CN104450903A - Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof - Google Patents
Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof Download PDFInfo
- Publication number
- CN104450903A CN104450903A CN201410717439.6A CN201410717439A CN104450903A CN 104450903 A CN104450903 A CN 104450903A CN 201410717439 A CN201410717439 A CN 201410717439A CN 104450903 A CN104450903 A CN 104450903A
- Authority
- CN
- China
- Prior art keywords
- plasmodium
- probe
- hybridization
- kinds
- diagnosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a probe for classificatory diagnosis of four plasmodia infecting human, a kit and a using method thereof, wherein species special probes are respectively adopted for plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae; 10 T tails are added at the 5' end of the probe and are cross-linked and fixed on a nylon hybrid membrane in an ultraviolet manner. The kit consists of PCR and reverse dot blot hybridization reaction reagents and materials and can be used for classificatory diagnosis of plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malariae or two or three or four of the plasmodium falciparum, plasmodium vivax, plasmodium ovale and plasmodium malaria, so that the invention provides a simple, convenient and quick plasmodium classificatory diagnosis technique.
Description
Technical field
The present invention relates to a kind of probe for plasmodium classification diagnosis, test kit and using method thereof, particularly relate to a kind of probe for Diagnosis of malignant plasmodium, Plasmodium vivax, Plasmodium ovale, malariae and test kit thereof and using method, belong to plasmodium detection field.
Background technology
Plasmodium is Protozoa, sporozoa (Sporozoa), Coccidia (Cocciidea), Haemosporea (Haemosporidiidea), a genus in protozoon section (Plasmadiidea), i.e. the general name of plasmodium (plasmodiam).Person comprises plasmodium falciparum (Plasmodium falciparum), Plasmodium vivax (Plasmodium vivax), Plasmodium ovale (Plasmodium ovals), malariae (Plasmodium malariae) four kinds to parasitize human body.China is the widest with vivax malaria distribution, except Qinghai-Tibet Platean, throughout the whole nation.Subtertian malaria is taken second place, and being distributed on the south Huaihe River, the Qinling Mountains one, is with Yunnan-Guizhou, Guangdong and Guangxi Provinces and Hainan.Quartan malaria is all dispersed in case in north and south, the Changjiang river each province.Ovale malaria only has minority case report in Yunnan and Guangdong.
Malaria is to one of the most serious transmissible disease of human health risk, and China since two thousand malaria occurs ging up, and wherein Yunnan, Hainan two province are comparatively serious, and many provinces are subject to the threat of Introduced cases subtertian malaria, especially overseas the threat of Introduced cases subtertian malaria.Along with increasing of economic globalization and international connection, export of labour services number in recent years increases year by year, and input-response relation case increases year by year, in ascendant trend year by year.Introduced cases come from the people who return to homeland of the subtertian malaria district occurred frequently export of labour services such as Africa, Burma mostly, China's malaria death in 2008 is all labor service returned personnel overseas, within 2009, have 21 provinces (city, district) to have the case report of Introduced cases subtertian malaria, and malaria death is also all Imported cases.2010 annual report Introduced cases subtertian malaria 1161 examples, account for 92.3% of subtertian malaria reported cases number, and within comparatively 2009, (897 example) rises 29.4%.31 provinces (city, district) in the whole nation in 2012 have report case survey of malaria, compared with 2011, autochthonous infection case survey of malaria obviously declines, input-response relation case ratio obviously rises, especially overseas input-response relation case ratio rises to 91.0% (2474/2718) in 2012 from 66.4% (2974/4479) in 2011, wherein based on subtertian malaria.Therefore, pay close attention to malaria, particularly overseas Introduced cases subtertian malaria epidemic situation is very important.
At present, malaria diagnosis method mainly divides 3 classes: one is the etiological diagnosis based on traditional Microscopical Method For Detection, improves detection efficiency, as fluorescence dye etc. by the protozoon number in increase blood sample, improvement dyeing process or both combinations; Two is the amynologic diagnostic methods grown up the seventies in last century, and as indirect fluorescent antibody technique, enzyme-linked immunosorbent assay etc., wherein immunochromatography technique has become the study hotspot of malaria diagnosis because of its feature such as quick, easy; Three is the molecular biological testing risen the eighties in last century, determines Infected With Plasmodium, as gene probe and round pcr etc. by detection plasmodium kind, the specific gene fragment of strain.Round pcr plays an increasingly important role because of the susceptibility of its height, specificity and the resolving ability to worm kind, worm strain in malaria diagnosis, and the methods such as sleeve type PCR can further improve susceptibility and the accuracy of diagnosis.But PCR method is still required great effort consuming time, need test of many times determination polyinfection.In primary first-order equation, how to detect multiple worm kind, focus that worm strain, even genotype become Recent study.
Reverse dot blot hybridization (reverse dot blot, RDB) be a kind of spot hybridization test proposed by Saiki etc. for 1989, and be applied to hemopathy and the thalassemic detection of Beta, the method is easy and simple to handle, film adds the probe for different subtype or sudden change, multiple sample can be detected on a film simultaneously, be conducive to reducing costs, save time.RDB only needs relatively short oligonucleotide probe just can provide obvious hybridization signal, can be identified the difference of a base in template by adjustment hybridization conditions.This technology compared with forward dot hybridization and gel electrophoresis transfer printing hybridization have quick, easy, susceptibility is high, the feature of high specificity, in the detection etc. of gene type, detection in Gene Mutation, pathogenic agent, especially have the advantage of its uniqueness.
Summary of the invention
Main purpose of the present invention is to provide a set of for the plasmodial probe of classification diagnosis, can be used for plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, malariae or two kinds or three kinds or four kinds of plasmodial polymerase chain reaction-reverse dot blot hybridization classification diagnosis wherein.
Described probe is for each plasmodial species specificity fragment design, and probe 5 ' end is all added with 10 T tails, and its nucleotides sequence is classified as:
Another object of the present invention is to provide a kind of polymerase chain reaction for plasmodium classification diagnosis-reverse dot blot hybridization test kit, comprise polymerase chain reaction universal primer solution (PM) and polymerase chain reaction premix (RM), be fixed with the nylon Hybond membrane (chip) of various types of plasmodium probe, room temperature hybridization solution (Hyb), washing lotion I (W1), washing lotion II (W2), the alkaline phosphatase (AP) of marked by streptavidin, alkaline phosphatase buffer (Buffer1), colorbuffer (Buffer2), chromogenic substrate (NBT/BCIP), it is characterized in that, described test kit can carry out plasmodium falciparum at ambient temperature, Plasmodium vivax, Plasmodium ovale, malariae or two kinds or three kinds or four kinds of plasmodial classification diagnosis wherein.It is patient whole blood's genomic dna that this test kit is suitable for specimen types.
Described polymerase chain reaction universal primer solution (PM), be by upstream primer (5 '-3 ': GAGGGCAAGTCTGGTGCCAG) with downstream primer (5 '-3 ': CATCTGAATACGAATGTCCCCAAGC) according to 1: 1 proportions, primer 5 ' is held all with biotin labeling, and primer concentration is 10 μm of ol/L.
The described preparation method being fixed with the nylon Hybond membrane (chip) of classification diagnosis plasmodium probe is, draw at least one probe 0.3-0.5 μ L point in four kinds of classification diagnosis plasmodium probes (SEQ No.1-SEQ No.4) respectively on nylon membrane with pipettor, after UV-crosslinked, namely can be used for hybrid experiment.The UV-crosslinked time is set as 15 ", 30 ", 1 ', 1 ' 30 ", 2 ', 3 ', 5 ', 10 ', preferred crosslinking time is 5 '.The point sample concentration changing probe is respectively 1 μm of ol/L, 2.5 μm of ol/L, 5 μm of ol/L, 7.5 μm of ol/L, 10 μm of ol/L, 25 μm of ol/L, 50 μm of ol/L, 100 μm of ol/L, after hybridization, be 25-100 μm of ol/L by the point sample concentration of the depth determination probe of spot colors, preferred concentration is 50 μm of ol/L.
The present invention also provides a kind of using method for classification diagnosis plasmodium test kit, it is characterized in that, comprises PCR amplification and room temperature reverse dot blot hybridization diagnoses two key steps, and reverse dot blot hybridization diagnosis can complete at ambient temperature.
The reaction system of polymerase chain reaction 50 μ L comprises: polymerase chain reaction premix (RM) 25 μ L, DEPC water 22 μ L, primer mixed solution (PM) 2 μ L, DNA profiling 1 μ L, replaces DNA profiling in negative control with DEPC water.Amplification program is: 94 DEG C, 3min; 94 DEG C, 30s, 53 DEG C, 30s, 72 DEG C, 30s, totally 30 circulations; Last 5min extension at 72 DEG C.
The concrete steps of room temperature reverse dot blot hybridization diagnostic method are:
(1) the nylon Hybond membrane being fixed with classification diagnosis plasmodium probe is placed in hybridization bag or hybrid pipe, adds the room temperature hybridization solution of 300 μ L;
(2) with biotin labeled amplified production 95 DEG C of sex change 5min, rapid ice bath 2min;
(3) in room temperature hybridization solution, 30 μ L sex change amplified productions are added, room temperature hybridization 3hr;
(4) discard hybridization solution, washing lotion I, washing lotion II respectively wash 2 times, each 5min;
(5) discard washing lotion, add the Streptavidin of the alkali phosphatase enzyme mark of 1000 times of dilutions, room temperature reaction 30min;
(6) discard enzyme liquid, substrate buffer solution washs 2 times, each 5min;
(7) discard substrate buffer solution, add freshly prepared substrate, lucifuge reaction 5-15min;
(8) discarded by substrate, deionized water stops, and result of determination after film becomes dry, occurs that the judgement of obvious bluish voilet spot is positive findings, is immaculately judged to be negative findings.
Arranging room temperature hybridization time is respectively 1hr, 3hr, 5hr, (O/N) overnight, is 3hr by the depth determination hybridization time of spot colors.
Accompanying drawing explanation
The electrophorogram of Fig. 1 tetra-kinds of plasmodium synthetic template PCR primer.Wherein M is 100bp DNA ladder, and PV, PO, PM, PF are respectively: vivax malaria, ovale malaria, quartan malaria and subtertian malaria plasmodium template PCR primer.
The UV-crosslinked time-optimized result of Fig. 2, in figure, F, M, O, V are respectively: subtertian malaria, quartan malaria, ovale malaria and vivax malaria probe.
The optimization experiment result of Fig. 3 concentration and probe concentration, in figure, F, M, O, V are respectively: subtertian malaria, quartan malaria, ovale malaria and vivax malaria probe.
The optimization experiment result of Fig. 4 hybridization time, in figure, F, M, O, V are respectively: subtertian malaria, quartan malaria, ovale malaria and vivax malaria probe.
Fig. 5 PCR-reverse dot blot hybridization diagnoses the sensitivity experiment result of four kinds of plasmodium synthetic templates, and in figure, 0-8 is the logarithmic value adding plasmid copy number in each PCR system, and NC is negative control.
A is plasmodium falciparum synthetic template PCR primer reverse dot blot hybridization sensitivity experiment result
B is malariae synthetic template PCR primer reverse dot blot hybridization sensitivity experiment result
C is Plasmodium ovale synthetic template PCR primer reverse dot blot hybridization sensitivity experiment result
D is Plasmodium vivax synthetic template PCR primer reverse dot blot hybridization sensitivity experiment result
Fig. 6 PCR-reverse dot blot hybridization diagnoses the specificity experiments result of four kinds of plasmodium synthetic templates, F in figure, M, O, V is respectively subtertian malaria, quartan malaria, ovale malaria and vivax malaria synthetic template PCR primer, Fal, Mal, Ova, Viv are respectively the corresponding probe of subtertian malaria, quartan malaria, ovale malaria and vivax malaria.
Fig. 7 PCR-reverse dot blot hybridization diagnoses four kinds of plasmodium clinical case proof test results, and in figure, Fal, Mal, Ova, Viv are respectively the corresponding probe of subtertian malaria, quartan malaria, ovale malaria and vivax malaria, and P1, P2 are known subtertian malaria positive clinical sample.
Specific implementation method
Be described in further detail the present invention below, advantage and disadvantage of the present invention will be more clear along with description.But these embodiments are only exemplary; any restriction is not formed to scope of the present invention; what those skilled in the art should understand that is; can modify to the details of technical solution of the present invention and form lower without departing from the spirit and scope of the present invention or replace, but these amendments and replacement all fall within the scope of protection of the present invention.
Embodiment
1. test materials and method
1.1 test materials
Four kinds of plasmodium synthetic fragments are sequence (M19172, the AF488000 with reference to Genbank has delivered, L48987, X13926) synthetic, fragment is connected on pMD18-T carrier, and be converted into competent cell DH5 α, store with the bacterium liquid form of 30% glycerine.
Synthetic plasmid and clinical sample genomic dna are provided by Beijing inspection and quarantine bureau.
1.2 probe design
Use DNAMAN software to four kinds of general upstream and downstream primers of plasmodium (5 '-3 ': GAGGGCAAGTCTGGTGCCAG, 5 '-3 ': CATCTGAATACGAATGTCCCCAAGC) amplified fragments is compared, choose diversity sequence and devise four kinds of plasmodial probes of classification diagnosis (SEQ No.1-SEQ No.4), primer and probe are synthesized by Invitrogen company, 5 ' end of primer carries out biotin labeling, 5 ' end of probe adds 10 T tails, and the nucleotides sequence of probe is classified as:
The extraction of 1.3 recombinant plasmids and checking
The glycerol stock liquid accessing 100uL in the LB substratum of penbritin is added in advance at 3mL, 37 DEG C, 160rpm shaking culture 8-10h, plasmid is extracted in the explanation with reference to the little extraction reagent kit of plasmid, carry out order-checking qualification, after all the other bacterium liquid add 30% glycerine, put into-80 DEG C of preservations.With Nanophotometer apparatus measures plasmid concentration.
The preparation of 1.4 biotin labeling object fragments
With each plasmodium recombinant plasmid for template, with biotin labeled universal primer (5 '-3 ': GAGGGCAAGTCTGGTGCCAG, 5 '-3 ' pcr amplification is carried out: CATCTGAATACGAATGTCCCCAAGC), the reaction system of its 50 μ L comprises: polymerase chain reaction premix (RM) 25 μ L, DEPC water 22 μ L, primer mixed solution (PM) 2 μ L, DNA profiling 1 μ L, replaces DNA profiling with DEPC water in negative control.Amplification program is: 94 DEG C, 3min; 94 DEG C, 30s, 53 DEG C, 30s, 72 DEG C, 30s, totally 30 circulations; Last 5min extension at 72 DEG C.The amplified production getting 5 μ L after reaction terminates carries out electrophoresis detection on the sepharose of 2%.
1.5 preparations being fixed with the nylon Hybond membrane (chip) of classification diagnosis plasmodium probe
Draw four kinds of classification diagnosis plasmodium probes (SEQ No.1-SEQ No.4) 0.3-0.5 μ L point respectively on nylon membrane with pipettor, after UV-crosslinked, namely can be used for hybrid experiment.
The foundation of 1.6 room temperature reverse dot hybridization methods
The concrete steps of room temperature reverse dot blot hybridization diagnostic method are: the nylon Hybond membrane being fixed with classification diagnosis plasmodium probe is placed in hybridization bag or hybrid pipe by (1), add the room temperature hybridization solution of 300 μ L; (2) with biotin labeled amplified production 95 DEG C of sex change 5min, rapid ice bath 2min; (3) in room temperature hybridization solution, 30 μ L sex change amplified productions are added, room temperature hybridization 3hr; (4) discard hybridization solution, washing lotion I, washing lotion II respectively wash 2 times, each 5min; (5) discard washing lotion, add the Streptavidin of the alkali phosphatase enzyme mark of 1000 times of dilutions, room temperature reaction 30min; (6) discard enzyme liquid, substrate buffer solution washs 2 times, each 5min; (7) discard substrate buffer solution, add freshly prepared substrate, lucifuge reaction 5-15min; (8) discarded by substrate, deionized water stops, and result of determination after film becomes dry, occurs that the judgement of obvious bluish voilet spot is positive findings, is immaculately judged to be negative findings.
The optimization of 1.7 hybridization conditions
The nylon Hybond membrane of classification diagnosis plasmodium probe is fixed with according to the method preparation described in 1.5, optimizing the UV-crosslinked time is set as 15 ", 30 ", 1 ', 1 ' 30 ", 2 ', 3 ', 5 ', 10 ', determine the UV-crosslinked time by the depth of spot colors.The point sample concentration changing probe is respectively 1 μm of ol/L, 2.5 μm of ol/L, 5 μm of ol/L, 7.5 μm of ol/L, 10 μm of ol/L, 25 μm of ol/L, 50 μm of ol/L, 100 μm of ol/L, after hybridization, by the point sample concentration of the depth determination probe of spot size and color.Prepare nylon Hybond membrane with the best determined in above-mentioned test UV-crosslinked time and probe point sample concentration, for the test of room temperature reverse dot blot hybridization, and hybridization time is optimized.Room temperature hybridization time used is 1hr, 3hr, 5hr, (O/N) overnight, after hybridization, by the top condition of the depth determination hybridization of spot colors.
1.8 sensitivity test
Calculate the copy number concentration of each plasmodium plasmid template, will determine that each plasmid of copy number concentration carries out 10 times of gradient dilutions (10 successively
8copies/uL, 10
7copies/uL, 10
6copies/uL, 10
5copies/uL, 10
4copies/uL, 10
3copies/uL, 10
2copies/uL, 10
1copies/uL, 10
0copies/uL), by polymerase chain reaction-reverse dot blot hybridization test, the plasmid of above-mentioned each concentration is detected respectively, each extent of dilution arranges 3 parallel tests, has at least and occurs that the judgement of obvious bluish voilet spot is positive findings for 2 times, is immaculately judged to be negative findings.
1.9 specific test
Polymerase chain reaction is carried out for template respectively with plasmodium falciparum, malariae, Plasmodium ovale, Plasmodium vivax synthetic plasmid, with the nylon Hybond membrane being fixed with subtertian malaria, quartan malaria, ovale malaria and vivax malaria probe, reverse dot blot hybridization test is carried out to each PCR reaction product, check the specificity of each plasmodium probe.
1.10 clinical sample proof test
To confirm 2 routine subtertian malaria patient whole blood genomic dnas as template, biotin labeling object fragment is prepared by pcr amplification, reverse dot blot hybridization detection is carried out with the hybridization condition of above-mentioned optimization, each sample occurs that the judgement of obvious bluish voilet spot is positive findings, is immaculately judged to be negative findings.
2. test-results
The preparation of 2.1 biotin labeling object fragments
According to the working method in 1.4, with each plasmodium recombinant plasmid for template, with biotin labeled general upstream primer (5 '-3 ': GAGGGCAAGTCTGGTGCCAG) and downstream primer (5 '-3 ': CATCTGAATACGAATGTCCCCAAGC) carry out pcr amplification, amplified fragments subtertian malaria, quartan malaria, ovale malaria and vivax malaria should be respectively 405bp, 443bp, 413bp and 407bp, the amplified production getting 5 μ L after reaction terminates carries out electrophoresis detection on the sepharose of 2%, result as shown in Figure 1, conforms to expected results.
2.2 UV-crosslinked time-optimized results
According to the working method in 1.5, setting the UV-crosslinked time is respectively 15 ", 30 ", 1 ', 1 ' 30 ", 2 ', 3 ', 5 ', 10 '; test-results is as Fig. 2; determine the UV-crosslinked time by the depth of spot colors; 1 '-10 ' all there is obvious bluish voilet spot in each probe; for guaranteeing UV-crosslinked result, preferred crosslinking time is 5 '.
The optimization experiment result of 2.3 concentration and probe concentration
The nylon Hybond membrane of classification diagnosis plasmodium probe is fixed with according to the method preparation described in 1.5, the point sample concentration changing probe is respectively 1 μm of ol/L, 2.5 μm of ol/L, 5 μm of 0l/L, 7.5 μm of ol/L, 10 μm of ol/L, 25 μm of ol/L, 50 μm of ol/L, 100 μm of ol/L, hybridization result as shown in Figure 3, be 25-100 μm of ol/L by the point sample concentration of the depth determination probe of spot colors, wherein the spot size of 50 μm of ol/L each probe point sample concentration and color best, therefore determine that each probe point sample concentration preferred result is 50 μm of ol/L.
The optimization experiment result of 2.4 hybridization time
The optimization of room temperature reverse dot blot hybridization experimental cross time is carried out with the test conditions of above-mentioned optimization, arranging room temperature hybridization time is 1hr, 3hr, 5hr, (O/N) overnight, hybridization result is as Fig. 4, during hybridization 3hr all can there is obvious bluish voilet spot in each probe, therefore determines that hybridization time is 3hr.
2.5 sensitivity test results
To determine that each plasmodium plasmid of copy number concentration carries out 10 times of gradient dilutions (10 successively
8copies/uL, 10
7copies/uL, 10
6copies/uL, 10
5copies/uL, 10
4copies/uL, 10
3copies/uL, 10
2copies/uL, 10
1copies/uL, 10
0copies/uL), according to the polymerase chain reaction after condition optimizing-reverse dot blot hybridization test, above-mentioned each concentration plasmid is detected respectively, result as shown in Figure 5, to occur that obvious bluish voilet spot is the detectability of this probe, the detectability of subtertian malaria, quartan malaria, ovale malaria and vivax malaria is respectively: 10
3, 10
5, 10
6with 10
7copies/uL.
2.6 specific test results
According to the working method in 1.9, respectively to carry out PCR reaction containing plasmodium falciparum, malariae, Plasmodium ovale, Plasmodium vivax synthetic plasmid for template, with the nylon Hybond membrane being fixed with each probe of subtertian malaria, quartan malaria, ovale malaria and vivax malaria, reverse dot blot hybridization test is carried out to each PCR reaction product, test-results is as Fig. 6, there is obvious bluish voilet spot in the position being only fixed with each corresponding plasmodium probe, illustrate that the specificity of probe is good, can plasmodial species-specific diagnosis be carried out.
2.7 clinical sample confirmatory experiment results
Apply this reverse dot hybridization method and confirmed that subtertian malaria patient clinical sample whole blood genomic dna detects to 2 examples, result as shown in Figure 7.In two routine subtertian malaria positive cases, through the example (P2) that fluorescence quantitative PCR detection signal is stronger, also there is obvious bluish voilet spot in reverse dot blot hybridization result, and results of hybridization is consistent with diagnosis, for subtertian malaria infects.More weak to another routine patient (P1) signal in fluorescence quantitative PCR detection, also show as more weak bluish voilet spot in this experiment, results of hybridization is also consistent with clinical diagnosis, for subtertian malaria infects.
Claims (4)
1. a set of for the plasmodial probe of classification diagnosis four kinds infection people, it is characterized in that, described probe system is for the species specificity fragment design of plasmodium falciparum, Plasmodium vivax, Plasmodium ovale and malariae, and probe 5 ' end is all added with 10 T tails, and its nucleotides sequence is classified as:
Described probe can be used for plasmodium falciparum, Plasmodium vivax, Plasmodium ovale, malariae or two kinds or three kinds or four kinds of plasmodial polymerase chain reaction-reverse dot blot hybridization classification diagnosis wherein.
2. one kind is infected the plasmodial test kit of people for classification diagnosis four kinds, it is characterized in that, comprise polymerase chain reaction universal primer solution (PM) and polymerase chain reaction premix (RM), be fixed with the nylon Hybond membrane (chip) of various plasmodium probe, room temperature hybridization solution (Hyb), washing lotion I (W1), washing lotion II (W2), the alkaline phosphatase (AP) of marked by streptavidin, alkaline phosphatase buffer (Bufferl), colorbuffer (Buffer2), chromogenic substrate (NBT/BCIP), it is characterized in that, described test kit can carry out plasmodium falciparum at ambient temperature, malariae, Plasmodium ovale, Plasmodium vivax or two kinds or three kinds or four kinds of plasmodial classification diagnosis wherein,
Described polymerase chain reaction universal primer solution (PM), it is characterized in that, primer 5 ' is held all with biotin labeling, upstream primer (5 '-3 ': GAGGGCAAGTCTGGTGCCAG) with downstream primer (5 '-3 ': CATCTGAATACGAATGTCCCCAAGC) according to 1: 1 proportions, primer concentration is 10mol/L; The described nylon Hybond membrane (chip) being fixed with each worm kind plasmodium probe, it is characterized in that, be fixed with four kinds of classification diagnosis as claimed in claim 1 and infect at least one probe in people plasmodium probe (SEQ No.1, SEQ No.2, SEQ No.3, SEQ No.4), the point sample concentration of various plasmodium probe is 25-100 μm of ol/L, preferred concentration is 50 μm of ol/L, and point sample amount is 0.3-0.5 μ L.
3. one kind is infected the using method of the plasmodial test kit of people as claimed in claim 2 for classification diagnosis four kinds, it is characterized in that, comprise polymerase chain reaction (PCR) amplification and room temperature reverse dot blot hybridization two key steps, reverse dot blot hybridization can at room temperature complete;
Described polymerase chain reaction (PCR) amplification, it is characterized in that, the reaction system of its 50 μ L comprises: polymerase chain reaction premix (RM) 25 μ L, DEPC water 22 μ L, primer mixed solution (PM) 2 μ L, DNA profiling 1 μ L, replaces DNA profiling with DEPC water in negative control; Amplification program is: 94 DEG C, 3min; 94 DEG C, 30s, 53 DEG C, 30s, 72 DEG C, 30s, totally 30 circulations; Last 5min extension at 72 DEG C;
Described room temperature reverse dot hybridization method, is characterized in that, use room temperature hybridization solution (Hyb) as claimed in claim 2 to hybridize, concrete steps are:
(1) the nylon Hybond membrane being fixed with classification diagnosis four kinds infection people plasmodium probe is placed in hybridization bag or hybrid pipe, adds 300 μ L hybridization solutions;
(2) with biotin labeled amplified production in 95 DEG C of sex change 5min, rapid ice bath 2min;
(3) in hybridization solution, 30 μ L sex change amplified productions are added, room temperature hybridization 3hr;
(4) discard hybridization solution, respectively wash 2 times with washing lotion I, washing lotion II, each 5min;
(5) discard washing lotion, add the Streptavidin of the alkali phosphatase enzyme mark of 1000 times of dilutions, in room temperature reaction 30min;
(6) discard enzyme liquid, wash 2 times with substrate buffer solution, each 5min;
(7) discard substrate buffer solution, add the substrate of new preparation, lucifuge reaction 5-15min;
(8) substrate is discarded, use deionized water termination reaction, result of determination after film drying, occur that the judgement of obvious bluish voilet spot is positive findings, be immaculately judged to be negative findings.
4. probe as claimed in claim 1, test kit as claimed in claim 2 and the polymerase chain reaction-reverse dot blot hybridization classification diagnosis method for plasmodium diagnosis as claimed in claim 3 are including but not limited to employing micro-total analysis technology; It is characterized in that, the lysis of sample to be tested vat liquor, nucleic acid extraction purifying, nucleic acid amplification and detection are all integrated on micro-total analysis system and automatically complete, this micro-total analysis system is driven by micro diaphragm pump (valve), by unlatching and the closed drived control realizing microfluid sample of time variable control micro diaphragm pump (valve).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410717439.6A CN104450903B (en) | 2014-12-01 | 2014-12-01 | Probe for classificatory detection of four plasmodia infecting human, kit and using method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410717439.6A CN104450903B (en) | 2014-12-01 | 2014-12-01 | Probe for classificatory detection of four plasmodia infecting human, kit and using method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450903A true CN104450903A (en) | 2015-03-25 |
| CN104450903B CN104450903B (en) | 2017-04-12 |
Family
ID=52897648
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410717439.6A Active CN104450903B (en) | 2014-12-01 | 2014-12-01 | Probe for classificatory detection of four plasmodia infecting human, kit and using method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450903B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106319060A (en) * | 2016-08-31 | 2017-01-11 | 北京卓诚惠生生物科技股份有限公司 | Primer group and kit for detecting blood parasites by multi-PCR |
| CN109486962A (en) * | 2018-11-16 | 2019-03-19 | 合肥欧创基因生物科技有限公司 | A kind of plasmodium nucleic acid parting detecting reagent and its application method |
| CN113774157A (en) * | 2021-01-18 | 2021-12-10 | 江苏硕世生物科技股份有限公司 | Method for rapidly detecting and typing five plasmodia |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101541978A (en) * | 2006-11-30 | 2009-09-23 | Id-菲什技术公司 | Nucleic acid probes and methods for detecting plasmodium parasites |
| CN102220419A (en) * | 2011-04-26 | 2011-10-19 | 广东出入境检验检疫局检验检疫技术中心 | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof |
| CN103911463A (en) * | 2014-04-03 | 2014-07-09 | 河北国际旅行卫生保健中心 | Kit for detecting mosquito borne pathogens and detection method thereof |
-
2014
- 2014-12-01 CN CN201410717439.6A patent/CN104450903B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101541978A (en) * | 2006-11-30 | 2009-09-23 | Id-菲什技术公司 | Nucleic acid probes and methods for detecting plasmodium parasites |
| CN102220419A (en) * | 2011-04-26 | 2011-10-19 | 广东出入境检验检疫局检验检疫技术中心 | Nested PCR (Polymerase Chain Reaction) detection and fluorescence PCR detection kit for universal type malaria and subtypes thereof |
| CN103911463A (en) * | 2014-04-03 | 2014-07-09 | 河北国际旅行卫生保健中心 | Kit for detecting mosquito borne pathogens and detection method thereof |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106319060A (en) * | 2016-08-31 | 2017-01-11 | 北京卓诚惠生生物科技股份有限公司 | Primer group and kit for detecting blood parasites by multi-PCR |
| CN106319060B (en) * | 2016-08-31 | 2019-06-28 | 北京卓诚惠生生物科技股份有限公司 | Primer sets and kit for multiplex PCR detection haematozoon |
| CN109486962A (en) * | 2018-11-16 | 2019-03-19 | 合肥欧创基因生物科技有限公司 | A kind of plasmodium nucleic acid parting detecting reagent and its application method |
| CN113774157A (en) * | 2021-01-18 | 2021-12-10 | 江苏硕世生物科技股份有限公司 | Method for rapidly detecting and typing five plasmodia |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450903B (en) | 2017-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103757134B (en) | The fluorescence quantitative PCR detection reagent of African swine fever virus, test kit and detection method thereof | |
| CN100359022C (en) | Fluorescence quantitative PCR detection reagent for Asf virus and preparation method and use thereof | |
| Balamurugan et al. | A rapid and sensitive one step-SYBR green based semi quantitative real time RT-PCR for the detection of peste des petits ruminants virus in the clinical samples | |
| CN105087824B (en) | The preparation and use of Hemorrhagic fever correlation pathogen sldh gene chip | |
| CN103911447B (en) | Detect plasmodial primer, probe and method | |
| CN106086242A (en) | A kind of test kit detected for Flavivirus fast typing and virus load | |
| CN103911463A (en) | Kit for detecting mosquito borne pathogens and detection method thereof | |
| CN102719564B (en) | Triple polymerase chain reaction (PCR) kit for duck hepatitis virus type I, duck circoviruses and Muscovy duckling parvovirosis and application of triple PCR kit | |
| CN104450903A (en) | Probe for classificatory diagnosis of four plasmodia infecting human, kit and using method thereof | |
| CN110878381A (en) | Primer composition, kit and method for detecting mycoplasma bovis and infectious bovine rhinotracheitis virus | |
| WO2021254109A1 (en) | Specific primer pair for hiv-1 viral load real-time fluorescence quantitative pcr test, and test kit | |
| CN103589782A (en) | Kit for detecting genetically modified soybean | |
| CN108977578A (en) | Detect the kit and its method of H7N9 avian influenza virus | |
| CN105002284A (en) | Haemophilus paragallinarum fluorogenic quantitative PCR detection method | |
| CN103103287B (en) | Multigene-based influenza C virus real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection reagent | |
| CN110331221B (en) | Plasmodium gene diagnosis primer | |
| CN1865937A (en) | Real-time fluorescent quantitative detection method for simultaneous detection of A-type and B-type influenza virus and kit therefor | |
| Zhai et al. | Recombinase polymerase amplification combined with lateral flow dipstick for the rapid detection of Prorocentrum donghaiense | |
| KR102039178B1 (en) | Primer for amplifying the gene of malaria protozoa for the diagnosis of infections of malaria protozoa and detection method of malaria protozoa using the same | |
| CN105695601A (en) | Chimeric primer multiple PCR molecular detection kit for malaria species-genera detection and detection method thereof | |
| CN103589781A (en) | Detection kit for genetically modified corn | |
| CN102031314A (en) | Primer and probe sequence for human metapneumovirus nucleonic acid detection | |
| KR101312465B1 (en) | Primemrs and methods for detecting plasmodium vivax and plasmodium falciparum causing malaria, and detection kit thereof | |
| CN102154523A (en) | Primer for detecting human BK viral nucleic acid, fluorescent probe and application thereof | |
| CN102851395B (en) | Liquid-phase chip method used for detecting infectious laryngotracheitis virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210224 Address after: A4-041, 14 / F, block a, building J1, phase II, innovation industrial park, 2800 innovation Avenue, high tech Zone, Hefei City, Anhui Province, 230000 Patentee after: Hefei Guoyan Hanyin Testing Technology Co.,Ltd. Address before: 100123 Room 403, 4th floor, building 2, A3 Gaobeidian North Road, Chaoyang District, Beijing Patentee before: CHINA INSPECTION LABORATORY TECHNOLOGIES Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210927 Address after: 100123 1014, 10th floor, building 9, yard 3, Huangchang Road, Chaoyang District, Beijing Patentee after: CHINA INSPECTION LABORATORY TECHNOLOGIES Co.,Ltd. Address before: A4-041, 14 / F, block a, building J1, phase II, innovation industrial park, 2800 innovation Avenue, high tech Zone, Hefei City, Anhui Province, 230000 Patentee before: Hefei Guoyan Hanyin Testing Technology Co.,Ltd. |
|
| TR01 | Transfer of patent right |