CN104447717B - Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes - Google Patents

Abstract

Derivative that the invention provides a class Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes.The present invention uses the human enteric bacteria E.limosum ZL II with demethylating activity that Herba Silybi mariani flavone lignans carries out bioconversion, four demethyl derivatives of isolated.The derivative of the Herba Silybi mariani flavone lignanoid that the present invention provides shows inhibitory activity to the gathering of amyloid beta 42, and it is substantially better than prototype compound and Epigallo-catechin gallate (EGCG), there is the medicine prospect developing into the nerve degenerative diseases such as preventing and treating alzheimer's disease.The derivative of the Herba Silybi mariani flavone lignanoid that the present invention provides also shows certain inhibitory activity to cancer cell simultaneously.Achievement of the present invention has established working foundation for making full use of milk thistle resource and its economic value added of raising.

Description

Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes

Technical field

The invention belongs to biomedicine field, be specifically related to derivative and the preparation side thereof of a kind of Herba Silybi mariani flavone lignanoid Method and its purposes.

Background technology

Milk thistle (Silybi Fructus) is feverfew milk thistle Silybum marianum (L.) Gaertn. The dry mature fruit of (Milk thistle), originates in southern Europe, north African, records in the Pharmacopoeia of the People's Republic of China (2010 Version), cool in nature, bitter, return liver, gallbladder channel, there is clearing heat and detoxicating, effect of soothing liver-gallbladder, clinically for liver and gallbladder damp-heat, hypochondriac pain, The diseases in the liver and gallbladder such as jaundice.Milk thistle mainly includes the isomer of 6 flavanolignan's compounds, respectively legalon A/B (silybin A/B, two diastereoisomers), Isosilybin A/B (isosilybin A/B, two diastereo-isomerisms Body), Silychristin (silychristin) and silydianin (silydianin).This flavonolignan compound has been developed that Become Chinese patent drug silymarin (having another name called legalon, profit liver Thailand, Silibinin, sharp liver grand, CAS NO.65666-07-1), clinically For acute hepatitis, chronic hepatitis, early-phase hepatocirrhosis, the treatment of the diseases such as toxic liver injury；Herba Silybi mariani flavone constituents also protects the liver Rather, fly when the important source material of the hepatic cholagogic medicines such as sheet；In the U.S. and Europe using its active ingredient legalon as antioxygen helping digestion Product additive.

Summary of the invention

Derivative that it is an object of the invention to provide a kind of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes.

A kind of Herba Silybi mariani flavone lignanoid that the present invention provides is the compound as shown in formula I or formula II:

The preparation of compound shown in compound shown in the offer formula I that a further object is of the present invention, formula II, formula III or formula IV Method,

Comprise the steps 1) and 2):

1) mixture containing compound shown in formula V-formula VIII is added in medium base；Described medium base is It is suitable for bacterial strain Eubacterium limosum ZL-II CGMCC NO.6846 growth or the nutrient solution of fermentation；

2) step 1 will be inoculated in containing the bacterium solution of Eubacterium limosum ZL-II CGMCC NO.6846) prepare In culture medium, cultivate 48h and get final product for 37 DEG C.

In described method, described step 1) in, containing the mixture of compound shown in formula V-formula VIII and medium base Mass volume ratio is 2: 1；The unit of described quality is in terms of g, and the unit of volume is in terms of L.

In described method, described step 1) in, described addition by the mixture containing compound shown in formula V-formula VIII cultivates After in base basis, also wanting 121 DEG C of autoclaving 15min, then room temperature is placed standby.

In described method, described step 2) in, described bacterium solution and step 1) volume ratio of culture medium prepared is 1: 5；Institute State the OD of bacterium solution containing Eubacterium limosum ZL-II CGMCC NO.6846₆₀₀It is 1.826.

In described method, described medium base is specially cooked meat medium basis, consisting of: peptone 30.0g/ L, powdered beef 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium dihydrogen phosphate 5.0g/L, soluble starch 2.0g/L, solvent For water.

The described preparation method containing the bacterium solution of Eubacterium limosum ZL-II CGMCC NO.6846 is: take The frozen stock solution room temperature of Eubacterium limosum ZL-II CGMCC NO.6846 is melted, and adds in anaerobic liquid culture medium After 37 DEG C are cultivated 24h, so circulation carries out the amplification of bacterial strain.

In the described preparation method containing the bacterium solution of Eubacterium limosum ZL-II CGMCC NO.6846, described Frozen stock solution is 1: 5 with the volume ratio of anaerobic liquid culture medium；Repeat afterwards to be inoculated in anaerobism liquid according to the ratio of volume ratio 1: 10 Body culture medium expands system and increases bacterium, until obtaining OD₆₀₀The 500ml bacterium solution of=1.826.

Consisting of of described anaerobic liquid culture medium: peptone 15.0g/L, yeast 5.0g/L, soy peptone 5.0g/L, Powdered beef 5.0g/L, glucose 5.0g/L, sodium chloride 5.0g/L, soluble starch 3.0g/L, cysteine 0.5g/L, di(2-ethylhexyl)phosphate Hydrogen potassium 2.5g/L, ferroheme 0.005g/L, and vitamin K₁0.001g/L, solvent is water.

Described containing the mixture of compound shown in formula V-formula VIII be specially from composite family Silybum plant milk thistle Silybum marianum fruit uses the mixture of the flavone compound of methyl alcohol extraction, the mixing of this flavone compound Thing mainly includes that silymarin, described silymarin include legalon, Isosilybin, silydianin and Silychristin.

Described containing shown in formula V-formula VIII, the mixture of compound is specially the mixture of every 18.0g in, containing shown in formula V Compound shown in compound 24.006% shown in compound 7.692%, formula VII shown in compound 5.006%, formula VI and formula VIII 14.726%, described percentage is weight/mass percentage composition.

Described it is specially milk thistle methanolic extract powder, described water containing the mixture of compound shown in formula V-formula VIII Fly Ji methanolic extract powder purchased from Rui Di bio tech ltd, Xi'an, trade name silymarin, CAS NO.: 65666-07-1。

In described method, also include purification procedures；Described purification procedures includes macroporous absorbent resin XAD-2 Isolated and purified process, ODS press chromatographic separation and purification process and the isolated and purified process of preparative high performance liquid chromatography.

The condition of the described isolated and purified process of macroporous absorbent resin XAD-2 is: by step 2 in claim 2) training of gained Nutrient solution proceeds as follows, the nutrient solution of every 24L, filters to obtain supernatant, is splined on XAD-2 large pore resin absorption column, depends on respectively Each 6 column volumes of secondary deionized water, 10% ethanol water, 30% ethanol water, 50% ethanol water and 60% second 8 column volumes of alcohol solution elute, and collect 60% ethanol eluate flow point, remove solvent and obtain 7.48g Fr.1；Described post Sub-filler is XAD-2 macroporous absorbent resin, 1.7kg, granularity 20-60 mesh, average surface area 330m²/ g, post height × internal diameter is 450 ×90mm；It is 1L that described column volume refers specifically to a column volume；Described % refers to ethanol percentage by volume in ethanol water；

In described ODS, the condition of pressure chromatographic separation and purification process is: mixed by 7.48g Fr.1 and 11.22g reverse phase silica gel ODS Dry method loading after sample, pillar volume is 36 × 460mm, and filler is ODS, particle diameter 20-45 μm, pressure chromatogram methanol-water system in ODS System wash-out separates, and the flow velocity 20ml/min of eluent first elutes with 250ml 40% methanol aqueous solution, collects wash-out and starts to the The eluent of 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent；Again with 45% methanol aqueous solution wash-out, collect wash-out and open Begin to eluent first for 700ml, after removing solvent, obtain the Fr.1-2 of 325.3mg；Regather 700ml end to 1600ml end Eluent, remove after solvent to obtain the Fr.1-3 of 776.3mg；Described % nail alcohol percentage by volume in methanol aqueous solution；

The condition of the isolated and purified process of described preparative high performance liquid chromatography is: use preparative high performance liquid chromatography instrument SHIMADZU LC-20A, prepares post Inertsil ODS-3column, and post height × internal diameter is 250 × 20mm, and particle diameter 5 μm, with first The mixed liquor of alcohol and 0.1% aqueous formic acid carries out isocratic elution as elution buffer, purify respectively Fr.1-1, Fr.1-2 and Fr.1-3, in described elution buffer, methyl alcohol volumn concentration is 48%；In described 0.1% aqueous formic acid, the body of formic acid Long-pending percentage composition is 0.1%；The Fr.1-3 of Fr.1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg is used first respectively What alcohol was dissolved as 20.0mg/mL prepares mother liquor, mother liquor is prepared type high performance liquid chromatography respectively isolated and purified；Sample introduction every time Amount 1.0mL, flow velocity 10.0mL/min；For Fr.1-1 sample, collect the flow point that retention time is 38～41min, remove solvent After obtain compound shown in the formula IV of 43.2mg；For Fr.1-2 sample, collect the flow point that retention time is 45～53min, go Except obtaining compound shown in the formula III of 57.9mg after solvent；For in Fr.1-3 sample, first collecting retention time is 63～72min Flow point, remove the compound shown in formula II obtaining 61.5mg after solvent, regather the stream that retention time is 75～78min Point, obtain the compound shown in formula I of 26.3mg after removing solvent.

The compound that described method directly prepares falls within the scope of protection of the invention.

Compound shown in the offer formula I that a further object is of the present invention or formula II, or described method directly prepares Compound application in preparation has the product of following arbitrary purposes:

1) treatment Alzheimer disease；

2) suppression A β₄₂Protein aggregation；

3) treatment cancer；

4) suppression human cervical carcinoma cell, Human Prostate Cancer Cells, gastric carcinoma cells and/or the activity of human colon cancer cell.

Described human cervical carcinoma cell is specially human cervical carcinoma cell Hela；Described Human Prostate Cancer Cells is specifically people prostatitis Adenocarcinoma cell DU-145；Described gastric carcinoma cells is specially human gastric cancer cells BGC-823；Described human colon cancer cell is specifically people Colon cancer cell SW-480.

It is also another object of the present invention to provide Eubacterium limosum ZL-II CGMCC NO.6846 bacterial strain to exist Application in compound shown in preparation following formula I-formula IV is arbitrary:

The present invention uses has the human enteric bacteria E.limosum ZL-II of demethylating activity to Herba Silybi mariani flavone lignanoid Composition carries out bioconversion, four demethyl derivatives of isolated, and two of which is noval chemical compound, and this compounds exists Develop into the medicine prospect of the nerve degenerative diseases such as preventing and treating alzheimer's disease.

This analog derivative passes through ESI-TOF/MS,¹H NMR,¹³C NMR, HMBC and CD spectrum analysis, structure is reflected respectively It is set to demethyl Isosilybin B (T1), demethyl Isosilybin A (T2), demethyl Silybin B (T3) and demethyl water Fly Ji guest A (T4).T1-T4 is the converted product being separated to first, T1 and T2 is noval chemical compound.This compounds is to A Erci Silent sick amyloid-beta 42 (β-amyloid 42, the A β in sea₄₂) gathering show inhibitory activity, and be substantially better than prototype Compound and positive control Epigallo-catechin gallate (EGCG).T1-T4 has inhibitory activity to human cervical carcinoma cell Hela simultaneously, T1 and T2 has inhibitory activity to Human Prostate Cancer Cells DU-145, and T1 has inhibitory activity to human gastric cancer cells BGC-823, and T2 is to people Colon cancer cell SW-480 has inhibitory activity；But this compounds to the inhibitory activity of four kinds of tumour cells on the whole than prototype Compound is low.

Achievement of the present invention has established working foundation for making full use of milk thistle resource and its economic value added of raising；And such Derivative has potential application prospect in the treatment of the nerve degenerative diseases such as Alzheimer disease.

Accompanying drawing explanation

Fig. 1 is 16S rRNA gene homology analysis and the qualification result of ZL-II bacterial strain.Wherein, Strain ZL- II bacterial strain i.e. represents ZL-II bacterial strain.

Fig. 2 is chemical constitution and the bioconversion path of P1-P4 and T1-T4, and wherein * represents noval chemical compound.

Fig. 3 is that T1-T4 is to A β₄₂Inhibiting rate-the concentration curve assembled.

Fig. 4 is that P1-P4 is to A β₄₂Inhibiting rate-the concentration curve assembled.

Fig. 5 is compound P1-P4 and the T1-T4 inhibitory activity statistics figure to human tumor cells.

Detailed description of the invention

Experimental technique used in following embodiment if no special instructions, is conventional method.

Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.

The human enteric bacteria that following embodiment is used is mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846, this bacterial strain has been preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center (to be called for short CGMCC, deposit number is CGMCC NO.6846, and preservation date is on November 20th, 2012, and Classification And Nomenclature is Eubacterium limosum.The address at preservation center is Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101.

Milk thistle methanolic extract powder used in following embodiment is from composite family Silybum plant milk thistle Silybum marianum fruit uses the mixture of the flavone compound of methyl alcohol extraction, the mixing of this flavone compound Thing mainly includes that silymarin, described silymarin include legalon, Isosilybin, silydianin and Silychristin.

Described milk thistle methanolic extract powder is purchased from Rui Di bio tech ltd, Xi'an, trade name milk thistle Element, CAS NO.:65666-07-1.

In following embodiment use culture medium consist of:

Cooked meat medium basis (purchased from Beijing Luqiao Technology Co., Ltd., catalog number CM605): peptone 30.0g/L, powdered beef 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium dihydrogen phosphate 5.0g/L, soluble starch 2.0g/ L, solvent is water, pH 7.8.

Anaerobic liquid culture medium (purchased from Beijing Luqiao Technology Co., Ltd., catalog number CM1513): peptone 15.0g/L, yeast 5.0g/L, soy peptone 5.0g/L, powdered beef 5.0g/L, glucose 5.0g/L, sodium chloride 5.0g/L, Soluble starch 3.0g/L, cysteine 0.5g/L, potassium dihydrogen phosphate 2.5g/L, ferroheme 0.005g/L, and vitamin K₁ 0.001g/L, solvent is water, pH 7.3 ± 0.2.

Culture medium without carbon source: NaCl (3.0g), NH₄Cl (1.0g), PBS (100mL), deionized water 900 (mL), pH 6.4.It is sub-packed in 10mL before using and connects lid plastic centrifuge tube, often pipe 5mL；Surface covers 1mL atoleine；121 DEG C of high steams Sterilizing 20min；Room temperature is placed standby.PBS:KH₂PO₄(26.0g), K₂HPO₄(18.5g), deionized water (1L).

In sample involved in following embodiment, the HPLC detection method of enterodiol (END) is as follows:

Taking 200 μ L nutrient solutions, add 400 μ L water-saturated n-butanol extractions, 4800rpm/min is centrifuged 10min, takes supernatant 320 μ L are in centrifuge tube, and nitrogen dries up, and add 200 μ L chromatogram methyl alcohol, and 10000rpm/min is centrifuged 3min, takes supernatant 20 μ L Enter HPLC detection.Chromatographic column: Zorbax SB-C₁₈(4.6mm × 25cm, 5 μm, Agilent company of the U.S.)；Guard column Zorbax SB-C₁₈(4.6mm × 12.5mm, 5 μm, Agilent company of the U.S.)；Flowing phase: water (A)-acetonitrile (B), gradient elution: 0～ 30min (A: B volume ratio is changed to 50: 50 by 100: 0 linear gradients), 30～40min (A: B volume ratio is by 50: 50 linear gradients It is changed to 0: 100)；Flow velocity 1.0mL/min；Detection wavelength 280nm；Temperature 25 DEG C.

The percentage composition of the liquid described in following embodiment is percentage by volume.

Embodiment 1, the separation of mucus Eubacterium (Eubacterium limosum) ZL-II and qualification

One, the separation of mucus Eubacterium (Eubacterium limosum) ZL-II

Gather Freshman or stool in mice sample, increase bacterium through cooked meat medium, obtain gut flora sample, be inoculated into 5mL In culture medium without carbon source, add substrate flaxseed meal (particle diameter is 200 μm-1000 μm) 100mg, 37 DEG C of Anaerobic culturel 48h.Take 10 μ L is without carbon source culture medium bacterium solution, 10 times of gradient dilutions.Take 10^-6Times dilution is coated with flat board, 37 DEG C of Anaerobic culturel 24h.Picking is wherein Single bacterium colony, be inoculated into 5mL without in carbon source culture medium, add substrate flaxseed meal (particle diameter is 200 μm-1000 μm) 100mg, training Carrying out HPLC detection after supporting 2 days, screening can produce single bacterium colony of enterodiol.The bacterium solution taking 10 μ L active bacteria adds kitchen meat liquid Culture medium increasing bacterium, 10^-5Times dilution is coated with flat board, observes after Anaerobic culturel 48h, has white and relatively big (Strain-I), yellow And transparent and less (ZL-III) three kinds of different colours and the bacterium colony of form (ZL-II).

Two, the qualification of mucus Eubacterium (Eubacterium limosum) ZL-II

1, bacterial genomes DNA is extracted

Take ZL-II bacterial classification 0.5mL and be inoculated into anaerobic liquid culture medium 5mL cultivation 20h, take 1mL bacterium solution and carry out genomic DNA Extract.Bacterial genomes is extracted and is used kit (Tian Gen company, catalog number (Cat.No.) DP209), operates according to kit specification, obtains 120 μ L genome extracts.Detect through agarose gel electrophoresis, it was demonstrated that bacterial genomes DNA is extracted successfully.

2,16S rRNA amplification and order-checking

(1) design of primers: use enteron aisle bacterium universal primer, is synthesized by Shanghai Sheng Gong company.

Forward primer: AGAGTTTGATCCTGGCTCAG

Reverse primer: AAGGAGGTGATCCAGCCGCA

(2) PCR reaction system: be shown in Table 1.

Table 1.PCR amplification reaction system (50 μ L)

(3) pcr amplification reaction program:

(4) order-checking: PCR primer does not purifies, and send Beijing AudioCodes biotech firm to check order.

3,16S rRNA sequence analysis

16S rRNA sequence is as shown in sequence 1 in sequence table.Its 16S rRNA gene order is carried out homology analysis, ZL-II bacterial strain is accredited as mucus Eubacterium (Eubacterium limosum) (Fig. 1).This mucus Eubacterium (Eubacterium limosum) ZL-II is preserved in Chinese microorganism strain preservation conservator on November 20th, 2012 Meeting common micro-organisms center (being called for short CGMCC, address is: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, Deposit number is CGMCC No.6846).

Embodiment 2, biotransformation method prepare compound T1-T4

(1) biotransformation

Precision weighs milk thistle methanolic extract powder 48.0g and joins 24L cooked meat medium basis, divides to 12 cultivations In Ping (2L/ bottle), 121 DEG C of autoclaving 15min, room temperature is placed standby.

The frozen stock solution 1ml room temperature taking mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846 is melted Change, add 37 DEG C of cultivation 24h in the anaerobic liquid culture medium of 5mL, repeat afterwards to be inoculated according to the ratio of volume ratio 1: 10 to detest Oxygen liquid culture medium expands system and increases bacterium, until obtaining OD₆₀₀The 500ml bacterium solution of=1.826, finally takes 400ml (OD₆₀₀= 1.826) in the cooked meat medium basis containing milk thistle methanolic extract after bacterium solution is inoculated in above-mentioned 2L sterilizing, 37 DEG C of cultivations 48h.12 sample bottles are parallel to be operated according to this.

(2) Herba Silybi mariani flavone lignan component and the separation of demethyl derivative, qualification

1, the separation of Herba Silybi mariani flavone lignan component

Described milk thistle methanolic extract powder (18.0g), through ultrasonic extraction, presses chromatogram and the efficient liquid phase of preparative in ODS Chromatographic separation and purification obtains P1 (24.6mg), P2 (56.4mg), P3 (58.5mg) and P4 (40.1mg).

Described ultrasonic extraction process and condition: precision weighing milk thistle extract 18.0g, add methyl alcohol 360ml, ultrasonic carry Take 60min (500W, 40KHz, 60 DEG C)

ODS presses chromatographic purification process and condition: methanol extract liquid is evaporated to 30mL through 40 DEG C, with anti-phase after filtering Dry method loading after silica gel mixed sample, presses chromatogram methanol-water gradient system wash-out to separate, it is thus achieved that Fr.2-1 (50% methyl alcohol portion in ODS Divide eluent, 300mL, 263.5mg), Fr.2-2 (50% methanol fractions eluent, 300mL, 397.0mg) and Fr.2-3 (55% Meoh eluate, 1200mL, 829.0mg).

The isolated and purified process of above-mentioned preparative high performance liquid chromatography and condition: with methyl alcohol (A)-0.1% formic acid (B) system 45%A isocratic elution purifies main component in Fr.2-1, Fr.2-2 and Fr.2-3.P4 (40.1mg) is obtained from Fr.2-1, from Fr.2-2 obtains P3 (58.5mg), from Fr.2-3, obtains P2 (56.4mg) and P1 (24.6mg).

2, the separation of the demethyl derivative of Herba Silybi mariani flavone lignan component

By above-mentioned steps () through mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846 37 DEG C cultivate the nutrient solution (24L) of the bioconversion of gained after 48h and, through macroporous absorbent resin XAD-2, ODS presses chromatogram and preparation Type high performance liquid chromatography isolated and purified, obtains converting composition T1 (26.3mg), T2 (61.5mg), T3 (57.9mg) and T4 (43.2mg).Following isolated and purified during, the percentage of described liquid and liquid is percentage by volume.

Above-mentioned macroporous absorbent resin XAD-2 purge process and condition: nutrient solution (24L) 8 layers of gauze and cotton filter Supernatant, (filler is XAD-2 macroporous absorbent resin, 1.7kg, granularity 20-60 mesh, flat to be splined on XAD-2 large pore resin absorption column All surface area 330m²/ g, post height × internal diameter is 450 × 90mm), the most successively with deionized water, 10% ethanol, 30% ethanol, Each 6 column volumes (6.0L) of 50% ethanol and 8 column volumes (8.0L) of 60% ethanol elute, and collect 60% ethanol eluate Flow point, obtains Fr.1 (7.48g) after removing solvent.The used aqueous solution that ethanol solution is ethanol.

In above-mentioned ODS, the condition of pressure chromatographic separation and purification process is: mixed by 7.48g Fr.1 and 11.22g reverse phase silica gel ODS Dry method loading after sample, pillar volume is 36 × 460mm, and filler is ODS, particle diameter 20-45 μm, pressure chromatogram methanol-water system in ODS System wash-out separates, and the flow velocity 20ml/min of eluent first elutes with 250ml 40% methanol aqueous solution, collects wash-out and starts to the The eluent of 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent；Again with 45% methanol aqueous solution wash-out, collect wash-out and open Begin to eluent first for 700ml, after removing solvent, obtain the Fr.1-2 of 325.3mg；Regather 700ml end to 1600ml end Eluent, remove after solvent to obtain the Fr.1-3 of 776.3mg；Described % nail alcohol percentage by volume in methanol aqueous solution；

The condition of the isolated and purified process of above-mentioned preparative high performance liquid chromatography is: use preparative high performance liquid chromatography instrument SHIMADZU LC-20A, prepares post Inertsil ODS-3 column, and post height × internal diameter is 250 × 20mm, particle diameter 5 μm, with The mixed liquor of methyl alcohol and 0.1% aqueous formic acid carries out isocratic elution as elution buffer, purifies Fr.1-1, Fr.1-2 respectively And Fr.1-3, in described elution buffer, methyl alcohol volumn concentration is 48%；In described 0.1% aqueous formic acid, formic acid Volumn concentration is 0.1%；The Fr.1-3 of Fr.1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg is used respectively What methyl alcohol was dissolved as 20.0mg/mL prepares mother liquor, mother liquor carries out high performance liquid chromatography respectively isolated and purified；Sample size every time 1.0mL, flow velocity 10.0mL/min；For Fr.1-1 sample, collect the flow point that retention time is 38～41min, after removing solvent Obtain the T4 of 43.2mg；For Fr.1-2 sample, collect the flow point that retention time is 45～53min, obtain after removing solvent 57.9mg T3；For in Fr.1-3 sample, first collect the flow point that retention time is 63～72min, obtain after removing solvent The T2 of 61.5mg, regathers the flow point that retention time is 75～78min, obtains the T1 of 26.3mg after removing solvent.

3, Herba Silybi mariani flavone lignan component and the qualification of demethyl derivative thereof

Utilize nuclear-magnetism (¹H-NMR,¹³C-NMR, HMBC) and circular double dispersion (CD) spectrum compound P1-P4 and T1-T4 is entered Row Structural Identification,¹H-NMR、¹³C-NMR and CD modal data is shown in Table 1-4.The chemical constitution of P1-P4 and T1-T4 and by its chemistry knot Fig. 2 is seen in the bioconversion path of structure reasoning.

Table 1 compound P1, P2 and T1, T2¹HNMR data (J, Hz)

Table 2 compound P3, P4 and T3, T4¹HNMR data (J, Hz)

Table 3. compound¹³CNMR data

Cotton effect [Circular dichroism (the Wavelength at of table 4.T1-T4 and P1-P4 extremum)]

Embodiment 3, compound P1-P4 and T1-T4 are to A β₄₂The inhibitory activity of protein aggregation

Alzheimer disease (also known as senile dementia, Alzheimer ' s disease, AD) is a kind of nervous system disease Sick.In numerous pathogenesis, amyloid beta especially amyloid-beta 42 (A β₄₂) self aggregation cause Neurotoxicity is considered as the primary inducement of Alzheimer disease.

The present embodiment uses Thioflavin T (Thioflavin T, ThT) fluorescence method, to compound T1-T4 and prototype chemical combination Thing P1-P4 has carried out amyloid-beta 42 (A β₄₂) assemble inhibitory activity detection.

(1) experiment condition

1. instrument and equipment

AR1140 type electronic balance (Ao Haosi, the U.S.)；WMK-02 type constant incubator (Huangshi, Hubei Province medicine equipment Factory)；F96Pro sepectrophotofluorometer (Prism Optical Technology Co).

2. material and reagent

People source A β₄₂Synthetic peptide (Shanghai Qiangyao Biotechnology Co., Ltd., purity ＞ 95%)；Thioflavin T, hexafluoro isopropyl Alcohol HFIP (Sigma-Aldrich, USA)；Glycine (this Science and Technology Ltd. of Beijing health times, purity ＞ 99.99%)；Table no food (source, Shanghai leaf biotechnology is limited for sub-catechin and gallate (Epigallocatechin gallate, EGCG) reference substance Company).

Methyl alcohol (chromatographically pure, Tianjin great Mao chemical reagent factory)；Dimethyl sulfoxide (DMSO) DMSO (Amresco, USA)；Hydroxide Sodium, sodium chloride, potassium chloride, sodium dihydrogen phosphate, potassium dihydrogen phosphate (analyzing pure, chemical plant, Beijing)；(Wahaha is pure for pure water Water).

(2) experimental technique

1. the preparation of reagent

PBS solution: precision weighs NaCl 0.801g, KCl 0.020g, Na₂HPO₄0.178g and KH₂PO₄0.027 g, It is settled to 100mL (pH7.4) with pure water after mixing.

NaOH solution: precision weighs 0.800g NaOH, is settled to 100mL with pure water, obtains the NaOH of final concentration 0.2M Solution, is diluted to 10mM with pure water stand-by.

Glycine solution: precision weighs glycine 0.3752g, pure water is settled to 25mL, final concentration 0.2M.

Glycine-NaOH solution: addition 0.2M NaOH solution is to pH 8.5 in the glycine solution of 12.5mL 0.2M, It is settled to 50mL again, the final concentration of 50mM of glycine with pure water.

The preparation of Thioflavin T (ThT) solution: precision weighs ThT 1mg, adds pure water 1mL and dissolves, freeze in-20 DEG C Deposit.

2. sample is to A β₄₂Assemble the screening of inhibitory activity

1)Aβ₄₂The preparation of solution

Take 1 pipe people source A β₄₂Synthetic peptide (intein 1mg), adds 1mL acetonitrile: the solvent of water (1: 1, v/v) dissolves, packing To 20 centrifuge tubes.After drying up with nitrogen, at room temperature it is vacuum dried 2h, A β₄₂Content is 50.0 μ g/ pipes.A after processing β₄₂Frozen in-40 DEG C.

A β after process₄₂, balancing to room temperature and add 10mL HFIP, Room-temperature seal is placed 2 hours, is uncapped and overnight volatilize HFIP.Adding the 10mM NaOH solution of the 40 above-mentioned preparations of μ L, ultrasonic 10min dissolves, and the PBS adding the 160 above-mentioned preparations of μ L is molten Liquid, ultrasonic 1min obtains A β₄₂Solution.

2) preparation of sample solution

Compound T1-T4 EGCG (Epigallo-catechin gallate (EGCG)) and embodiment 2 prepared is the most molten In DMSO, it is prepared as concentration gradient and is respectively the positive control solution of 1.5mM, 0.5mM, 0.1mM and 0.05mM and sample is molten Liquid.

Compound P1-P4 embodiment 2 prepared is dissolved in DMSO respectively, is prepared as concentration gradient and is respectively The sample solution of 2.0mM, 1.5mM, 0.5mM and 0.1mM.

3) sample and A β₄₂Incubation reaction

By the A β of above-mentioned preparation₄₂Solution packing is to centrifuge tube (9 μ L/ pipe), then each sample being separately added into above-mentioned preparation is molten Liquid (1 μ L) mixes, and hatches 24h for 37 DEG C.To add the A β of EGCG positive control solution₄₂Solution is as positive control, to add Enter the A β of 1 μ L DMSO₄₂Solution is as negative control, and each sample is all set up without A β simultaneously₄₂Blank.Above-mentioned In reaction system, the final concentration of A β 42 is about 50 μMs.

4) ThT fluorescence experiments

Take frozen ThT solution, take 8 μ L and add 1mL glycine-NaOH solution, obtain ThT-glycine solution.To above-mentioned Step 3) described in reaction system in each add 40 μ L freshly prepared ThT-glycine solution, fully after mixing, lucifuge is placed 10min, by fluorescence spectrophotometer measurement solution fluorescence intensity.Excitation wavelength 440nm, 15 grades of gains, measure 300-600nm ripple Long transmitting fluorescence spectrum, launches the fluorescent value of light as receiving point using the 482nm of document report.

Each sample compares inhibiting rate I%=[1-with negative control DMSO group after the fluorescent value of subduction blank (F_s-F_B)/(F_D-F_BD)] × 100% (Fs is sample solution fluorescent value, F_BFor corresponding without A β₄₂Blank solution fluorescent value, F_DFor DMSO negative control solution fluorescent value, F_BDFor without A β₄₂The DMSO contrast solution solution fluorescence value of reaction system).

(3) experimental result and discussion

ThT can specifically embed A β₄₂Aggregation in and under 440nm exciting light effect 482nm produce feature The transmitting fluorescence of property, therefore can measure A β quantitatively₄₂Coherent condition and Associated Inhibitory Activity.Adopting said method this section pair T1-T4 and P1-P4 carries out A β₄₂Assemble the screening of inhibitory activity, the results are shown in Table 5 and Fig. 3-Fig. 4.Table 5 result shows, T1-T4 and P2, P3 show inhibitory action, and the DeGrain (IC of P1 and P4₅₀＞ 200 μMs).The IC of T1, T2, T3 and T4₅₀Value is respectively It is 10.46 μMs, 7.49 μMs, 7.95 μMs and 9.78 μMs, shows significant inhibitory activity, with positive control EGCG (IC₅₀=9.01 μM) effect is suitable.But, the IC of P2 and P3₅₀Value is 166.35 μMs and 145.10 μMs respectively, shows certain inhibitory activity. It can be seen that the T1-T4 of same concentrations shows higher suppression work than P1-P4 from the inhibiting rate-concentration curve of Fig. 3-4 Property.

Table 5

N=3 data analysis uses SPSS19.0 statistical analysis software.

Above experimental result confirms that the demethyl converted product T1-T4 of P1-P4 has more preferable neuroprotection, Ah Potential application prospect is had in the treatment of the nerve degenerative diseases such as Alzheimer's disease.

Embodiment 4, compound P1-P4 and the T1-T4 inhibitory activity to cancer cell

The present embodiment uses CellTiter-Glo luminescence method to determine T1-T4 and P1-P4 respectively to 4 kinds of human tumor cells System (human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823 and human colon cancer cell SW- 480) inhibitory activity.

Human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823, human colon cancer cell SW-480 is purchased from Guan Ke Bioisystech Co., Ltd of Sino-U.S..

(1) experiment condition and method

1 experiment condition

Human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823 and human colon cancer cell SW-480 is incubated at containing the hyclone (FBS) that percent by volume is 10% the most successively, 100units/mL penicillin and In 1640 culture mediums of 100units/mL streptomysin, MEM culture medium, 1640 culture mediums and MEM culture medium.Cancer cell is containing body The CO of long-pending percentage composition 5%₂The lower 37 DEG C of cultivations of wet environment.By the detection examination of CellTiter-Glo luminescence method cytoactive Agent box (Promega, USA) measures cell viability.

2 experimental techniques

Cancer cell is inoculated into 384 orifice plates with the initial density in 1000cells/ hole.Cell is separately added into after cultivating 18-24h Compound T1-T4, P1-P4 (final concentration is 20 μMs) are hatched, right using staurosporin (Staurosporine) as the positive According to.After 72h is hatched, add 15 μ L CellTiter-Glo luminescence reagents, hatch 10min.

Use Multimode Microplate Reader Varioskan Flash (Thermo Scientific, USA) measure the relative light units (RLU) of sample, after deducting the RLU of solvent control, calculate inhibiting rate.

(2) experimental result and discussion

Compound T1-T4 and P1-P4 shows different inhibitory activity to 4 kinds of tumour cells, and result is shown in Fig. 5.Fig. 5 result Display, T1-T4 and P1-P4 all shows inhibitory activity to Hela, and T1, T2 and P1-P3 show inhibitory activity, T1, P1 to DU-145 With P2, BGC-823 is shown that inhibitory activity, T2, P1 and P4 show inhibitory activity to SW-480.But converted product T1-T4 is to 4 kinds The inhibitory activity of tumour cell is lower than prototype compound P1-P4 on the whole it was confirmed the demethylation of flavanolignan's constituents The structure-activity relationship of antitumor activity can be weakened.

Claims (9)

1. the compound as shown in formula I or formula II:

2. the preparation method of compound shown in compound shown in compound, formula III described in claim 1 or formula IV,

Comprise the steps 1) and 2):

1) mixture containing compound shown in formula V-formula VIII is added in medium base；Described medium base is applicable Bacterial strain Eubacterium limosum ZL-II CGMCC NO.6846 growth or the nutrient solution of fermentation；

2) step 1 will be inoculated in containing the bacterium solution of Eubacterium limosum ZL-II CGMCC NO.6846) cultivation prepared In base, cultivate 48h and get final product for 37 DEG C.

Method the most according to claim 2, it is characterised in that: described medium base is cooked meat medium basis, its group Become: peptone 30.0g/L, powdered beef 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium dihydrogen phosphate 5.0g/L, solvable Property starch 2.0g/L, solvent is water.

Method the most according to claim 3, it is characterised in that: described containing Eubacterium limosum ZL-II The preparation method of the bacterium solution of CGMCC NO.6846 is: take freezing of Eubacterium limosum ZL-II CGMCC NO.6846 Liquid storage room temperature is melted, and adds 37 DEG C of cultivation 24h, so circulation in anaerobic liquid culture medium and carries out the amplification of bacterial strain.

5. according to the arbitrary described method of claim 2-4, it is characterised in that: described containing compound shown in formula V-formula VIII Mixture is the flavonoids using methyl alcohol to extract from composite family Silybum plant milk thistle Silybum marianum fruit The mixture of compound, the mixture of this flavone compound mainly include silymarin, described silymarin include legalon, Isosilybin, silydianin and Silychristin.

6. according to the arbitrary described method of claim 2-4, it is characterised in that: also include purification procedures；Described separation is pure Change step and include the isolated and purified process of macroporous absorbent resin XAD-2, ODS press chromatographic separation and purification process and preparative high-efficient liquid Phase chromatographic separation and purification process.

7. according to the arbitrary described method of claim 6, it is characterised in that:

The condition of the described isolated and purified process of macroporous absorbent resin XAD-2 is: by step 2 in claim 2) nutrient solution of gained Proceed as follows, the nutrient solution of every 24L, filter to obtain supernatant, be splined on XAD-2 large pore resin absorption column, use the most successively Each 6 column volumes of deionized water, 10% ethanol water, 30% ethanol water, 50% ethanol water and 60% ethanol water 8 column volumes of solution elute, and collect 60% ethanol eluate flow point, remove solvent and obtain 7.48g Fr.1；Described pillar is filled out Material is XAD-2 macroporous absorbent resin, 1.7kg, granularity 20-60 mesh, average surface area 330m²/ g, post height × internal diameter is 450 × 90mm；Described column volume refers to that a column volume is 1L；Described % refers to ethanol percentage by volume in ethanol water；

In described ODS, the condition of pressure chromatographic separation and purification process is: after 7.48g Fr.1 and 11.22g reverse phase silica gel ODS is mixed sample Dry method loading, pillar volume is 36 × 460mm, and filler is ODS, particle diameter 20-45 μm, presses chromatogram methanol-water system to wash in ODS De-separate, the flow velocity 20ml/min of eluent, first elute with 250ml 40% methanol aqueous solution, collect wash-out and start to the The eluent of 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent；Again with 45% methanol aqueous solution wash-out, collect wash-out and open Begin to eluent first for 700ml, after removing solvent, obtain the Fr.1-2 of 325.3mg；Regather 700ml end to 1600ml end Eluent, remove after solvent to obtain the Fr.1-3 of 776.3mg；Described % nail alcohol percentage by volume in methanol aqueous solution；

The condition of the isolated and purified process of described preparative high performance liquid chromatography is: use preparative high performance liquid chromatography instrument SHIMADZU LC-20A, prepares post Inertsil ODS-3column, and post height × internal diameter is 250 × 20mm, and particle diameter 5 μm, with first The mixed liquor of alcohol and 0.1% aqueous formic acid carries out isocratic elution as elution buffer, purify respectively Fr.1-1, Fr.1-2 and Fr.1-3, in described elution buffer, methyl alcohol volumn concentration is 48%；In described 0.1% aqueous formic acid, the body of formic acid Long-pending percentage composition is 0.1%；The Fr.1-3 of Fr.1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg is used first respectively What alcohol was dissolved as 20.0mg/mL prepares mother liquor, mother liquor carries out high performance liquid chromatography respectively isolated and purified；Sample size every time 1.0mL, flow velocity 10.0mL/min；For Fr.1-1 sample, collect the flow point that retention time is 38～41min, after removing solvent Obtain compound shown in the formula IV of 43.2mg；For Fr.1-2 sample, collect the flow point that retention time is 45～53min, remove Compound shown in the formula III of 57.9mg is obtained after solvent；For in Fr.1-3 sample, first collecting retention time is 63～72min Flow point, obtains the compound shown in formula II of 61.5mg, regathers the flow point that retention time is 75～78min after removing solvent, The compound shown in formula I of 26.3mg is obtained after removing solvent.

8. compound shown in compound described in claim 1 or claim 2 Chinese style III or formula IV has following arbitrary in preparation Application in the product of purposes:

1) treatment Alzheimer disease；

2) suppression A β₄₂Protein aggregation；

3) treatment cancer；

4) suppression human cervical carcinoma cell, Human Prostate Cancer Cells, gastric carcinoma cells and/or the activity of human colon cancer cell.

9.Eubacterium limosum ZL-II CGMCC NO.6846 bacterial strain is in preparation arbitrary shownization of following formula I-formula IV Application in compound: