CN104404083B - A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium - Google Patents
A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium Download PDFInfo
- Publication number
- CN104404083B CN104404083B CN201410706339.3A CN201410706339A CN104404083B CN 104404083 B CN104404083 B CN 104404083B CN 201410706339 A CN201410706339 A CN 201410706339A CN 104404083 B CN104404083 B CN 104404083B
- Authority
- CN
- China
- Prior art keywords
- milch goat
- gsirt1
- carrier
- self
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium.Described carrier is the carrier for expression of eukaryon for including milch goat gSirt1 genes, and the nucleotide sequence of described milch goat gSirt1 genes is as shown in SEQ.ID.NO.1.Carrier for expression of eukaryon constructed by the present invention realizes overexpression or overexpression in milch goat stem spermatogonium, being detected by RT PCR, Western blot and cell cycle confirms, gSirt1 genes contribute to the self-renewing of stem spermatogonium, dryness (versatility) to maintain and cell propagation.
Description
Technical field
The invention belongs to stem spermatogonium technical field, be related to a kind of self-renewing for promoting milch goat stem spermatogonium and
The carrier of propagation and its application.
Background technology
Stem spermatogonium (spermatogonial stem cells, SSCs), also referred to as male germ stem cells (male
Germline stem cell, mGSCs), it is to be located at the epilamellar a kind of adult stem cell of convoluted tubule of testis, SSCs passes through certainly
I updates the stabilization for being able to maintain that itself Population, and and can Development And Differentiation forms spermatoblast.Studies have shown that SSC is in testis
Its in microenvironment can be as embryonic stem cell, in vivo and in vitro with all cell types including differentiation generation triploblastica
Potential (Oatley JM, Brinster RL.Regulation of spermatogonial stem cell self-
renewal in mammals.Annu Rev Cell Dev Biol 2008；24:263-86.).Stem spermatogonium can conduct
Study the preferable external model that spermatoblast occurs, meiosis regulating and cell reprogram.
Through tentatively establishing the cultivating system of the embryonic genital cells such as mouse, people and male germ stem cells, and
Its basic biological characteristics (Kubota H, Avarbock MR, Brinster RL.2004.Growth factors are solved
essential for self-renewal and expansion of mouse spermatogonial stem
cells.Proc Natl Acad Sci U S A.101(47):16489-16494；Oatley JM,Avarbock MR,
Telaranta AI,Fearon DT,Brinster RL.2006.Identifying genes important for
spermatogonial stem cell self-renewal and survival.Proc Natl Acad Sci U S
A.103(25):9524-9529), and respectively done from the arrenotoky of adult mice and the isolated versatility of human testicle tissue
Cell (Chikhovskaya JV, Jonker MJ, Meissner A, Breit TM, Repping S, van Pelt
AM.2012.Human testis-derived embryonic stem cell-like cells are not
pluripotent,but possess potential of mesenchymal progenitors.Human
Reproduction.27(1):210-221；Kossack N,Meneses J,Shefi S,Nguyen HN,Chavez S,
Nicholas C,Gromoll J,Turek PJ,Reijo-Pera RA.2009.Isolation and
characterization of pluripotent human spermatogonial stem cell-derived
cells.Stem Cells.27(1):138-149.).Later stage research find CD49f, CD90 (Thy1), C-kit (CD117),
GFR1 etc. can be as the specific marker of male germ stem cells, and has been used for purified mouse and the male germ stem cells of people
(He Z,Jiang J,Hofmann MC,Dym M.2007.Gfra1 silencing in mouse spermatogonial
stem cells results in their differentiation via the inactivation of RET
tyrosine kinase.Biology Of Reproduction.77(4):723-733；He Z,Kokkinaki M,Jiang
J,Dobrinski I,Dym M.2010.Isolation,characterization,and culture of human
spermatogonia.Biology Of Reproduction.82(2):363-372；Niu Z,Goodyear SM,Rao S,
Wu X,Tobias JW,Avarbock MR,Brinster RL.2011.MicroRNA-21regulates the self-
renewal of mouse spermatogonial stem cells.Proceedings of the National
Academy of Sciences.108(31):12740-12745.).In vitro culture is the molecule machine of research mGSCs function controllings
System and cell-signaling pathways provide new method.Although in vitro culture and amplification versatility ES cells routinize increasingly,
But the foundation of adult tissue stem cell (including mGSCs) Vitro Culture Techniques is still more difficult.Although in the past 10 years between,
Many is had reported on the progress of mouse and rat mGSCs in vitro cultures (Kanatsu-Shinohara M, Lee J, et
al..2008.Pluripotency of a single spermatogonial stem cell in mice.Biology Of
Reproduction.78(4):681-687；Oatley JM,Avarbock MR,Telaranta AI,Fearon DT,
Brinster RL.2006.Identifying genes important for spermatogonial stem cell
self-renewal and survival.Proc Natl Acad Sci U S A.103(25):9524-9529).At present, nibble
The mGSCs of tooth class animal can cultivate long time in vitro, and the propagation of cell is also very notable.Have been reported that and think that mGSCs has
There is potential (Kanatsu-Shinohara M, Lee J, the et al..2008.Pluripotency for being converted into multipotent stem cells
of a single spermatogonial stem cell in mice.Biology Of Reproduction.78(4):
681-687).This characteristic causes mGSCs to have big advantage, but its specific heredity, epigenetic and its development are latent
The mechanism such as energy also need to further study.
Histone deacetylase (histone deacetylase, HDAC) family plays in adult stem differentiation
Important function, in the atomization of stem cell HDAC expression lower (McCool KW, Xu X, Singer DB, Murdoch FE,
Fritsch MK.The role of histone acetylation in regulating early gene
expression patterns during early embryonic stem cell differentiation.J Biol
Chem 2007；282:6696-706.).Mammal histone deacetylase family is now divided into 4 groups, wherein the 3rd group just
It is Sirt1-7 deacetylase sirtuins families (Chalkiadaki A, Guarente L.Sirtuins mediate
mammalian metabolic responses to nutrient availability.Nat Rev Endocrinol
2012；8:287-96.).
Sirtuin is deacetylation enzyme highly conserved in a kind of evolution, and its family member has 7:Sirt1~
Sirt7, all it can allow them to combine not with highly conserved NAD+ binding domain and catalytic domain, different N-terminals and C-terminal
Same substrate.
Early stage, Coussens et al. by gene Knockout obtained the double mouse models for striking (Sirt1-/-) of Sirt1,
It was found that the Sirt1 deficient mice life-spans can shorten, the bodily form diminishes, male mice can generate more abnormal sperms.Sirt1 genes
After knockout, stem spermatogonium number positive Oct4 is remarkably decreased in mouse testis, and spermatogenesis is blocked, ripe essence
Son significantly reduces.Further study show that there occurs more DNA damages in the mature sperm of Sirt1 knock out mice.It is right
Found after the gene expression spectrum analysis of Sirt1 knock out mice, 85 gene tables for being related to spermatogenesis and albumen sumoization
Up to there occurs change (Coussens M, Maresh JG, Yanagimachi R, Maeda G, Allsopp R.Sirt1
deficiency attenuates spermatogenesis and germ cell function.PLoS One 2008；3:
e1571.)。
The content of the invention
Present invention solves the problem in that provide a kind of load for the self-renewing and propagation for promoting milch goat stem spermatogonium
Body and its application, by building gSirt1 carrier for expression of eukaryon and being transfected into milch goat stem spermatogonium, promote milch goat essence former
The self-renewal capacity and ability of cell proliferation of stem cell.
The present invention is to be achieved through the following technical solutions：
A kind of carrier for promoting the self-renewing of milch goat stem spermatogonium and breeding, is to include milch goat gSirt1 genes
Carrier for expression of eukaryon.
The nucleotide sequence of described milch goat gSirt1 genes is as shown in SEQ.ID.NO.1.
After the eukaryotic expression vector transfection milch goat stem spermatogonium comprising milch goat gSirt1 genes, make it
GSirt1 gene overexpressions or overexpression.
Antibiotic-screening gene and marker gene are additionally provided with described carrier for expression of eukaryon.
Described carrier for expression of eukaryon is pSirt1-IRES2-AcGFP, and milch goat gSirt1 gene clonings are arrived
In pIRES2-AcGFP expression vectors, wherein gSirt1 is connected with AcGFP by IRES2, forms bicistronic mRNA.
The described self-renewing of promotion milch goat stem spermatogonium and the carrier of propagation is promoting milch goat essence former dry thin
The self-renewing of born of the same parents, maintain application in versatility and propagation.
GSirt1 gene overexpressions or overexpression after described eukaryotic expression vector transfection milch goat stem spermatogonium, and on
Adjust with self-renewing and the expression of versatility related gene, raise it is cell proliferation related because and cyclin expression.
Described self-renewing and versatility related gene include Oct4 and Plzf, and described is cell proliferation related because of bag
Include Myc and PCNA, cyclin CCNA1.
Rush makes it into the S phases of cell cycle after described eukaryotic expression vector transfection milch goat stem spermatogonium, accelerates
Cell is bred.
A kind of method for promoting the self-renewing of milch goat stem spermatogonium and breeding, including following operation：
1) milch goat gSirt1 gene of the clone as shown in SEQ.ID.NO.1, and be cloned into carrier for expression of eukaryon
Build gSirt1 carrier for expression of eukaryon；
2) in DMEM-F12 nutrient solutions, using milch goat stem spermatogonium as cell to be transfected, add and mix in Opti-
GSirt1 carrier for expression of eukaryon in MEM, add transfection reagent TurboFect and transfected, be incubated at room temperature；
3) gSirt1 is overexpressed or the milch goat stem spermatogonium of overexpression, its self-renewal capacity increase, cell propagation
Accelerate.
Compared with prior art, the present invention has technique effect beneficial below：
It is provided by the invention promote milch goat stem spermatogonium self-renewing and propagation carrier, be with spermatogenesis
Related Sirt1 genes build carrier for expression of eukaryon as target gene, are transduceed using milch goat stem spermatogonium as host,
Promote gSirt1 gene overexpressions or overexpression in stem spermatogonium.Carrier for expression of eukaryon constructed by the present invention is realized in milk
Overexpression or overexpression in goat stem spermatogonium, being detected by RT-PCR, Western blot and cell cycle confirms,
GSirt1 genes contribute to the self-renewing of stem spermatogonium, dryness (versatility) to maintain and cell propagation.
The carrier provided by the invention for promoting the self-renewing of milch goat stem spermatogonium and breeding, in transfection milch goat essence
After former stem cell, gSirt1 gene overexpressions (relative expression quantity is up to 125 times compared with the control).
Due to gSirt1 gene overexpressions, it has raised self-renewing and versatility related gene Plzf, its relative expression
Amount has raised 56 times；Also raise cell proliferation related because Myc, PCNA and cyclin CCNA1, wherein Myc are relative
Expression quantity has raised 2.5 times, and PCNA relative expression quantities have raised 5 times, and CCNA1 relative expression quantities have raised 4.5 times, with to photograph
Than expressing notable up-regulation.And these gene upregulations with self-renewing, versatility and cell propagation, gSirt1 genes are disclosed in milk
Goat stem spermatogonium can promote the self-renewing of milch goat stem spermatogonium, maintain versatility and propagation after being overexpressed.And
After the Flow cytometry of cell cycle in milch goat stem spermatogonium it has furthermore been found that overexpress Sirt1, in G1/
The cell conspicuousness of G0 phases is reduced, and the cell conspicuousness in the S phases increases.
The carrier provided by the invention for promoting the self-renewing of milch goat stem spermatogonium and breeding, can promote milch goat
The self-renewal capacity of stem spermatogonium increases, and cell propagation is accelerated, and Sirt1 can also play regulation and dimension in stem spermatogonium
Self-renewing and the effect of versatility are held, can be played in the research that structure immortalizes milch goat stem spermatogonium potential positive
Effect.
Brief description of the drawings
Fig. 1 is the plasmid map of pSirt1-IRES2-AcGFP expression vectors；
Fig. 2 is positive recombinant plasmid pSirt1-IRES2-AcGFP, the gSirt1 gene piece of EcoRI and BamHI double digestions
Section and pIRES2-AcGFP carriers；
Fig. 3 is the milch goat stem spermatogonium of fluorescence microscope pSirt1-IRES2-AcGFP carrier positive expressions
Reporter gene EGFP is expressed and the result figure of Sirt1 antibody stainings；
Fig. 4-1~Fig. 4-3 is quantitative PCR and Western Blot after Sirt1 is overexpressed in milch goat stem spermatogonium
Detection；
Fig. 5 is the cell cycle detection of 48h after Sirt1 is overexpressed in milch goat stem spermatogonium.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, it is described be explanation of the invention and
It is not to limit.
It is provided by the invention promote milch goat stem spermatogonium self-renewing and propagation carrier, be with spermatogenesis
Related Sirt1 genes build carrier for expression of eukaryon as target gene, are transduceed using milch goat stem spermatogonium as host,
Promote gSirt1 gene overexpressions or overexpression in stem spermatogonium.
Specifically, present invention eukaryotic expression of the structure containing gSirt1 and green fluorescent protein (AcGFP) gene first carries
Body pSirt1-IRES2-AcGFP, the carrier is transfected and imports milch goat male germ stem cells, fluorescence microscope mark
Gene A cGFP and Sirt1 antibody staining detects its expression, it was demonstrated that target gene gSirt1 is dry thin in milch goat arrenotoky
Expressed in born of the same parents good.
Involved main agents are as follows：DMEM-F12 culture mediums are purchased from U.S. GIBCO (Invitrogen) company,
EDTA is purchased from Sigma Co., USA, and hyclone is U.S. HYCLONE (HYCLONE) company, and Tissue Culture Plate and culture dish are
Denmark's Nunclon Products, plasmid extraction kit are purchased from Tiangeng company, reverse transcription reagent box and TurboFect transfection examinations
Agent is purchased from Thermo companies, and Sirt1 antibody is purchased from Bioworld companies.Archaeal dna polymerase is purchased from TAKARA companies.
The present invention is described in further detail with experiment below in conjunction with the accompanying drawings.
1st, carrier for expression of eukaryon pSirt1-IRES2-AcGFP structure
A, target gene milch goat gSirt1 clone
According to GeneID:GSirt1mRNA the primers P1 and P2 that XM_005699096.1 is announced, with milk mountain
The cDNA of sheep spermatogonium is that template primer P1, P2 enter performing PCR amplification, and primer sequence is as follows：
Forward direction primer P1:CGAGAATTCGTTGAAAGATGGCGG 24
Backward primer P2:GCGCGGATCCCATTCAATTTGACAT 25
50 μ L PCR reaction systems are：5×Fly Buffer：5 μ L, dNTPs (2.5mmol/L)：2 μ L, P1 (5 μm of ol/
L)：1 μ L, P2 (5 μm of ol/L)：1 μ L, FastPfu polymerase (5U/ μ L)：0.15 μ L, template：1.5 μ L, Mg2+(50mmol/L)：1
μ L, add ultra-pure water to 50 μ L.
PCR reaction conditions are：94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 3min, 30
Individual PCR cycle, 72 DEG C re-extend 7min；
PCR primer is connected overnight for 4 DEG C afterwards with pMD-18T Vector digestions (EcoRI and BamHI double digestions), conversion sense
By state cell E.coli DH5 α, by ammonia benzyl resistance screening, recon is selected, is identified through EcoRI and BamHI double digestions positive
Recombinant plasmid pMD-18T-gSirt1 simultaneously delivers the sequencing of Shanghai biotechnology Services Co., Ltd.GSirt1 gene sequencing knots
Fruit is as shown in SEQ.ID.NO.1, the gSirt1mRNA sequences (GeneID with announcement:XM_005699096.1) homology is
99.7%, therefore, the gene cloned is the gSirt1 genes of milch goat.
B, pSirt1-IRES2-AcGFP carrier structure
The present invention specifically includes target gene with pIRES2-AcGFP carriers and pMD-18T-gSirt1 vector constructions
GSirt1 carrier for expression of eukaryon pSirt1-IRES2-AcGFP (its plasmid map is as shown in Figure 1).
The structure of pSirt1-IRES2-AcGFP carriers is as follows：
With EcoRI and BamHI difference double digestions, the gSirt1 and pIRES2- cloned from pMD-18T-gSirt1 carriers
AcGFP (is commercially available), glue reclaim fragment, with the 4 DEG C of connections of T4DNA ligases overnight, and transformed competence colibacillus cell E.coli
DH5 α, positive recombinant plasmid is identified through EcoRI and BamHI double digestions.Testing result is as shown in Fig. 2 wherein, swimming lane 1 is EcoRI
Positive recombinant plasmid is identified with BamHI double digestions, 5360bp and 2121bp two band can be seen, illustrate that gSirt1 passes through
EcoRI and BamHI restriction enzyme sites are cloned on carrier pIRES2-AcGFP；Swimming lane 2 is EcoRI and BamHI double digestions
GSirt1 fragments, 2121bp；Swimming lane 3 is the pIRES2-AcGFP carriers of EcoRI and BamHI double digestions, it can be seen that a treaty
For 5360bp band；Swimming lane M is Marker, size represent respectively 500bp, 750bp, 2500bp, 1000bp, 2000bp,
3000bp, 500bp and 15000bp；The recombinant plasmid of acquisition is named as pSirt1-IRES2-AcGFP.
PSirt1-IRES2-AcGFP carriers include neomycin resistance screening-gene neorWith marker gene AcGFP；Mark
Gene A cGFP high in mammalian cell can be expressed and produce fluorescence；The present invention passes through multiple cloning sites EcoRI and BamHI
Multiple cloning sites target gene gSirt1 being inserted on pIRES2-AcGFP, make gSirt1 genes table in the cell of transfection
Reach.
Because plasmid is bred in Escherichia coli, easily bacterial endotoxin is taken to whole production with common plasmid extraction method
In thing, the presence of bacterial endotoxin can influence plasmid transfection efficiency and cell growth, thus this research used go it is endotoxic
Plasmid extraction kit, to reduce negative effect of the endotoxin to result of the test.Go endotoxic plasmid pure with Tiangeng company
Nucleic acid-protein analyzer is used to determine the concentration and purity of plasmid after changing kit extraction plasmid, after measured, the concentration of plasmid is
389ng/ μ l, OD260/280 1.89, illustrates that plasmid is purer, available for transfecting.
2nd, pSirt1-IRES2-AcGFP eukaryotic expression vector transfections milch goat male germ stem cells
C, the culture of milch goat male germ stem cells
A pipe milch goat male germ stem cells are taken to add 0.8ml DMEM-F12 cells to train in 37 DEG C of defrostings from liquid nitrogen
Nutrient solution centrifuges, and abandons supernatant, adds cell culture fluid to be resuspended, takes 4ml cell suspending liquids to be inoculated in diameter 6cm culture dish, be placed in
CO2Cultivated in incubator under the conditions of 37 DEG C.
When milch goat male germ stem cells reach 80% and converged, nutrient solution is abandoned in suction, with without Ca2+、Mg2+PBS rinse
Cell, add pancreatin and EDTA mixture slaking liquid, vitellophag.Cell is observed under inverted microscope, treats that most cells are returned
Contract, be rounded, space between cells expand when, with containing 10% hyclone DMEM-F12 cell culture fluids terminate digestion, use pipettor
After piping and druming, it is collected by centrifugation, suspends, be inoculated in 12 orifice plates in 1: 3 ratio, be put into CO2Cultivated in incubator.Milch goat male is raw
Stem cell is grown, is cultivated and is reached 80% to cell and converge for transfecting.
D, pSirt1-IRES2-AcGFP eukaryotic expression vector transfections milch goat male germ stem cells
The present invention is specifically transfected using transfection reagent TurboFect, by pSirt1-IRES2-AcGFP eukaryotic expressions
Vector introduction milch goat male germ stem cells, it is specially：
The day before transfection, by milch goat male germ stem cells with 1 × 105It is inoculated in 12 orifice plates, overnight incubation makes carefully
Born of the same parents reach 70-80% and converged.For every hole cell, the fresh DMEM-F12 nutrient solutions of preheating are changed before transfection, then by 1 μ g
PSirt1-IRES2-AcGFP carrier for expression of eukaryon is added in 100 μ l Opti-MEM and mixed, and then adds 2 μ l's
TurboFect piping and druming mixes, and after being incubated at room temperature 20min, slowly adds it in cell culture fluid；Renew after 6h fresh
DMEM-F12 nutrient solutions；Fluorescence microscope after 48h.
Transfection reagent TurboFect is a kind of unique cationic polymer aqueous solution, and it coordinates with potent buffer solution and made
With can efficiently by albumen, antibody and polypeptide import cytoplasm in.Whether no matter serum is contained in culture medium, the reagent can turn
Contaminate albumen.Carry out gene transfer compared with other methods with TurboFect, it is easy to operate, reproducible, not by DNA sizes limit
System, small toxicity, transduction efficiency are high.
3rd, the identification of pSirt1-IRES2-AcGFP carrier for expression of eukaryon positive expression cell
The positive milch goat male germ stem cells of pSirt1-IRES2-AcGFP carrier for expression of eukaryon have been transfected after 48h,
Carry out immunofluorescent staining：1) cell is fixed 15min by with 4%PFA room temperatures, and PBS is washed 2 times, each 5min；2) is used
0.1%Triton-X 100 room temperature rupture of membranes 10min, PBS are washed 2 times, each 5min；3) .1%BSA is incubated at room temperature 45min；4) inhale
BSA is removed, the appropriate primary antibody diluted in proportion, 4 DEG C of overnight incubations are added dropwise；5) sucks primary antibody, and PBS is washed 3 times, each 5min；6).
The appropriate secondary antibody diluted in proportion is added dropwise, is incubated at room temperature 1h, PBS is washed 3 times, each 5min；7), which is added, contains Hoechst 33342
Cell dye karyolymph, be incubated at room temperature 3min, PBS washes 3 times, each 5min；8) appropriate PBS is added dropwise in, and fluorescence microscope simultaneously shines
Phase.
As shown in figure 3, wherein, AcGFP is the AcGFP expressions of results observed under green fluorescence, SIRT1 is testing result
The SIRT1 expressions of results observed under red fluorescence, AcGFP/SIRT1 are SIRT1 antibody stainings (red) and AcGFP (green)
Fluorecyte overlaps, and Hoechst 33342 is control, the results showed that AcGFP and SIRT1 is expressed simultaneously, target gene
GSirt1 successful expressions in milch goat male germ stem cells.
4th, Sirt1 promotes self-renewing and the propagation of milch goat stem spermatogonium
RT-PCR, Western blot detection are carried out respectively to the stem spermatogonium of gSirt1 successful expressions.As Fig. 4-1 institute
The Sirt1 and PLZF being shown as in quantitative PCR detection overexpression Sirt1 cells, wherein gSirt1 genes relative expression quantity is up to 125
Times, Plzf relative expression quantity has raised 56 times；Fig. 4-2 show quantitative PCR detection overexpression Sirt1 cells in Myc,
PCNA, CCNA1, CCND1, wherein Myc relative expression quantities have raised 2.5 times, and PCNA relative expression quantities have raised 5 times, CCNA1 phases
4.5 times have been raised to expression quantity；Fig. 4-3 is SIRT1, PLZF, OCT4 in Western Blot detection overexpression Sirt1 cells
And MYC, it is apparent that Sirt1, PLZF expression significantly up-regulation, and OCT4 and MYC expression is also substantially raised.
In stem spermatogonium, Plzf and Oct4 are very important self-renewing and versatility related gene.And in milk
After overexpressing Sirt1 in goat stem spermatogonium, detection finds self-renewing and versatility phase in milch goat stem spermatogonium
The equal up-regulated expressions of correlation gene Oct4 and Plzf (shown in Fig. 4-1, Fig. 4-3), it is cell proliferation related because of Myc, PCNA and cell week
Phase PROTEIN C CNA1 also up-regulated expression (shown in Fig. 4-2, Fig. 4-3).And the up-regulated expression of these related genes obviously can promote milk mountain
The self-renewing of sheep stem spermatogonium and the maintenance of polymorphism.
After the Flow cytometry of cell cycle in milch goat stem spermatogonium it has furthermore been found that overexpress Sirt1,
Cell conspicuousness in the G1/G0 phases is reduced, and the cell conspicuousness in the S phases increases.As shown in figure 5, wherein A is milch goat
Cell cycle after stem spermatogonium transfection pSirt1-IRES2-AcGFP；B is that milch goat stem spermatogonium transfects pIRES2-
Cell cycle after AcGFP；C is the cell cycle of milch goat stem spermatogonium；D is the data statistics in A, B and C figure, as a result
Display G1/G0 phases, S phase cell numbers have significant difference, and increasing for S phase cell quantities also illustrates that cell propagation is accelerated.
These results suggest that in milch goat stem spermatogonium overexpress Sirt1 after, milch goat stem spermatogonium self
Updating ability increases, and cell propagation is accelerated, and Sirt1 can also play regulation in milch goat stem spermatogonium and maintain self-renewing
With the effect of versatility, potential positive role can be played in the research that structure immortalizes milch goat stem spermatogonium.
Claims (7)
1. a kind of carrier for promoting the self-renewing of milch goat stem spermatogonium and breeding, it is characterised in that be to include milch goat
The carrier for expression of eukaryon of gSirt1 genes；The nucleotide sequence of described milch goat gSirt1 genes is as shown in SEQ.ID.NO.1；
Described carrier for expression of eukaryon is pSirt1-IRES2-AcGFP, by milch goat gSirt1 gene clonings to pIRES2-
In AcGFP expression vectors, wherein gSirt1 is connected with AcGFP by IRES2, forms bicistronic mRNA；
After the eukaryotic expression vector transfection milch goat stem spermatogonium, make its gSirt1 gene overexpression or overexpression.
2. promote the self-renewing of milch goat stem spermatogonium and the carrier of propagation as claimed in claim 1, it is characterised in that
Antibiotic-screening gene and marker gene are additionally provided with described carrier for expression of eukaryon.
3. the self-renewing of promotion milch goat stem spermatogonium and the carrier of propagation described in claim 1 are promoting ex vivo environment
The self-renewing of the lower milch goat stem spermatogonium of culture, maintain versatility and breed in application.
4. application as claimed in claim 3, it is characterised in that described eukaryotic expression vector transfection milch goat stem spermatogonium
GSirt1 gene overexpressions or overexpression afterwards, and raise and increase with self-renewing and the expression of versatility related gene, up-regulation cell
Grow the expression of related gene and cyclin.
5. application as claimed in claim 4, it is characterised in that described self-renewing and versatility related gene include Oct4
And Plzf, described is cell proliferation related because including Myc and PCNA, cyclin CCNA1.
6. application as claimed in claim 4, it is characterised in that described eukaryotic expression vector transfection milch goat stem spermatogonium
Rush makes it into the S phases of cell cycle afterwards, accelerates cell propagation.
7. a kind of method for promoting the self-renewing of the milch goat stem spermatogonium under ex vivo environment culture and breeding, its feature exist
In, including following operation：
1) milch goat gSirt1 gene of the clone as shown in SEQ.ID.NO.1, and be cloned into carrier for expression of eukaryon and build
GSirt1 carrier for expression of eukaryon；
2) in DMEM-F12 nutrient solutions, using milch goat stem spermatogonium as cell to be transfected, add and mix in Opti-MEM
In gSirt1 carrier for expression of eukaryon, add transfection reagent TurboFect and transfected, be incubated at room temperature；
3) gSirt1 is overexpressed or the milch goat stem spermatogonium of overexpression, its self-renewal capacity increase, and cell propagation is accelerated.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410706339.3A CN104404083B (en) | 2014-11-27 | 2014-11-27 | A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410706339.3A CN104404083B (en) | 2014-11-27 | 2014-11-27 | A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104404083A CN104404083A (en) | 2015-03-11 |
| CN104404083B true CN104404083B (en) | 2018-02-16 |
Family
ID=52641748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410706339.3A Expired - Fee Related CN104404083B (en) | 2014-11-27 | 2014-11-27 | A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104404083B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754724A (en) * | 2016-12-09 | 2017-05-31 | 西北农林科技大学 | A kind of ox stem spermatogonium system of immortalization and its construction method |
-
2014
- 2014-11-27 CN CN201410706339.3A patent/CN104404083B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| Sirt1 deficiency attenuates spermatogenesis and germ cell function;Coussens，et al;《PLoS One》;20080229;第3卷(第2期);全文 * |
| Transcriptional Analysis of Histone Deacetylase Family Members Reveal Similarities Between Differentiating and Aging Spermatogonial Stem Cells;Kofman,et al;《Stem Cell Rev and Rep》;20130228;第9卷(第1期);摘要、讨论部分 * |
| XM_005699096;NCBI;《NCBI》;20130930;第1页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104404083A (en) | 2015-03-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108949824A (en) | The method that method based on HMEJ mediates Ipr1 fixed point insertion to obtain transgenic cow fetal fibroblast | |
| Zhang et al. | CRISPR/Cas9 mediated chicken Stra8 gene knockout and inhibition of male germ cell differentiation | |
| Naito et al. | Long term in vitro culture of chicken primordial germ cells isolated from embryonic blood and incorporation into germline of recipient embryo | |
| Gao et al. | The REGγ-proteasome regulates spermatogenesis partially by P53-PLZF signaling | |
| CN108949988A (en) | A kind of application of long-chain non-coding RNA SNHG6 in breast cancer diagnosis or treatment | |
| CN103642828B (en) | A kind of gene knock-in recombinant vectors and preparation method thereof and mouse model preparation method | |
| Huang et al. | Establishment of a porcine Oct-4 promoter-driven EGFP reporter system for monitoring pluripotency of porcine stem cells | |
| Shen et al. | MyoG-enhanced circGPD2 regulates chicken skeletal muscle development by targeting miR-203a | |
| Nagy et al. | Murine embryonic stem cells | |
| CN105039402B (en) | A kind of method for improveing pig muscle quality | |
| CN104404083B (en) | A kind of self-renewing and the carrier bred and its application for promoting milch goat stem spermatogonium | |
| CN105063023B (en) | A kind of Zinc finger nuclease-mediated pig MSTN gene mutations sequence and its application | |
| Lai et al. | LKB1 controls the pluripotent state of human embryonic stem cells | |
| Hughes et al. | Gene targeting in embryonic stem cells | |
| CN107988257B (en) | Carrier, cell and the method for goat cloning efficiency are improved based on the horizontal modification of donorcells DNA methylation | |
| CN103421781A (en) | Promoters of pig muscle tissue specific expression gene myf6 and use thereof | |
| CN109536495A (en) | Inhibit siRNA and its application of RTL1 gene expression | |
| Yue et al. | Mir-34c affects the proliferation and pluripotency of porcine induced pluripotent stem cell (piPSC)-like cells by targeting c-Myc | |
| CN110042123B (en) | Method for improving bovine somatic cell cloning efficiency through induction expression of zfp57 | |
| CN104630272A (en) | Demethylation-based vector for promoting self-renewal and proliferation of germline stem cells and application thereof | |
| Zhang et al. | Nanos2 promotes differentiation of chicken (Gallus gallus) embryonic stem cells to male germ cells | |
| Guo et al. | Characterization of the proximal region of the goat NANOG promoter that is used for monitoring cell reprogramming and early embryo development | |
| CN111575384A (en) | Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor | |
| Salabi et al. | Cell culture, sex determination and single cell cloning of ovine transgenic satellite cells in vitro | |
| CN106337049A (en) | Breeding method of anti-influenza transgenic animals expressing double genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180216 Termination date: 20181127 |