CN104450651B - A kind of β glucosides enzyme mutant and its application - Google Patents
A kind of β glucosides enzyme mutant and its application Download PDFInfo
- Publication number
- CN104450651B CN104450651B CN201410753327.6A CN201410753327A CN104450651B CN 104450651 B CN104450651 B CN 104450651B CN 201410753327 A CN201410753327 A CN 201410753327A CN 104450651 B CN104450651 B CN 104450651B
- Authority
- CN
- China
- Prior art keywords
- beta
- glucosidase
- enzyme
- gene
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/2445—Beta-glucosidase (3.2.1.21)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01021—Beta-glucosidase (3.2.1.21)
Abstract
It is an object of the invention to provide a kind of β glucosides enzyme mutant and its application.The amino acid sequence of the β glucosides enzyme mutant is SEQ ID NO：3, the nucleotide sequence of its encoding gene is SEQ ID NO：4, optimum temperature is 50 DEG C, and can keep more than 80% enzyme activity within the scope of 30 DEG C 60 DEG C, and heat resistance is more stronger than wild type；Most suitable action pH is 5.0, and can keep more than 70% enzyme activity in the scopes of pH3.0 6.0, and the scope of application in acid condition is more broader than wild type, therefore advantageously in its application in cellulosic material degradation process.
Description
Technical field
The invention belongs to genescreen renovation technique field, and in particular to a kind of beta-glucosidase enzyme mutant and its should
With.
Background technology
Beta-glucosidase, also known as β-D-Glucose glycosides glucose hydrolysis enzyme, alias gentiobiase, cellobiase
(cellobias, CB or β-G) and amygdalase.It belongs to cellulose enzyme, is the important composition in cellulose decomposition enzyme system
Composition, can hydrolyze the β-D-Glucose key for being incorporated into end irreducibility, while discharging β-D-Glucose and matching somebody with somebody accordingly
Base.
Cellulose is formed by connecting D- glucopyranose polymer by β-Isosorbide-5-Nitrae-glycosidic bond, is most abundant on the earth and can
The resource of regeneration.It is estimated that on the earth annual photosynthesis produce 1.5 × 101,100,000,000 tons of celluloses (Ryu, D.D etc., 1980,
Enzyme and Microbial Technology).In most cases, higher value application cellulose first must be by fibre
The plain enzyme of dimension is effectively degraded to it.The biology of cellulase-producing is many in nature, mainly microorganism, such as filamentous fungi,
Bacterium and actinomyces etc..Therefore, screening or genetic modification research and application to cellulase-producing microorganism just receives universal
Concern.
It is generally believed that cellulose substances, which enzymatically act on generation glucose, at least needs three kinds of enzymes：Endoglucanase,
Exocellobiohydrolase and beta-glucosidase.Endoglucanase and exocellobiohydrolase first drop cellulose
Solution is into cellobiose, and it resolves into glucose by beta-glucosidase again.Cellulase is mainly cooperateed with by these three enzymes to be made
With finally converting cellulose into glucose.Beta-glucosidase plays a key effect in this process.And in cellulase
Beta-glucosidase content is few in component, vigor is low, the bottleneck as cellulase hydrolysis.Therefore, pass through gene recombination technology structure
Engineering bacteria is built, the degraded effective to cellulose of secreting, expressing high activity beta-glucosidase is significant.Therefore, having had very
A variety of beta-glucosidase genes are built into different engineering bacterias.And the more excellent beta-glucosidase of performance is developed,
And improve its expression quantity and be still one of study hotspot of this area.
The content of the invention
It is an object of the invention to provide a kind of beta-glucosidase enzyme mutant and its application.The present invention passes through mass mutation
Screening, finally obtains that a kind of heat resistance is stronger, the wider range of mutant of the scope of application under sour environment, and builds and weighed
Group expresses the trichoderma reesei engineered strain of the mutant, to realize that its application is laid a good foundation.
One aspect of the present invention is related to a kind of beta-glucosidase, is that amino acid sequence is SEQ ID NO：1 β-glucose
93rd amino acids of glycosides enzyme are changed into Ile from Leu, and the 133rd amino acids are changed into Phe from Tyr, and the 222nd amino acids are become by Asn
For Gly, the 579th amino acids are changed into Leu from Ile, and the 676th amino acids are changed into Phe from Gln.
The amino acid sequence of above-mentioned beta-glucosidase enzyme mutant is SEQ ID NO：3, the nucleotide sequence of its encoding gene
For SEQ ID NO：4.
Another aspect of the present invention, which is related to, carries coded sequence for SEQ ID NO：4 beta-glucosidase enzyme mutant gene
Recombinant plasmid.
The invention further relates to a kind of engineered strain, it carries above-mentioned recombinant plasmid.
The engineered strain is trichoderma reesei (Trichoderma reesei).
The invention further relates to a kind of cellulase, prepared by the fermentation of above-mentioned trichoderma reesei.
The present invention obtains a kind of new beta-glucosidase enzyme mutant, the most suitable effect of the mutant by a large amount of screenings
Temperature is 50 DEG C, and can keep within the scope of 30 DEG C -60 DEG C more than 80% enzyme activity, and heat resistance is more stronger than wild type；It is most suitable to make
It is 5.0 with pH, and more than 70% enzyme activity can be kept within the scope of pH3.0-6.0, the scope of application in acid condition is than wild
Raw type is broader, therefore advantageously in its application in cellulosic material degradation process.
Brief description of the drawings
Fig. 1：SDS-PAGE electrophoresis detection figures,
Wherein swimming lane 1 is T. reesei host fermented supernatant fluid, and swimming lane 2 is trichoderma reesei TR-BG fermented supernatant fluids, swimming
Road 3 is for 95KDa at trichoderma reesei TR-BG5 fermented supernatant fluids, arrow meaning；
Fig. 2：Beta-glucosidase wild type enzyme activity relative with mutant-operative temperature curve map；
Fig. 3：Beta-glucosidase wild type enzyme activity relative with mutant-action pH curve map.
Embodiment
The method of the present invention is described further with reference to example.The experiment of unreceipted actual conditions in embodiment
Method, generally can routinely condition, as J. Pehanorm Brookers (Sambrook) etc. are write《Molecular Cloning:A Laboratory guide》Middle institute
The condition stated, or run according to the condition proposed by manufacturer.Those skill in the art related can be by embodiment more
Understand well and grasp the present invention.
The clone of the beta-glucosidase gene of embodiment 1 and its structure of mutant
1.1 extract aspergillus fumigatus total genomic dna
By aspergillus fumigatus (Aspergillus fumigatus) incubated overnight, appropriate thalline is taken to be placed in centrifuge tube,
13000rpm centrifuges 5min, abandons supernatant；Add 400 μ l extraction buffers (100mM Tris-HCl, 100mM EDTA, 250mM
NaCl, 1%SDS)；Then plus 100mg quartz sands or bead, make instrument in pearl and acutely vibrate 2min or so；65 DEG C of water-bath 20min
Afterwards, 200 μ l10M NH4AC, ice bath 10min are added；13000rpm centrifuges 10min, takes supernatant；Add the anhydrous second of 2 times of volumes
Alcohol, -20 DEG C of placement 30min；13000rpm centrifuges 10min, abandons supernatant；Washed with 70% ethanol 2 times；Dry, add water dissolving,
In -20 DEG C of preservations.
1.2 gene cloning
The genome DNA extracted using in 1.1 is utilized respectively primer BG-F and BG-R and enters performing PCR amplification as template：
BG-F：AAAGGTACCATGAGATTCGGTTGGCTCGAGG；
BG-R：AAATCTAGACTAGTAGACACGGGGCAGAGG；
PCR amplification conditions are 95 DEG C of 4min；94℃30S；58 DEG C of 30S, 72 DEG C of 3min30 circulations；72 DEG C, 7min；Gel
QIAquick Gel Extraction Kit reclaims pcr amplification product.
1.3 expression vector establishment
Pcr amplification product in 1.2 is subjected to digestion with restriction enzyme XbaI and KpnI；Meanwhile, with restricted interior
Enzyme cutting XbaI and KpnI carries out digestion to Trichoderma expression vector pTG；Digestion products are purified using gel purification kit, are used in combination
T4DNA ligases connect above-mentioned two digestion products；Connection product is transformed into DH5a Escherichia coli, entered with ampicillin
Row selection.By the way that the clone obtained is sequenced, the gene order of above-mentioned pcr amplification product is SEQ ID NO:2
(being named as TR-BG), its amino acid sequence encoded is SEQ ID NO:1.Found through NCBI BLAST sequence alignments, SEQ ID
NO:The amino acid sequence similarity of 1 beta-glucosidase with deriving from aspergillus fumigatus is 100%.
Use amount reagent preparation box purification of Recombinant plasmid, the matter from the correct escherichia coli cloning of sequencing result in plasmid
Grain is named as pTG-TR-BG.
The acquisition of 1.4 mutant
In order to further improve above-mentioned beta-glucosidase, (amino acid sequence is SEQ ID NO to applicant:1) heat-resisting
Property, obtained recombinant plasmid pTG-TR-BG is built using in 1.3 as template, primer is separately designed, carrying out multiple spot to target gene determines
Point mutation, as a result finds that some mutation do not influence on its heat resistance, and some mutation even make heat resistance worse, also have in addition
A little mutation, although its pH scope of application after heat resistance, but mutation can be improved and narrowed, it is undesirable.Finally, applicant obtains
Heat resistance can be significantly improved, again can expand the combination in the mutational site of the scope of application under acid condition：L93I, Y133F,
The point mutation of N222G, I579L, Q676F five.
Above-mentioned five point mutation body is named as TR-BG5, its amino acid sequence is SEQ ID NO:3, with reference to the sequent synthesis
One coding nucleotide sequence SEQ ID NO:4.The sequence is the codon bias according to trichoderma reesei and optimum synthesis, and
Two restriction enzyme sites of KpnI and XbaI are added respectively at the two ends of composition sequence 5 ' and 3 ', and it is limited to give birth to work bioengineering share by Shanghai
Company completes.
Recombinant plasmid containing above-mentioned five point mutation body gene is built using operation described in 1.3, pTG-TR-BG5 is named as.
Embodiment 2 is converted and screening
Li's Trichoderma strains spore suspension is drawn in PDA plate center (9cm culture dishes), treats that bacterium colony covers with whole culture
Ware, respectively cuts the culture medium of 1cm × 1cm sizes, is placed in 120mL YEG+U fluid nutrient mediums, 30 DEG C, 200rpm, and culture 14~
16h。
Mycelium is collected with sterile Miracloth filter clothes, and is cleaned once with solution A, will aseptically be cleaned
Mycelium be transferred to 40mL Protoplasting solutions, 30 DEG C, 90rpm cultivates 1-2h, and protoplast is detected with micro- sem observation
Conversion progress.
With the above-mentioned warm bath liquid of sterile Miracloth filter-cloth filterings, gained filtrate is protoplast solution.By plasm
Liquid solution is sub-packed in the sterile disposable centrifuge tubes of two 50mL, and the volume of every pipe is settled into 45mL with solution B,
3000rpm, centrifuges 10min, and abandoning supernatant is precipitated；Clean precipitation again with 5mL solution Bs twice；By pellet resuspended in
In 10mL solution Bs, and protoplast is counted with blood counting chamber.Protoplast is centrifuged again and abandoning supernatant, according to
Blood counting chamber count results, add appropriate solution B and precipitation are resuspended so that protoplast number is 1 × 108Individual/mL or so.
On ice, the above-mentioned protoplast solutions of 200 μ L are added in the sterile 7mL centrifuge tubes of precooling, each conversion reaction
With 1 pipe, 10 μ g recombinant plasmid pTG-TR-BG5 are added, 50 μ L solution Cs is added, 20min is placed on ice again after gentle mixing.
Conversion upper strata culture medium is melted and is maintained at 55 DEG C；Above-mentioned 7mL centrifuge tubes are removed from ice, and are added into pipe
2mL solution Cs and 4mL solution Bs, gently mix each pipe, and gained mixture is protoplast mixture；Tried to 3 top agars
The above-mentioned protoplast mixtures of 1mL are added in each in pipe, and are toppled over immediately with converting on lower floor's flat board, and flat board is existed
5-7d is cultivated at 30 DEG C to there is transformant to grow.
The one of transformant incubated overnight of picking, takes appropriate thalline to be placed in centrifuge tube, 13000rpm centrifugation 5min, abandons
Supernatant；Add 400 μ l extraction buffers (100mM Tris-HC, 100mM EDTA, 250mM NaCl, 1%SDS)；Then plus
100mg quartz sands or bead, make instrument in pearl and acutely vibrate 2min or so；After 65 DEG C of water-bath 20min, 200 μ l10M are added
NH4AC, ice bath 10min；13000rpm centrifuges 10min, takes supernatant；Add the absolute ethyl alcohol of 2 times of volumes, -20 DEG C of placements
30min；13000rpm centrifuges 10min, abandons supernatant；Washed with 70% ethanol 2 times；Dry, add water dissolving, in -20 DEG C of preservations.
The genomic DNA of above-mentioned transformant is extracted, and as template, enters performing PCR amplification using upstream and downstream primer, to mesh
Gene verified.
Upstream primer sequence is：GGGGTACCATGGCTCTCTCCAAGCT；
Downstream primer sequence is：GCTCTAGATTACAAGCACTGCGAATAC；
PCR amplification conditions are 95 DEG C of 4min；94℃40S；58 DEG C of 40S, 72 DEG C of 3min, 30 circulations；72℃7min.Utilize
Gel reclaims kit reclaims pcr amplification product, and carries out sequencing analysis, and the gene order for as a result showing pcr amplification product is
SEQ ID NO:4, so as to illustrate that the present invention builds the trichoderma reesei for having obtained the TR-BG5 genes of enzyme mutant containing beta-glucosidase
Engineering bacteria, is named as trichoderma reesei TR-BG5 (Trichoderma reesei TR-BG5).
Wild type beta-glucosidase TR-BG gene is also transformed into trichoderma reesei using above-mentioned same method, structure
The trichoderma reesei engineering bacteria for obtaining recombinantly expressing wild type beta-glucosidase TR-BG is built, trichoderma reesei TR-BG is named as
(Trichoderma reesei TR-BG)。
Solution A：2.5mL1M K2HPO4, 2.5mL1M KH2PO4, 48.156g MgSO4, add dlH2O is to final volume
500mL, the filtering with microporous membrane with 0.22 μm is degerming.
Solution B：5mL1M Tris (pH7.5), 2.77g CaCl2, 109.32g sorbierites, addition dlH2O is to final volume
500mL, the filtering with microporous membrane with 0.22 μm is degerming.
Solution C：250g PEG4000,2.77g CaCl2, 5mL1M Tris (pH7.5), addition dlH2O is to final volume
500mL, the filtering with microporous membrane with 0.22 μm is degerming.
Protoplasting solution：By 0.4mg lyases (Lysing Enzyme from Trichoderma
Harzianum, Sigma) it is dissolved in 40mL solution As, the filtering with microporous membrane with 0.22 μm is degerming.
Convert lower floor's flat board：0.1%MgSO4, 1%KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 0.35% agar
Powder.
Convert upper strata culture medium：0.1%MgSO4, 1%KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorb
Alcohol, 0.35% agarose.
Trace element：In 250mL dlH21g FeSO are added in O4·7H2O, 8.8g ZnSO4·7H2O, 0.4gCuSO4·
5H2O, 0.15g MnSO4·4H2O, 0.1g Na2B4O7·10H2O, 50mg (NH4)6Mo7O24·4H2The dense HCl of O, 0.2mL, completely
DlH is used after dissolving2O is settled to 1L, and the filtering with microporous membrane with 0.22 μm is degerming.
PDA plate：20g glucose, 200g potato cooking liquors, 15g agar adds dlH2O is to final volume 1000mL, high pressure
Steam sterilization.
YEG+U fluid nutrient mediums：20g glucose, 5g yeast extracts, 1g uridines add dlH2O is to final volume
1000mL, autoclaving.
The fermentation checking of embodiment 3
The T. reesei host, trichoderma reesei TR-BG5 and trichoderma reesei TR-BG that do not import foreign gene are connect respectively
Plant in MM fermentation mediums (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09%
MgSO4, 2%KH2PO4, 0.04%CaCl2, 0.018% Tween-80,0.018% trace element) to cultivate, 30 DEG C of cultures 48 are small
When, then cultivate 48 hours for 25 DEG C.Zymotic fluid is centrifuged respectively, takes supernatant to carry out SDS-PAGE electrophoresis detections.As a result
As shown in figure 1, the theoretical molecular size of the beta-glucosidase of the present invention from aspergillus fumigatus is about 95KDa, i.e. Fig. 1
The signified position of middle arrow, swimming lane 1 is Host Strains fermented supernatant fluid, and it does not almost have protein band in arrow pointed location, and
The trichoderma reesei TR-BG of swimming lane 2 and the trichoderma reesei TR-BG5 fermented supernatant fluids of swimming lane 3 respectively have at arrow meaning one it is very bright
Aobvious protein band, so as to illustrate that the trichoderma reesei engineering bacteria TR-BG that the present invention is built can effective expression wild-type beta-glucose
Glycosides enzyme TR-BG, trichoderma reesei engineering bacteria TR-BG5 can effective expression beta-glucosidase enzyme mutant TR-BG5.
The beta-glucosidase enzyme activity determination of embodiment 4
1st, enzyme activity determination method
1) unit of enzyme activity defines
It is per minute from the salicin solution that concentration is 0.5% under conditions of 50 DEG C, pH value are 4.8 (neutrality is 6.0)
Degraded release is an enzyme activity unit U equivalent to the enzyme amount required for the reduced sugar of 1 micromoles glucose.
2) measuring principle
Beta-glucosidase can be in hydrolysis fiber disaccharides glucoside bond generation glucose.Glucose is in boiling water bath
Under the conditions of can with 3,5- dinitrosalicylic acids (DNS) reagent occur chromogenic reaction.The depth of reaction solution color is produced with enzymolysis
Glucose amount be directly proportional, and the growing amount of glucose is directly proportional to the vigor of beta-glucosidase in reaction solution.Therefore,
The intensity of reaction solution color is determined by spectral colorimetric, the vigor of beta-glucosidase in reaction solution can be calculated.
3) determination step
Take four 25mL colorimetric cylinders (blank tube, three sample cells).It is accurate to add with corresponding respectively into four branch pipes
Salicin solution (5.3) 2.00mL of pH buffer preparations.Difference accurately adds the enzyme liquid 0.50mL to be measured diluted in three
In branch sample cell (blank tube is not added with), mixed with eddy blending machine, Gai Sai.Four test tubes are placed in 50 ± 0.1 DEG C of water-baths simultaneously
In, 15min is reacted in accurate timing.DNS reagent 3.OmL are quickly and accurately added into each pipe, are accurately added in blank tube
The enzyme liquid 0.50mL to be measured diluted, shakes up.Four branch pipes are put into boiling water bath simultaneously, accurate timing, heat 10min, taken out,
Room temperature is rapidly cooled to, 25mL is settled to water.Returned to zero with blank tube, under spectrophotometer wavelength 540nm, use 10mm colorimetrics
Cup, is measured respectively.The absorbance of sample liquid, averages in three sample cells.By looking into standard curve or using equation of linear regression
Obtain the content of reduced sugar.
4) enzyme activity is calculated
Enzyme activity calculation formula：X1=A × (106/180.2/103) × 1/0.5 × n/15=0.74 × A × n
In formula：
X l-β glucuroide enzyme activities, u/g (or u/mL)；
A-absorbance checks in the reduction sugar amount of (or calculating), mg on standard curve；
106/180.2/103- glucose content is converted into micromole；
1/0.5-it is converted into enzyme liquid 1ml；
The extension rate of n-enzyme sample；
15-time scale factor.
2nd, enzyme activity determination result
It is only 5.5U/mL, trichoderma reesei TR-BG to determine T. reesei host fermented supernatant fluid enzyme activity according to the method described above
Fermented supernatant fluid enzyme activity be 242U/mL, and the enzyme activity of trichoderma reesei TR-BG5 fermented supernatant fluids be 291U/mL, so as to enter
One step proves that Host Strains produce the amount of beta-glucosidase seldom in itself, and recombinant bacterium trichoderma reesei TR-BG and TR-BG5 then can be high
The beta-glucosidase of effect expression external source.
The characterization analysis of embodiment 5
1st, optimum temperature
Respectively in 20 DEG C, 25 DEG C, 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C, pH6.0 bars
Above-mentioned trichoderma reesei TR-BG and TR-BG5 fermented supernatant fluid enzyme activity is determined under part, using highest enzyme activity as 100%, calculates relative
Enzyme activity, does temperature-relative enzyme activity curve.As a result as shown in Fig. 2 wild type beta-glucosidase TR-BG optimum temperature
For 40 DEG C, and beta-glucosidase enzyme mutant TR-BG5 optimum temperature is 50 DEG C, and can be protected within the scope of 30 DEG C -60 DEG C
More than 80% enzyme activity is held, so as to illustrate that the heat resistance of beta-glucosidase after mutation is significantly improved.
2nd, Optimun pH
Respectively with pH value in 3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0 buffer solution dilution
Trichoderma reesei TR-BG and TR-BG5 fermented supernatant fluid is stated, its enzyme activity is determined under the conditions of 50 DEG C, using highest enzyme activity as 100%,
Relative enzyme activity is calculated, pH- is with respect to enzyme activity curve.As a result as shown in figure 3, wild type beta-glucosidase TR-BG most suitable work
It is 6.0 with pH, and beta-glucosidase enzyme mutant TR-BG5 most suitable action pH is 5.0, and can be protected within the scope of pH3.0-6.0
More than 70% enzyme activity is held, so as to illustrate that the adaptability of beta-glucosidase in acid condition is significantly increased after mutation
By force, the scope of application is more wide in range.
To sum up, expression quantity of the beta-glucosidase enzyme mutant that the present invention is obtained in trichoderma reesei is significantly higher than wild
Type, and the heat resistance of mutant is stronger, the scope of application in acid condition is broader, advantageously in it in cellulosic material
Application in enzymolysis process.
Claims (7)
1. a kind of beta-glucosidase, it is characterised in that described beta-glucosidase is that amino acid sequence is SEQ ID NO：1
The 93rd amino acids of beta-glucosidase Ile is changed into from Leu, the 133rd amino acids are changed into Phe, the 222nd ammonia from Tyr
Base acid is changed into Gly from Asn, and the 579th amino acids are changed into Leu from Ile, and the 676th amino acids are changed into Phe from Gln；Its amino acid
Sequence is SEQ ID NO：3.
2. a kind of gene, it is characterised in that the beta-glucosidase described in described gene code claim 1.
3. gene as claimed in claim 2, it is characterised in that the nucleotide sequence of the gene is SEQ ID NO：4.
4. a kind of recombinant plasmid, it is characterised in that described recombinant plasmid carries the gene described in claim 2.
5. a kind of engineered strain, it is characterised in that described engineered strain carries the recombinant plasmid described in claim 4.
6. engineered strain as claimed in claim 5, it is characterised in that described engineered strain is trichoderma reesei
(Trichoderma reesei)。
7. a kind of method of the beta-glucosidase prepared described in claim 1, it is characterised in that described method is to use right
It is required that the engineered strain fermentation described in 5 prepares beta-glucosidase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410753327.6A CN104450651B (en) | 2014-12-09 | 2014-12-09 | A kind of β glucosides enzyme mutant and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410753327.6A CN104450651B (en) | 2014-12-09 | 2014-12-09 | A kind of β glucosides enzyme mutant and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450651A CN104450651A (en) | 2015-03-25 |
| CN104450651B true CN104450651B (en) | 2017-08-15 |
Family
ID=52897406
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410753327.6A Active CN104450651B (en) | 2014-12-09 | 2014-12-09 | A kind of β glucosides enzyme mutant and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450651B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104975039B (en) * | 2015-06-24 | 2018-05-11 | 方诩 | A kind of recombinant plasmid and its application in degraded cellulose raw material |
| CN105524903B (en) * | 2016-01-28 | 2019-03-12 | 中国农业科学院饲料研究所 | A kind of beta-glucosidase improvement mutant E168Q and its encoding gene and application |
| CN105567663B (en) * | 2016-01-28 | 2018-09-07 | 中国农业科学院饲料研究所 | The β-glucosidase mutants F67Y and its encoding gene and application that a kind of catalytic efficiency improves |
| CN105567662B (en) * | 2016-01-28 | 2018-09-07 | 中国农业科学院饲料研究所 | A kind of thermophilic β-glucosidase mutants-M36N and its encoding gene and application |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
| CN117402858B (en) * | 2023-12-13 | 2024-03-15 | 北京科为博生物科技有限公司 | Beta-glucosidase mutant with improved heat resistance |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2228440B1 (en) * | 2003-05-02 | 2012-08-22 | Novozymes Inc. | Variants of beta-glucosidases |
| CN103589701B (en) * | 2013-11-18 | 2015-02-04 | 青岛蔚蓝生物集团有限公司 | Low-temperature cellulase and application thereof |
| CN103725660B (en) * | 2013-12-04 | 2015-07-29 | 青岛蔚蓝生物集团有限公司 | A kind of endoglucanase and application thereof |
| CN103642778B (en) * | 2013-12-18 | 2015-08-05 | 青岛蔚蓝生物集团有限公司 | A kind of β-endo-glucanase enzyme mutant and application thereof |
| CN103865905B (en) * | 2014-03-13 | 2015-08-19 | 青岛蔚蓝生物集团有限公司 | A kind of endoglucanase |
-
2014
- 2014-12-09 CN CN201410753327.6A patent/CN104450651B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450651A (en) | 2015-03-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104450651B (en) | A kind of β glucosides enzyme mutant and its application | |
| CN103589701B (en) | Low-temperature cellulase and application thereof | |
| Sakthiselvan et al. | Molecular characterization of a Xylanase-producing fungus isolated from fouled soil | |
| CN109321552A (en) | A kind of novel Pullulanase and its gene, engineering bacteria and preparation method | |
| CN109072222A (en) | Fungus Trichoderma with saltant type BXL1 gene and the manufacturing method using fungi manufacture xylo-oligosaccharide and glucose | |
| CN101870985B (en) | Endo-beta-glucanase gene | |
| CN103060208B (en) | Trichoderma engineering strain capable of efficiently expressing beta-1, 4-glucanase coding gene and application thereof | |
| CN102021185B (en) | Function and usage of magnaporthe oryzae MoCHS1 gene and coded protein thereof | |
| Tang et al. | Fermentation and purification of cellulase from a novel strain Rhizopus stolonifer var. reflexus TP-02 | |
| CN102363774B (en) | Beta-mannaseBA-Man5A with wide pH range, gene thereof and application of gene | |
| CN105969783B (en) | The mutated gene TlXynA_3 of zytase TlXynA a kind of and its application | |
| CN105176849B (en) | A kind of preparation method and applications of the Li's Trichoderma strains of high yield Chillan mould alpha-galactosidase | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN103865905B (en) | A kind of endoglucanase | |
| CN104498456A (en) | Acidic beta-glucosidase Bgl3B and gene and application thereof | |
| Lim et al. | Cloning and expression of a Trichoderma longibrachiatum β-mannanase gene in Pichia pastoris | |
| CN104450653B (en) | Cellulase mutant and application thereof | |
| CN103232949A (en) | Pichia pastoris engineered strain expressing 61-family glycoside hydrolase gene | |
| CN104271738B (en) | The endoglucanase that characteristic improves | |
| Wahyudi et al. | Screening of chitinase-producing rhizosphere actinomycetes and their genetic diversity | |
| CN101407820B (en) | Gene of encoding glycosyl hydrolase family 32 sucrase and use thereof | |
| KR20090085379A (en) | Cellulase protein derived from bacillus amyloliquefaciens dl-3 and transformed escherichia coli dl-3 strain thereof | |
| CN110423704A (en) | A kind of Pichi strain of high yield feruloyl esterase | |
| CN103060341B (en) | Transcriptional regulation factor derived from trichoderma reesei and coding gene and application of transcriptional regulation factor | |
| CN116555094B (en) | Polysaccharide degrading bacteria of vibrio alginolyticus and culture method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Yiman Inventor after: Zhang Qing Inventor after: Li Bin Inventor after: Cao Tishuang Inventor after: Dong Jiqiao Inventor after: Tang Bo Inventor after: Huang Yijun Inventor after: Wang Huaming Inventor before: Zhang Qing Inventor before: Li Bin Inventor before: Cao Tishuang Inventor before: Dong Jiqiao Inventor before: Tang Bo Inventor before: Huang Yijun Inventor before: Wang Huaming |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |