CN104447717A - Demethylation derivatives of silybi fructus flavonolignan and preparation method and application of demethylation derivatives - Google Patents
Demethylation derivatives of silybi fructus flavonolignan and preparation method and application of demethylation derivatives Download PDFInfo
- Publication number
- CN104447717A CN104447717A CN201310428712.9A CN201310428712A CN104447717A CN 104447717 A CN104447717 A CN 104447717A CN 201310428712 A CN201310428712 A CN 201310428712A CN 104447717 A CN104447717 A CN 104447717A
- Authority
- CN
- China
- Prior art keywords
- compound
- formula
- solution
- ods
- derivatives
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D407/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00
- C07D407/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings
- C07D407/04—Heterocyclic compounds containing two or more hetero rings, at least one ring having oxygen atoms as the only ring hetero atoms, not provided for by group C07D405/00 containing two hetero rings directly linked by a ring-member-to-ring-member bond
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/16—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing two or more hetero rings
- C12P17/162—Heterorings having oxygen atoms as the only ring heteroatoms, e.g. Lasalocid
Abstract
The invention provides derivatives of silybi fructus flavonolignan and a preparation method and an application of the derivatives. In the invention, the silybi fructus flavonolignan ingredient is biologically converted by using a human body intestinal tract bacterium E.limosum ZL-II having demethylation activity, and four demethylation derivatives are obtained through separation. The derivatives of silybi fructus flavonolignan provided in the invention, obviously superior to the prototype compound and epigallocatechin gallate, exhibit inhibitory activity to aggregation of beta-amyloid protein 42 and have development prospect of medicaments in preventing and treating neurodegenerative diseases such as Alzheimer's disease and the like. At the same time, the derivatives of silybi fructus flavonolignan provided in the invention also exhibit certain inhibitory activity to cancer cells. According to the invention, the invention lay work foundation for making full use of the silybi fructus resource and improving economic value added of the product.
Description
Technical field
The invention belongs to biomedicine field, be specifically related to derivative of a kind of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes.
Background technology
Silymarin (Silybi Fructus) is the dry mature fruit of feverfew Silymarin Silybum marianum (L.) Gaertn. (Milk thistle), originate in southern Europe, north African, record in the Pharmacopoeia of the People's Republic of China (2010 editions), cool in nature, bitter, returns liver, gallbladder channel, there is effect that is clearing heat and detoxicating, depressed liver-energy dispersing and function of gallbladder promoting, clinically for dampness-heat in the liver and gallbladder, hypochondriac pain, the liver and gall diseases such as jaundice.Silymarin mainly comprises the isomers of 6 flavanolignan's compounds, be respectively Silybin A/B (silybin A/B, two diastereomers), Isosilybin A/B (isosilybin A/B, two diastereomers), Silychristin (silychristin) and Silydianin (silydianin).This flavonolignan compound has been developed to Chinese patent medicine silymarin and (has had another name called silybin, sharp liver Thailand, Silibinin, sharp liver are grand, CAS NO.65666-07-1), clinically for acute hepatitis, chronic hepatitis, early stage liver cirrhosis, the treatment of the diseases such as toxic liver injury; Herba Silybi mariani flavone constituents is also proheparin, flies the important source material working as the hepatic cholagogic medicines such as sheet; In the U.S. and Europe using its effective constituent silibinin as antioxidative food additive.
Summary of the invention
The object of this invention is to provide derivative of a kind of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes.
A kind of Herba Silybi mariani flavone lignanoid provided by the invention is such as formula the compound shown in I or formula II:
Also object of the present invention is to provide the preparation method of compound shown in compound shown in formula I, formula II, formula III or formula IV,
Comprise the steps 1) and 2):
1) mixture containing compound shown in formula V-Shi VIII is added in medium base; Described medium base is the nutrient solution that applicable bacterial strain Eubacterium limosum ZL-II CGMCC NO.6846 grows or ferments;
2) step 1 is inoculated in by containing the bacterium liquid of Eubacterium limosum ZL-II CGMCC NO.6846) in the substratum prepared, cultivate 48h and get final product for 37 DEG C.
In described method, described step 1) in, be 2: 1 containing the mixture of compound shown in formula V-Shi VIII and the mass volume ratio of medium base; The unit of described quality is in g, and the unit of volume is in L.
In described method, described step 1) in, describedly added after in medium base by the mixture containing compound shown in formula V-Shi VIII, also want 121 DEG C of autoclaving 15min, then room temperature is placed for subsequent use.
In described method, described step 2) in, described bacterium liquid and step 1) volume ratio of substratum prepared is 1: 5; The OD of the described bacterium liquid containing Eubacterium limosum ZL-II CGMCC NO.6846
600be 1.826.
In described method, described medium base is specially cooked meat medium basis, and it consists of: peptone 30.0g/L, beef powder 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium primary phosphate 5.0g/L, Zulkovsky starch 2.0g/L, and solvent is water.
The preparation method of the described bacterium liquid containing Eubacterium limosum ZL-II CGMCC NO.6846 is: the frozen storing liquid room temperature of getting Eubacterium limosum ZL-II CGMCC NO.6846 is melted, add in anaerobic liquid substratum after 37 DEG C of cultivation 24h, so the amplification of bacterial strain is carried out in circulation.
In the preparation method of the described bacterium liquid containing Eubacterium limosum ZL-II CGMCC NO.6846, the volume ratio of described frozen storing liquid and anaerobic liquid substratum is 1: 5; Repeat to be inoculated in expansion system in anaerobic liquid substratum according to the ratio of volume ratio 1: 10 afterwards and increase bacterium, until obtain OD
600the 500ml bacterium liquid of=1.826.
Consisting of of described anaerobic liquid substratum: peptone 15.0g/L, yeast 5.0g/L, soy peptone 5.0g/L, beef powder 5.0g/L, glucose 5.0g/L, sodium-chlor 5.0g/L, Zulkovsky starch 3.0g/L, halfcystine 0.5g/L, potassium primary phosphate 2.5g/L, protoheme 0.005g/L, and vitamin K
10.001g/L, solvent is water.
The described mixture containing compound shown in formula V-Shi VIII is specially the mixture adopting the flavonoid compound of methanol extraction from composite family Silybum plant Silymarin Silybum marianum fruit, the mixture of this flavonoid compound mainly comprises silymarin, and described silymarin comprises silibinin, Isosilybin, Silydianin and Silychristin.
The described mixture containing compound shown in formula V-Shi VIII is specially in the mixture of every 18.0g, containing compound 14.726% shown in compound 24.006% and formula VIII shown in compound 7.692% shown in compound 5.006% shown in formula V, formula VI, formula VII, described percentage ratio is mass percentage.
The described mixture containing compound shown in formula V-Shi VIII is specially Silymarin methanol extract powder, and described Silymarin methanol extract powder is purchased from Rui Di bio tech ltd, Xi'an, and commodity are called silymarin, CAS NO.:65666-07-1.
In described method, also comprise purification procedures; Described purification procedures comprises in macroporous adsorbent resin XAD-2 separation and purification process, ODS presses chromatographic separation and purification process and preparative high performance liquid chromatography separation and purification process.
The condition of described macroporous adsorbent resin XAD-2 separation and purification process is: by step 2 in claim 2) nutrient solution of gained proceeds as follows, the nutrient solution of every 24L, filter to obtain supernatant liquor, be splined on XAD-2 macroporous adsorptive resins, wash-out is carried out successively respectively with deionized water, 10% aqueous ethanolic solution, 30% aqueous ethanolic solution, each 6 column volumes of 50% aqueous ethanolic solution and 60% aqueous ethanolic solution, 8 column volumes, collect 60% ethanol eluate flow point, remove solvent and obtain 7.48g Fr.1; Described pillar filler is XAD-2 macroporous adsorbent resin, 1.7kg, granularity 20-60 order, average surface area 330m
2/ g, post is high × and internal diameter is 450 × 90mm; Described column volume specifically refers to that a column volume is 1L; Described % refers to the percent by volume of ethanol in aqueous ethanolic solution;
The condition of chromatographic separation and purification process is pressed to be in described ODS: 7.48g Fr.1 and 11.22g reverse phase silica gel ODS to be mixed dry method loading after sample, pillar volume is 36 × 460mm, filler is ODS, particle diameter 20-45 μm, in ODS, chromatogram methanol-water system elutions is pressed to be separated, the flow velocity 20ml/min of elutriant, first with 250ml 40% methanol aqueous solution wash-out, collection wash-out starts the elutriant to 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent; Again with 45% methanol aqueous solution wash-out, collect wash-out and start, to the first elutriant of 700ml, after removing solvent, to obtain the Fr.1-2 of 325.3mg; Regather the elutriant at 700ml end to 1600ml end, after removing solvent, obtain the Fr.1-3 of 776.3mg; The percent by volume of described % nail alcohol in methanol aqueous solution;
The condition of described preparative high performance liquid chromatography separation and purification process is: adopt preparative high performance liquid chromatography instrument SHIMADZU LC-20A, preparative column Inertsil ODS-3column, post is high × and internal diameter is 250 × 20mm, particle diameter 5 μm, isocratic elution is carried out as elution buffer using the mixed solution of methyl alcohol and 0.1% aqueous formic acid, purifying Fr.1-1, Fr.1-2 and Fr.1-3 respectively, in described elution buffer, methyl alcohol volumn concentration is 48%; In described 0.1% aqueous formic acid, the volumn concentration of formic acid is 0.1%; By the Fr.1-3 of Fr.1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg respectively with dissolve with methanol be 20.0mg/mL prepare mother liquor, mother liquor is prepared respectively the separation and purification of type high performance liquid chromatography; Each sample size 1.0mL, flow velocity 10.0mL/min; For Fr.1-1 sample, collecting retention time is the flow point of 38 ~ 41min, remove obtain 43.2mg after solvent formula IV shown in compound; For Fr.1-2 sample, collecting retention time is the flow point of 45 ~ 53min, remove obtain 57.9mg after solvent formula III shown in compound; For in Fr.1-3 sample, first collecting retention time is the flow point of 63 ~ 72min, obtain the compound shown in formula II of 61.5mg after removing solvent, regather the flow point that retention time is 75 ~ 78min, after removing solvent, obtain the compound shown in formula I of 26.3mg.
The compound that described method directly prepares also belongs to the scope of protection of the invention.
An also object of the present invention is to provide formula I or the compound shown in formula II, or the compound that described method directly prepares is preparing the application had in the product of following arbitrary purposes:
1) alzheimer's disease is treated;
2) A β is suppressed
42protein aggregation;
3) Therapeutic cancer;
4) activity of human cervical carcinoma cell, Human Prostate Cancer Cells, gastric carcinoma cells and/or human colon cancer cell is suppressed.
Described human cervical carcinoma cell is specially human cervical carcinoma cell Hela; Described Human Prostate Cancer Cells is specially Human Prostate Cancer Cells DU-145; Described gastric carcinoma cells is specially human gastric cancer cells BGC-823; Described human colon cancer cell is specially human colon cancer cell SW-480.
Another object of the present invention is to provide the application of Eubacterium limosum ZL-II CGMCC NO.6846 bacterial strain in the arbitrary shown compound of preparation following formula I-Shi IV:
The present invention uses the human enteric bacteria E.limosum ZL-II with demethylating activity to carry out bio-transformation to Herba Silybi mariani flavone lignans, separation obtains four demethyl derivatives, wherein two is new compound, and this compounds is in the medicine prospect being developed to the nerve degenerative diseases such as control alzheimer's disease.
This analog derivative passes through ESI-TOF/MS,
1h NMR,
13c NMR, HMBC and CD spectroscopic analysis, structure is accredited as demethyl Isosilybin B (T1), demethyl Isosilybin A (T2), demethyl Silybin B (T3) and demethyl Silybin A (T4) respectively.T1-T4 is the converted product be separated to first, T1 and T2 is new compound.Such Compounds for Alzheimer amyloid-beta 42 (β-amyloid 42, A β
42) gathering show inhibit activities, and be obviously better than prototype compound and positive control NVP-XAA 723.T1-T4 has inhibit activities to human cervical carcinoma cell Hela simultaneously, T1 and T2 has inhibit activities to Human Prostate Cancer Cells DU-145, and T1 has inhibit activities to human gastric cancer cells BGC-823, and T2 has inhibit activities to human colon cancer cell SW-480; But this compounds is lower than prototype compound on the whole to the inhibit activities of four kinds of tumour cells.
Achievement of the present invention has established working foundation for making full use of Silymarin resource and improving its economic value added; And this analog derivative has potential application prospect in the treatment of the nerve degenerative diseases such as alzheimer's disease.
Accompanying drawing explanation
Fig. 1 is 16S rRNA gene homology analysis and the qualification result of ZL-II bacterial strain.Wherein, namely Strain ZL-II bacterial strain represents ZL-II bacterial strain.
Fig. 2 is chemical structure and the bio-transformation path of P1-P4 and T1-T4, and wherein * represents new compound.
Fig. 3 is that T1-T4 is to A β
42inhibiting rate-the concentration curve assembled.
Fig. 4 is that P1-P4 is to A β
42inhibiting rate-the concentration curve assembled.
Fig. 5 is the inhibit activities statistics figure of compound P1-P4 and T1-T4 to human tumor cells.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
The human enteric bacteria that following embodiment uses is mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846, this bacterial strain has been preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center and (has been called for short CGMCC, deposit number is CGMCC NO.6846, preservation date is on November 20th, 2012, and Classification And Nomenclature is Eubacterium limosum.The address at preservation center is Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, postcode 100101.
Silymarin methanol extract powder used in following embodiment is the mixture adopting the flavonoid compound of methanol extraction from composite family Silybum plant Silymarin Silybum marianum fruit, the mixture of this flavonoid compound mainly comprises silymarin, and described silymarin comprises silibinin, Isosilybin, Silydianin and Silychristin.
Described Silymarin methanol extract powder is purchased from Rui Di bio tech ltd, Xi'an, and commodity are called silymarin, CAS NO.:65666-07-1.
The substratum used in following embodiment consist of:
Cooked meat medium basis (purchased from Beijing Luqiao Technology Co., Ltd., catalog number CM605): peptone 30.0g/L, beef powder 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium primary phosphate 5.0g/L, Zulkovsky starch 2.0g/L, solvent is water, pH 7.8.
Anaerobic liquid substratum is (purchased from Beijing Luqiao Technology Co., Ltd., catalog number CM1513): peptone 15.0g/L, yeast 5.0g/L, soy peptone 5.0g/L, beef powder 5.0g/L, glucose 5.0g/L, sodium-chlor 5.0g/L, Zulkovsky starch 3.0g/L, halfcystine 0.5g/L, potassium primary phosphate 2.5g/L, protoheme 0.005g/L, and vitamin K
10.001g/L, solvent is water, pH 7.3 ± 0.2.
Without carbon source substratum: NaCl (3.0g), NH
4cl (1.0g), PBS (100mL), deionized water 900 (mL), pH 6.4.Be sub-packed in 10mL before using and connect lid plastic centrifuge tube, often pipe 5mL; Surface coverage 1mL whiteruss; 121 DEG C of high pressure steam sterilization 20min; Room temperature is placed for subsequent use.PBS:KH
2pO
4(26.0g), K
2hPO
4(18.5g), deionized water (1L).
In sample involved in following embodiment, the HPLC detection method of Enterodiol (END) is as follows:
Get 200 μ L nutrient solutions, add 400 μ L water-saturated n-butanol extractions, the centrifugal 10min of 4800rpm/min, get supernatant liquor 320 μ L in centrifuge tube, nitrogen dries up, and adds 200 μ L chromatogram methyl alcohol, the centrifugal 3min of 10000rpm/min, gets supernatant liquor 20 μ L and enters HPLC detection.Chromatographic column: Zorbax SB-C
18(4.6mm × 25cm, 5 μm, Agilent company of the U.S.); Guard column Zorbax SB-C
18(4.6mm × 12.5mm, 5 μm, Agilent company of the U.S.); Moving phase: water (A)-acetonitrile (B), gradient elution: 0 ~ 30min (A: B volume ratio is changed to 50: 50 by 100: 0 linear gradients), 30 ~ 40min (A: B volume ratio is changed to 0: 100 by 50: 50 linear gradients); Flow velocity 1.0mL/min; Determined wavelength 280nm; Temperature 25 DEG C.
The percentage composition of the liquid described in following embodiment is percent by volume.
The Isolation and ldentification of embodiment 1, mucus Eubacterium (Eubacterium limosum) ZL-II
One, the separation of mucus Eubacterium (Eubacterium limosum) ZL-II
Gather Freshman or stool in mice sample, increase bacterium through cooked meat medium, obtain intestinal microflora sample, be inoculated into 5mL without in carbon source substratum, add substrate flaxseed meal (particle diameter is 200 μm-1000 μm) 100mg, 37 DEG C of Anaerobic culturel 48h.Get 10 μ L without carbon source substratum bacterium liquid, 10 times of gradient dilutions.Get 10
-6times diluent is coated with dull and stereotyped, 37 DEG C of Anaerobic culturel 24h.Picking single bacterium colony wherein, is inoculated into 5mL without in carbon source substratum, adds substrate flaxseed meal (particle diameter is 200 μm-1000 μm) 100mg, cultivates and carry out HPLC detection after 2 days, and screening can produce single bacterium colony of Enterodiol.The bacterium liquid getting 10 μ L active bacteria adds kitchen meat liquid nutrient medium and increases bacterium, 10
-5times diluent is coated with dull and stereotyped, observes after Anaerobic culturel 48h, the bacterium colony of adularescent and comparatively large (Strain-I), yellow (ZL-II) and transparent and less (ZL-III) three kinds of different colours and form.
Two, the qualification of mucus Eubacterium (Eubacterium limosum) ZL-II
1, bacterial genomes DNA extraction
Get ZL-II bacterial classification 0.5mL and be inoculated into anaerobic liquid substratum 5mL cultivation 20h, get 1mL bacterium liquid and carry out extracting genome DNA.Bacterial genomes is extracted and is used test kit (Tian Gen company, catalog number (Cat.No.) DP209), according to the operation of test kit specification sheets, obtains 120 μ L genome extracting solutions.Detect through agarose gel electrophoresis, confirm the success of bacterial genomes DNA extraction.
2,16S rRNA increases and order-checking
(1) design of primers: adopt entero-bacte universal primer, synthesized by Shanghai Sheng Gong company.
Forward primer: AGAGTTTGATCCTGGCTCAG
Reverse primer: AAGGAGGTGATCCAGCCGCA
(2) PCR reaction system: in table 1.
Table 1.PCR amplification reaction system (50 μ L)
(3) pcr amplification reaction program:
(4) check order: the non-purifying of PCR primer, send Beijing AudioCodes biotech firm to check order.
3,16S rRNA sequential analysis
16S rRNA sequence is as shown in sequence in sequence table 1.Carry out homology analysis to its 16S rRNA gene order, ZL-II bacterial strain is accredited as mucus Eubacterium (Eubacterium limosum) (Fig. 1).This mucus Eubacterium (Eubacterium limosum) ZL-II is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on November 20th, 2012 and (is called for short CGMCC, address is: Datun Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, deposit number is CGMCC No.6846).
Embodiment 2, biotransformation method prepare compound T1-T4
(1) biotransformation
Precision takes Silymarin methanol extract powder 48.0g and joins 24L cooked meat medium basis, divides to (2L/ bottle) in 12 culturing bottles, 121 DEG C of autoclaving 15min, and room temperature is placed for subsequent use.
The frozen storing liquid 1ml room temperature of getting mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846 is melted, add 37 DEG C of cultivation 24h in the anaerobic liquid substratum of 5mL, repeat to be inoculated in expansion system in anaerobic liquid substratum according to the ratio of volume ratio 1: 10 afterwards and increase bacterium, until obtain OD
600the 500ml bacterium liquid of=1.826, finally gets 400ml (OD
600=1.826) bacterium liquid be inoculated in after above-mentioned 2L sterilizing containing in the cooked meat medium basis of Silymarin methanol extract, cultivate 48h for 37 DEG C.12 sample bottles are parallel to be operated according to this.
(2) separation of Herba Silybi mariani flavone lignan component and demethyl derivative thereof, qualification
1, the separation of Herba Silybi mariani flavone lignan component
Described Silymarin methanol extract powder (18.0g) is through supersound extraction, chromatogram and preparative high performance liquid chromatography separation and purification is pressed to obtain P1 (24.6mg) in ODS, P2 (56.4mg), P3 (58.5mg) and P4 (40.1mg).
Described supersound extraction process and condition: precision weighing Herba Silybi mariani extract 18.0g, adds methyl alcohol 360ml, supersound extraction 60min (500W, 40KHz, 60 DEG C)
Chromatographic purification process and condition is pressed: methanol extract liquid is evaporated to 30mL through 40 DEG C after filtering in ODS, dry method loading after sample is mixed with reverse phase silica gel, in ODS, press chromatogram methanol-water gradient system wash-out to be separated, obtain Fr.2-1 (50% methanol fractions elutriant, 300mL, 263.5mg), Fr.2-2 (50% methanol fractions elutriant, 300mL, 397.0mg) and Fr.2-3 (55% meoh eluate, 1200mL, 829.0mg).
Above-mentioned preparative high performance liquid chromatography separation and purification process and condition: with main component in methyl alcohol (A)-0.1% formic acid (B) system 45%A isocratic elution purifying Fr.2-1, Fr.2-2 and Fr.2-3.From Fr.2-1, obtain P4 (40.1mg), from Fr.2-2, obtain P3 (58.5mg), from Fr.2-3, obtain P2 (56.4mg) and P1 (24.6mg).
2, the separation of the demethyl derivative of Herba Silybi mariani flavone lignan component
Above-mentioned steps (one) is cultivated the nutrient solution (24L) of the bio-transformation of gained after 48h through macroporous adsorbent resin XAD-2 through mucus Eubacterium Eubacterium limosum ZL-II CGMCC NO.6846 37 DEG C, the separation and purification of chromatogram and preparative high performance liquid chromatography is pressed in ODS, obtain transforming composition T1 (26.3mg), T2 (61.5mg), T3 (57.9mg) and T4 (43.2mg).In following separation and purification process, described liquid and the percentage ratio of liquid are percent by volume.
Above-mentioned macroporous adsorbent resin XAD-2 purge process and condition: nutrient solution (24L) 8 layers of gauze and cotton filter to obtain supernatant liquor, (filler is XAD-2 macroporous adsorbent resin to be splined on XAD-2 macroporous adsorptive resins, 1.7kg, granularity 20-60 order, average surface area 330m
2/ g, post is high × and internal diameter is 450 × 90mm), each 6 column volumes (6.0L) of deionized water, 10% ethanol, 30% ethanol, 50% ethanol and 60% ethanol, 8 column volumes (8.0L) are used to carry out wash-out respectively successively, collect 60% ethanol eluate flow point, after removing solvent, obtain Fr.1 (7.48g).Ethanolic soln used is the aqueous solution of ethanol.
The condition of chromatographic separation and purification process is pressed to be in above-mentioned ODS: 7.48g Fr.1 and 11.22g reverse phase silica gel ODS to be mixed dry method loading after sample, pillar volume is 36 × 460mm, filler is ODS, particle diameter 20-45 μm, in ODS, chromatogram methanol-water system elutions is pressed to be separated, the flow velocity 20ml/min of elutriant, first with 250ml 40% methanol aqueous solution wash-out, collection wash-out starts the elutriant to 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent; Again with 45% methanol aqueous solution wash-out, collect wash-out and start, to the first elutriant of 700ml, after removing solvent, to obtain the Fr.1-2 of 325.3mg; Regather the elutriant at 700ml end to 1600ml end, after removing solvent, obtain the Fr.1-3 of 776.3mg; The percent by volume of described % nail alcohol in methanol aqueous solution;
The condition of above-mentioned preparative high performance liquid chromatography separation and purification process is: adopt preparative high performance liquid chromatography instrument SHIMADZU LC-20A, preparative column Inertsil ODS-3 column, post is high × and internal diameter is 250 × 20mm, particle diameter 5 μm, isocratic elution is carried out as elution buffer using the mixed solution of methyl alcohol and 0.1% aqueous formic acid, purifying Fr.1-1, Fr.1-2 and Fr.1-3 respectively, in described elution buffer, methyl alcohol volumn concentration is 48%; In described 0.1% aqueous formic acid, the volumn concentration of formic acid is 0.1%; By the Fr.1-3 of Fr.1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg respectively with dissolve with methanol be 20.0mg/mL prepare mother liquor, mother liquor is carried out high performance liquid chromatography separation and purification respectively; Each sample size 1.0mL, flow velocity 10.0mL/min; For Fr.1-1 sample, collecting retention time is the flow point of 38 ~ 41min, obtains the T4 of 43.2mg after removing solvent; For Fr.1-2 sample, collecting retention time is the flow point of 45 ~ 53min, obtains the T3 of 57.9mg after removing solvent; For in Fr.1-3 sample, first collecting retention time is the flow point of 63 ~ 72min, obtains the T2 of 61.5mg, regather the flow point that retention time is 75 ~ 78min after removing solvent, obtains the T1 of 26.3mg after removing solvent.
3, the qualification of Herba Silybi mariani flavone lignan component and demethyl derivative thereof
Utilize nuclear-magnetism (
1h-NMR,
13c-NMR, HMBC) and circular double dispersion (CD) spectrum Structural Identification is carried out to compound P1-P4 and T1-T4,
1h-NMR,
13c-NMR and CD modal data is in Table 1-4.The chemical structure of P1-P4 and T1-T4 and see Fig. 2 by the bio-transformation path of its chemical structure reasoning.
Table 1 compound P1, P2 and T1, T2
1hNMR data (J, Hz)
Table 2 compound P3, P4 and T3, T4
1hNMR data (J, Hz)
Table 3. compound
13cNMR data
The cotton effect [Circular dichroism (Wavelength at extremum)] of table 4.T1-T4 and P1-P4
Embodiment 3, compound P1-P4 and T1-T4 are to A β
42the inhibit activities of protein aggregation
Alzheimer's disease (also known as senile dementia, Alzheimer ' s disease, AD) is a kind of nervous system disorders.In numerous pathogenesis, amyloid beta---especially amyloid-beta 42 (A β
42) the neurotoxicity that causes of self aggregation be considered to the primary inducement of alzheimer's disease.
The present embodiment adopts Thioflavin T (Thioflavin T, ThT) fluorescent method, has carried out amyloid-beta 42 (A β to compound T1-T4 and prototype compound P1-P4
42) inhibit activities assembled detects.
(1) experiment condition
1. plant and instrument
AR1140 type electronic balance (Ao Haosi, the U.S.); WMK-02 type constant incubator (Huangshi, Hubei Province medical apparatus and instruments factory); F96Pro spectrophotofluorometer (Prism Optical Technology Co).
2. material and reagent
People source A β
42synthetic peptide (Shanghai Qiangyao Biotechnology Co., Ltd., purity > 95%); Thioflavin T, hexafluoroisopropanol HFIP (Sigma-Aldrich, USA); Glycine (Beijing health is this Science and Technology Ltd. doubly, purity > 99.99%); NVP-XAA 723 (Epigallocatechin gallate, EGCG) reference substance (Yuan Ye bio tech ltd, Shanghai).
Methyl alcohol (chromatographically pure, Tianjin great Mao chemical reagent factory); Dimethyl sulfoxide (DMSO) DMSO (Amresco, USA); Sodium hydroxide, sodium-chlor, Repone K, SODIUM PHOSPHATE, MONOBASIC, potassium primary phosphate (analytical pure, chemical plant, Beijing); Pure water (Wahaha Pure Water).
(2) experimental technique
1. the preparation of reagent
PBS solution: precision takes NaCl 0.801g, KCl 0.020g, Na
2hPO
40.178g and KH
2pO
40.027 g, is settled to 100mL (pH7.4) with pure water after mixing.
NaOH solution: precision takes 0.800g NaOH, is settled to 100mL with pure water, obtains the NaOH solution of final concentration 0.2M, is diluted to 10mM stand-by with pure water.
Glycine solution: precision takes glycine 0.3752g, and pure water is settled to 25mL, final concentration 0.2M.
Glycine-NaOH solution: add 0.2M NaOH solution to pH 8.5 in the glycine solution of 12.5mL 0.2M, then be settled to 50mL with pure water, glycine final concentration is 50mM.
The preparation of Thioflavin T (ThT) solution: precision takes ThT 1mg, adds pure water 1mL and dissolves, frozen in-20 DEG C.
2. sample is to A β
42assemble the screening of inhibit activities
1) A β
42the preparation of solution
Get 1 pipe people source A β
42synthetic peptide (intein 1mg), adds 1mL acetonitrile: the dissolution with solvents of water (1: 1, v/v), divides and is filled in 20 centrifuge tubes.After drying up with nitrogen, at room temperature vacuum-drying 2h, A β
42content is that 50.0 μ g/ manage.By the A β after process
42frozen in-40 DEG C.
A β after process
42, balance and add 10mL HFIP to room temperature, Room-temperature seal places 2 hours, and uncapping spends the night volatilizes HFIP.Add the 10mM NaOH solution of the above-mentioned preparation of 40 μ L, ultrasonic 10min dissolves, then adds the PBS solution of the above-mentioned preparation of 160 μ L, and ultrasonic 1min obtains A β
42solution.
2) preparation of sample solution
The compound T1-T4 that EGCG (NVP-XAA 723) and embodiment 2 prepare is dissolved in DMSO respectively, is prepared into positive control solution and sample solution that concentration gradient is respectively 1.5mM, 0.5mM, 0.1mM and 0.05mM.
Compound P1-P4 embodiment 2 prepared is dissolved in DMSO respectively, is prepared into the sample solution that concentration gradient is respectively 2.0mM, 1.5mM, 0.5mM and 0.1mM.
3) sample and A β
42incubation reaction
By the A β of above-mentioned preparation
42solution divides and is filled to centrifuge tube (9 μ L/ manage), then each sample solution (1 μ L) adding above-mentioned preparation respectively mixes, and hatches 24h for 37 DEG C.To add the A β of EGCG positive control solution
42solution as positive control, to add the A β of 1 μ L DMSO
42solution is as negative control, and each sample is all set up not containing A β simultaneously
42blank.In above-mentioned reaction system, the final concentration of A β 42 is about 50 μMs.
4) ThT fluorescence experiments
Get frozen ThT solution, get 8 μ L and add 1mL glycine-NaOH solution, obtain ThT-glycine solution.To above-mentioned steps 3) described in reaction system in respectively add the freshly prepared ThT-glycine solution of 40 μ L, fully after mixing, lucifuge places 10min, by fluorescence spectrophotometer measurement solution fluorescence intensity.Excitation wavelength 440nm, 15 grades of gains, measure the emitting fluorescence spectrum of 300-600nm wavelength, using the radiative fluorescent value of the 482nm of bibliographical information as acceptance point.
Each sample compares inhibiting rate I%=[1-(F with negative control DMSO group after the fluorescent value of subduction blank
s-F
b)/(F
d-F
bD)] × 100% (Fs is sample solution fluorescent value, F
bfor corresponding without A β
42blank solution fluorescent value, F
dfor DMSO negative control solution fluorescent value, F
bDfor without A β
42the DMSO contrast solution solution fluorescence value of reaction system).
(3) experimental result and discussion
ThT can embed A β specifically
42aggregation in and under the effect of 440nm exciting light, produce distinctive emitting fluorescence at 482nm, therefore can measure A β quantitatively
42state of aggregation and Associated Inhibitory Activity.Adopting said method this section carries out A β to T1-T4 and P1-P4
42assemble the screening of inhibit activities, the results are shown in Table 5 and Fig. 3-Fig. 4.Table 5 result shows, T1-T4 and P2, P3 show restraining effect, and the DeGrain (IC of P1 and P4
50> 200 μMs).The IC of T1, T2, T3 and T4
50value is respectively 10.46 μMs, 7.49 μMs, 7.95 μMs and 9.78 μMs, shows significant inhibit activities, with positive control EGCG (IC
50=9.01 μMs) effect is suitable.But, the IC of P2 and P3
50value is 166.35 μMs and 145.10 μMs respectively, shows certain inhibit activities.As can be seen from the inhibiting rate-concentration curve of Fig. 3-4, the T1-T4 of same concentrations shows higher inhibit activities than P1-P4.
Table 5
N=3 data analysis uses SPSS19.0 statistical analysis software.
Above experimental result confirms that the demethyl converted product T1-T4 of P1-P4 has better neuroprotective, and the treatment of the nerve degenerative diseases such as alzheimer's disease has potential application prospect.
Embodiment 4, compound P1-P4 and T1-T4 are to the inhibit activities of cancer cells
The present embodiment adopts CellTiter-Glo luminescence method to determine T1-T4 and P1-P4 respectively to 4 kinds of human tumor cell line (human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823 and human colon cancer cell SW-480) inhibit activities.
Human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823, human colon cancer cell SW-480 are all purchased from Guan Ke Bioisystech Co., Ltd of Sino-U.S..
(1) experiment condition and method
1 experiment condition
Human cervical carcinoma cell Hela, Human Prostate Cancer Cells DU-145, human gastric cancer cells BGC-823 and human colon cancer cell SW-480 be incubated at successively respectively containing volume percent be 10% foetal calf serum (FBS), 1640 substratum of 100units/mL penicillin and 100units/mL Streptomycin sulphate, MEM substratum, in 1640 substratum and MEM substratum.Cancer cells is at the CO containing volumn concentration 5%
2the lower 37 DEG C of cultivations of wet environment.Cell viability is measured by CellTiter-Glo luminescence method cytoactive detection kit (Promega, USA).
2 experimental techniques
Cancer cells is inoculated into 384 orifice plates with the initial density in 1000cells/ hole.Add compound T1-T4, P1-P4 (final concentration is 20 μMs) after cell cultures 18-24h respectively to hatch, using Staurosporine (Staurosporine) as positive control.After 72h is hatched, add 15 μ L CellTiter-Glo luminescence reagents, hatch 10min.
Use the relative light units (RLU) of Multimode Microplate Reader Varioskan Flash (Thermo Scientific, USA) working sample, after deducting the RLU of solvent control, calculate inhibiting rate.
(2) experimental result and discussion
Compound T1-T4 and P1-P4 shows different inhibit activities to 4 kinds of tumour cells, the results are shown in Figure 5.Fig. 5 result shows, T1-T4 and P1-P4 all shows inhibit activities to Hela, and T1, T2 and P1-P3 show inhibit activities to DU-145, and T1, P1 and P2 show inhibit activities to BGC-823, and T2, P1 and P4 show inhibit activities to SW-480.But converted product T1-T4 is lower than prototype compound P1-P4 on the whole to the inhibit activities of 4 kinds of tumour cells, confirm that the demethylation of flavanolignan's constituents can weaken the structure activity relationship of anti-tumor activity.
Claims (10)
1. one kind such as formula the compound shown in I or formula II:
2. the preparation method of compound shown in compound shown in compound, formula III described in claim 1 or formula IV,
Comprise the steps 1) and 2):
1) mixture containing compound shown in formula V-Shi VIII is added in medium base; Described medium base is the nutrient solution that applicable bacterial strain Eubacterium limosum ZL-II CGMCC NO.6846 grows or ferments;
2) by being inoculated in containing the bacterium liquid of Eubacterium limosum ZL-II CGMCC NO.6846 in substratum prepared by step 1), cultivating 48h and get final product for 37 DEG C.
3. method according to claim 2, is characterized in that: described medium base is specially cooked meat medium basis, and it consists of: peptone 30.0g/L, beef powder 5.0g/L, yeast 5.0g/L, glucose 3.0g/L, potassium primary phosphate 5.0g/L, Zulkovsky starch 2.0g/L, solvent is water.
4. according to the method in claim 2 or 3, it is characterized in that: the preparation method of the described bacterium liquid containing Eubacterium limosum ZL-II CGMCC NO.6846 is: the frozen storing liquid room temperature of getting Eubacterium limosum ZL-II CGMCC NO.6846 is melted, add 37 DEG C of cultivation 24h in anaerobic liquid substratum, so the amplification of bacterial strain is carried out in circulation.
5. according to the arbitrary described method of claim 2-4, it is characterized in that: the described mixture containing compound shown in formula V-Shi VIII is specially the mixture adopting the flavonoid compound of methanol extraction from composite family Silybum plant Silymarin Silybum marianum fruit, the mixture of this flavonoid compound mainly comprises silymarin, and described silymarin comprises silibinin, Isosilybin, Silydianin and Silychristin.
6., according to the arbitrary described method of claim 2-5, it is characterized in that: also comprise purification procedures; Described purification procedures comprises in macroporous adsorbent resin XAD-2 separation and purification process, ODS presses chromatographic separation and purification process and preparative high performance liquid chromatography separation and purification process.
7., according to the arbitrary described method of claim 2-6, it is characterized in that:
The condition of described macroporous adsorbent resin XAD-2 separation and purification process is: by step 2 in claim 2) nutrient solution of gained proceeds as follows, the nutrient solution of every 24L, filter to obtain supernatant liquor, be splined on XAD-2 macroporous adsorptive resins, wash-out is carried out successively respectively with deionized water, 10% aqueous ethanolic solution, 30% aqueous ethanolic solution, each 6 column volumes of 50% aqueous ethanolic solution and 60% aqueous ethanolic solution, 8 column volumes, collect 60% ethanol eluate flow point, remove solvent and obtain 7.48g Fr.1; Described pillar filler is XAD-2 macroporous adsorbent resin, 1.7kg, granularity 20-60 order, average surface area 330m
2/ g, post is high × and internal diameter is 450 × 90mm; Described column volume specifically refers to that a column volume is 1L; Described % refers to the percent by volume of ethanol in aqueous ethanolic solution;
The condition of chromatographic separation and purification process is pressed to be in described ODS: 7.48g Fr.1 and 11.22g reverse phase silica gel ODS to be mixed dry method loading after sample, pillar volume is 36 × 460mm, filler is ODS, particle diameter 20-45 μm, in ODS, chromatogram methanol-water system elutions is pressed to be separated, the flow velocity 20ml/min of elutriant, first with 250ml40% methanol aqueous solution wash-out, collection wash-out starts the elutriant to 250ml, obtains the Fr.1-1 of 100.3mg after removing solvent; Again with 45% methanol aqueous solution wash-out, collect wash-out and start, to the first elutriant of 700ml, after removing solvent, to obtain the Fr.1-2 of 325.3mg; Regather the elutriant at 700ml end to 1600ml end, after removing solvent, obtain the Fr.1-3 of 776.3mg; The percent by volume of described % nail alcohol in methanol aqueous solution;
The condition of described preparative high performance liquid chromatography separation and purification process is: adopt preparative high performance liquid chromatography instrument SHIMADZU LC-20A, preparative column Inertsil ODS-3column, post is high × and internal diameter is 250 × 20mm, particle diameter 5 μm, isocratic elution is carried out as elution buffer using the mixed solution of methyl alcohol and 0.1% aqueous formic acid, purifying Fr.1-1, Fr.1-2 and Fr.1-3 respectively, in described elution buffer, methyl alcohol volumn concentration is 48%; In described 0.1% aqueous formic acid, the volumn concentration of formic acid is 0.1%; By the Fr.1-3 of Fr. 1-2 and 776.3mg of Fr.1-1,325.3mg of 100.3mg respectively with dissolve with methanol be 20.0mg/mL prepare mother liquor, mother liquor is carried out high performance liquid chromatography separation and purification respectively; Each sample size 1.0mL, flow velocity 10.0mL/min; For Fr.1-1 sample, collecting retention time is the flow point of 38 ~ 41min, remove obtain 43.2mg after solvent formula IV shown in compound; For Fr.1-2 sample, collecting retention time is the flow point of 45 ~ 53min, remove obtain 57.9mg after solvent formula III shown in compound; For in Fr.1-3 sample, first collecting retention time is the flow point of 63 ~ 72min, obtain the compound shown in formula II of 61.5mg after removing solvent, regather the flow point that retention time is 75 ~ 78min, after removing solvent, obtain the compound shown in formula I of 26.3mg.
8. the compound that directly prepares of method described in claim 2-7.
9. compound described in compound described in claim 1 or claim 8 is preparing the application had in the product of following arbitrary purposes:
1) alzheimer's disease is treated;
2) A β is suppressed
42protein aggregation;
3) Therapeutic cancer;
4) activity of human cervical carcinoma cell, Human Prostate Cancer Cells, gastric carcinoma cells and/or human colon cancer cell is suppressed.
Application in compound shown in 10.Eubacterium limosum ZL-II CGMCC NO.6846 bacterial strain is arbitrary at preparation following formula I-Shi IV:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310428712.9A CN104447717B (en) | 2013-09-18 | 2013-09-18 | Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310428712.9A CN104447717B (en) | 2013-09-18 | 2013-09-18 | Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104447717A true CN104447717A (en) | 2015-03-25 |
| CN104447717B CN104447717B (en) | 2016-09-07 |
Family
ID=52894536
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310428712.9A Expired - Fee Related CN104447717B (en) | 2013-09-18 | 2013-09-18 | Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104447717B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106008445A (en) * | 2016-05-12 | 2016-10-12 | 兰州大学 | Flavone and lignin compound and extracting method thereof |
| CN109134486A (en) * | 2018-07-16 | 2019-01-04 | 广西师范大学 | Coumarinolignoids and its preparation method and application |
| CN110183431A (en) * | 2018-06-09 | 2019-08-30 | 江苏新元素医药科技有限公司 | One kind is for liver disease or the compound of prevention |
| US10702571B2 (en) | 2015-12-03 | 2020-07-07 | The University Of North Carolina At Pembroke | Materials for cathepsin B enhancement and methods of use |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101112364A (en) * | 2006-07-28 | 2008-01-30 | 天津天士力制药股份有限公司 | Hepadestal preparations and method for preparing the same |
| CN101548969A (en) * | 2009-03-05 | 2009-10-07 | 温州医学院 | Use of ethyl malonyl silybin derivant in preparing antioxidant medicine |
| CN102727484A (en) * | 2012-06-18 | 2012-10-17 | 中山大学 | Use of silymarin in preparations of drugs for treatment of Alzheimer's disease |
-
2013
- 2013-09-18 CN CN201310428712.9A patent/CN104447717B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101112364A (en) * | 2006-07-28 | 2008-01-30 | 天津天士力制药股份有限公司 | Hepadestal preparations and method for preparing the same |
| CN101548969A (en) * | 2009-03-05 | 2009-10-07 | 温州医学院 | Use of ethyl malonyl silybin derivant in preparing antioxidant medicine |
| CN102727484A (en) * | 2012-06-18 | 2012-10-17 | 中山大学 | Use of silymarin in preparations of drugs for treatment of Alzheimer's disease |
Non-Patent Citations (1)
| Title |
|---|
| CHANDRANI GUNARATNA ET AL.: "Application of liquid chromatography–electrospray ionization-ion trap mass spectrometry to investigate the metabolism of silibinin in human liver microsomes", 《JOURNAL OF CHROMATOGRAPHY B》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10702571B2 (en) | 2015-12-03 | 2020-07-07 | The University Of North Carolina At Pembroke | Materials for cathepsin B enhancement and methods of use |
| CN106008445A (en) * | 2016-05-12 | 2016-10-12 | 兰州大学 | Flavone and lignin compound and extracting method thereof |
| CN110183431A (en) * | 2018-06-09 | 2019-08-30 | 江苏新元素医药科技有限公司 | One kind is for liver disease or the compound of prevention |
| WO2019233440A1 (en) * | 2018-06-09 | 2019-12-12 | 江苏新元素医药科技有限公司 | Compound for treatment or prevention of liver diseases |
| CN110183431B (en) * | 2018-06-09 | 2023-04-11 | 江苏新元素医药科技有限公司 | Compound for treating or preventing liver diseases |
| CN109134486A (en) * | 2018-07-16 | 2019-01-04 | 广西师范大学 | Coumarinolignoids and its preparation method and application |
| CN109134486B (en) * | 2018-07-16 | 2021-03-16 | 广西师范大学 | Coumarin lignan, preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104447717B (en) | 2016-09-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | Extraction of bio-active components from Rhodiola sachalinensis under ultrahigh hydrostatic pressure | |
| Wang et al. | Antiviral ability of Kalanchoe gracilis leaf extract against enterovirus 71 and coxsackievirus A16 | |
| CN101045072A (en) | Extractive of turnipia arguta leaves and its pharmaceutical use | |
| CN104447717B (en) | Demethyl derivative of Herba Silybi mariani flavone lignanoid and preparation method thereof and its purposes | |
| CN101240005A (en) | Method for preparing platycodin D from balloon-flower root and application thereof in anti-cancer medicament | |
| Ni et al. | Identification of adenosine deaminase inhibitors from Tofu wastewater and litchi peel and their synergistic anticancer and antibacterial activities with cordycepin | |
| CN101214253B (en) | Application of anemarrhenasaponin B-II in preparing antidepressant product | |
| CN101824014B (en) | Compounds with anti-tumor activity in chloranthus japonicus and purpose thereof | |
| CN105131008B (en) | Preparation method and application of prenylated flavonoid compound with anti-hepatoma activity | |
| CN104224813B (en) | Pharmaceutical composition as well as preparation method and application thereof | |
| CN104382968B (en) | Extraction method of andrographolide, andrographolide pharmaceutical composition and application | |
| CN108113985B (en) | Application of eupatorium lindleyanum flavone part in preparation of anti-hepatitis B virus medicines | |
| CN102423346A (en) | Tree peony root bark extract, as well as preparation method and application thereof | |
| Lee et al. | Inhibition of HCV replicon cell growth by 2-arylbenzofuran derivatives isolated from Mori Cortex Radicis | |
| CN101396373B (en) | Cinobufacini extract and preparation method thereof | |
| CN103288614B (en) | Monocyclic phloroglucinol compounds with antineoplastic activity and pharmaceutical composition thereof | |
| CN104945460A (en) | Preparation method and applications of roxburic acid | |
| CN101648959B (en) | Coumaronochromones compound and preparation and application thereof | |
| CN103610682A (en) | Preparation method of 3(alpha)-hydroxyl-30-olive-12,20(29)-diene-28-acid and application in preparing anti-tumor drug | |
| CN103288615A (en) | Monocyclic phloroglucinol compounds and pharmaceutical composition and application thereof | |
| CN106117034A (en) | A kind of highly oxidized sesquiterpenoids and preparation method thereof and medical usage | |
| TWI685345B (en) | Artemisia extracts for inhibiting lung cancer cells | |
| Srinivasan et al. | Agrobacterium rhizogenes influences aervine enhancement in hairy root culture of Aerva javanica (Burm. f.) Juss. ex Schult and in silico assessment of human breast cancer activity | |
| CN109575091A (en) | Dimethyl 1,3,5-trihydroxybenzene derivative and its pharmaceutical composition and its application | |
| CN103113384B (en) | Catechin derivative named Fuzhuansu B, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160907 Termination date: 20170918 |