ID=52897664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410768055.7A Pending CN104450919A (en) | 2014-12-12 | 2014-12-12 | Method for detecting tolerance capability of gene mutation by inserting partial wobble oligonucleotide |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450919A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005087932A2 (en) * | 2003-10-03 | 2005-09-22 | Promega Corporation | Vectors for directional cloning |
| CN103981175A (en) * | 2014-03-27 | 2014-08-13 | 苏州大学 | Bleomycin resistance reporter gene mutant, and preparation method and application thereof |
-
2014
- 2014-12-12 CN CN201410768055.7A patent/CN104450919A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005087932A2 (en) * | 2003-10-03 | 2005-09-22 | Promega Corporation | Vectors for directional cloning |
| WO2005087932A3 (en) * | 2003-10-03 | 2006-03-02 | Promega Corp | Vectors for directional cloning |
| CN103981175A (en) * | 2014-03-27 | 2014-08-13 | 苏州大学 | Bleomycin resistance reporter gene mutant, and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| DINA BELLIZZI等: "A model for the involvement of Okazaki fragments maturation in the expansion of short tandem repeats", 《GENE》 * |
| 肖莉等: "同时含有插入与缺失的复杂突变的起源", 《南华大学学报·医学版》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105408497B (en) | The specificity of the genome editor of RNA guidance is improved using truncated guidance RNA (tru-gRNA) | |
| CN105316327B (en) | Wheat TaAGO4a gene C RISPR/Cas9 carrier and its application | |
| CN105132451B (en) | A kind of single transcriptional units directed modification skeleton carrier of CRISPR/Cas9 and its application | |
| CN113373130B (en) | Cas12 protein, gene editing system containing Cas12 protein and application | |
| CN107012164A (en) | CRISPR/Cpf1 Plant Genome directed modifications functional unit, the carrier comprising the functional unit and its application | |
| Li et al. | SWISS: multiplexed orthogonal genome editing in plants with a Cas9 nickase and engineered CRISPR RNA scaffolds | |
| KR20170020470A (en) | Genomewide unbiased identification of dsbs evaluated by sequencing (guide-seq) | |
| WO2014204578A1 (en) | Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing | |
| CN113136376B (en) | Cas12a variant and application thereof in gene editing | |
| Zakrzewski et al. | Analysis of ac 0 t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris | |
| CN104673824B (en) | A kind of carrier of suitable gene stacking and its application | |
| CN113234701B (en) | Cpf1 protein and gene editing system | |
| CN103602735A (en) | Method for precisely determining high-frequency and low-frequency mutations of mitochondrial DNA (deoxyribonucleic acid) by high-throughput sequencing | |
| CN109706148A (en) | A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer | |
| WO2021178934A1 (en) | Class ii, type v crispr systems | |
| CN102337284A (en) | Plasmid for preparing DNA Marker, and construction method and application thereof | |
| CN105087517B (en) | A method of recombination multienzyme complex and the seamless clone of external homologous recombination | |
| CN113583999A (en) | Cas9 protein, gene editing system containing Cas9 protein and application | |
| EP4127155A1 (en) | Class ii, type ii crispr systems | |
| CN106191253B (en) | Beijing duck based on GBS technology simplifies gene order surveying method | |
| CN117210437A (en) | Enzyme identification of two gene editing tools and application of enzyme identification in nucleic acid detection | |
| CN110499334A (en) | CRISPR/SlugCas9 gene editing system and its application | |
| CN109868271A (en) | DNA is carried out using chip synthetic oligonucleotide library to shuffle the method for library de novo formation | |
| WO2023028348A1 (en) | Enzymes with ruvc domains | |
| CN103981175A (en) | Bleomycin resistance reporter gene mutant, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150325 |