CN104404083A - Vector capable of promoting self renewal and proliferation of spermatogonial stem cells of dairy goat and application of vector - Google Patents

Abstract

The invention discloses a vector capable of promoting the self renewal and proliferation of spermatogonial stem cells of a dairy goat and application of the vector. The vector is an eukaryotic expression vector containing a dairy goat gSirt1 gene, wherein the nucleotide sequence of the dairy goat gSirt1 gene is shown as SEQ.ID.NO.1. According to the vector and the application of the vector, over-expression or super expression in the spermatogonial stem cells is realized by the constructed eukaryotic expression vector, and RT-PCR (Reverse Transcription-Polymerase Chain Reaction), Western blot and cell cycle examination show that the gSirt1 gene is helpful for the self renewal, stemness (pluripotency) maintenance and cell proliferation of the spermatogonial stem cells.

Description

A kind ofly promote the self of milk goat stem spermatogonium and the carrier of propagation and application thereof

Technical field

The invention belongs to stem spermatogonium technical field, relate to and a kind ofly promote the self of milk goat stem spermatogonium and the carrier of propagation and application thereof.

Background technology

Stem spermatogonium (spermatogonial stem cells, SSCs), also known as making male germ stem cells (male germline stem cell, mGSCs), be positioned at the epilamellar class adult stem cell of convoluted tubule of testis, SSCs can maintain the stable of self Population by self, can form spermatid by Development And Differentiation again.Research display, it can as embryonic stem cell in testis microenvironment for SSC, there is differentiation in vivo and in vitro and produce potential (Oatley JM, the BrinsterRL.Regulation of spermatogonial stem cell self-renewal in mammals.Annu RevCell Dev Biol 2008 of triploblastica in interior all cells type; 24:263-86.).Stem spermatogonium can occur as research spermatid, an ideal body external model of meiosis regulating and cell reprogrammed.

Now tentatively establish the culture system of the embryonic genital cell such as mouse, people and male germ stem cells, and understood its basic biological characteristics (Kubota H, Avarbock MR, Brinster RL.2004.Growth factors essential for self-renewal and expansion of mouse spermatogonialstem cells.Proc Natl Acad Sci U S A.101 (47): 16489-16494, Oatley JM, Avarbock MR, Telaranta AI, Fearon DT, Brinster RL.2006.Identifying genesimportant for spermatogonial stem cell self-renewal and survival.Proc Natl AcadSci U S A.103 (25): 9524-9529), and male germ stem cells (the Chikhovskaya JV of versatility is obtained respectively from adult mice and human testicle separate tissue, Jonker MJ, Meissner A, Breit TM, Repping S, van Pelt AM.2012.Human testis-derived embryonic stem cell-likecells are not pluripotent, but possess potential of mesenchymal progenitors.Human Reproduction.27 (1): 210-221, Kossack N, Meneses J, Shefi S, NguyenHN, Chavez S, Nicholas C, Gromoll J, Turek PJ, Reijo-Pera RA.2009.Isolationand characterization of pluripotent human spermatogonial stem cell-derived cells.Stem Cells.27 (1): 138-149.).The specific marker that later stage research finds CD49f, CD90 (Thy1), C-kit (CD117), GFR1 etc. can be used as male germ stem cells, and for male germ stem cells (the He Z of purified mouse and people, Jiang J, Hofmann MC, Dym M.2007.Gfra1silencing in mouse spermatogonial stem cells results in their differentiation via theinactivation of RET tyrosine kinase.Biology Of Reproduction.77 (4): 723-733; He Z, Kokkinaki M, Jiang J, Dobrinski I, Dym M.2010.Isolation, characterization, and culture of human spermatogonia.Biology Of Reproduction.82 (2): 363-372; Niu Z, Goodyear SM, Rao S, Wu X, Tobias JW, Avarbock MR, Brinster RL.2011.MicroRNA-21regulates the self-renewal of mousespermatogonial stem cells.Proceedings of the National Academy of Sciences.108 (31): 12740-12745.).Vitro culture is that the molecular mechanism of research mGSCs function controlling and cell-signaling pathways provide new method.Although vitro culture and amplification versatility ES cell routinize increasingly, the foundation of adult tissue stem cell (comprising mGSCs) Vitro Culture Techniques is still more difficult.Although between in the past 10 years, report many progress about Mouse and rat mGSCs vitro culture (Kanatsu-Shinohara M, Lee J, et al..2008.Pluripotency of a singlespermatogonial stem cell in mice.Biology Of Reproduction.78 (4): 681-687; Oatley JM, Avarbock MR, Telaranta AI, Fearon DT, Brinster RL.2006.Identifying genes important for spermatogonial stem cell self-renewal andsurvival.Proc Natl Acad Sci U S A.103 (25): 9524-9529).At present, the mGSCs of rodent can cultivate long time in vitro, and the propagation of cell is also very remarkable.Report is had to think that mGSCs has potential (the Kanatsu-Shinohara M being converted into multipotent stem cells, Lee J, et al..2008.Pluripotency of a single spermatogonial stem cell in mice.Biology OfReproduction.78 (4): 681-687).This characteristic makes mGSCs have huge advantage, but the mechanism such as its concrete heredity, epigenetic and potentiality of development thereof also need further research.

Histone deacetylase (histone deacetylase, HDAC) family plays a significant role in adult stem differentiation, HDAC down-regulated expression (McCool KW in the atomization of stem cell, Xu X, Singer DB, Murdoch FE, Fritsch MK.The role of histone acetylation inregulating early gene expression patterns during early embryonic stem celldifferentiation.J Biol Chem 2007; 282:6696-706.).Mammals histone deacetylase family is now divided into 4 groups, wherein the 3rd group is exactly deacetylase sirtuins family (Chalkiadaki A, the Guarente L.Sirtuins mediate mammalian metabolic responses tonutrient availability.Nat Rev Endocrinol 2012 of Sirt1-7; 8:287-96.).

Sirtuin is a kind of deacetylation enzyme of upper high conservative of evolving, and its family member has 7: Sirt1 ~ Sirt7, all has NAD+ binding domain and the catalytic domain of high conservative, and different N ends and C end can enable them in conjunction with different substrates.

Early stage, the people such as Coussens obtained by gene Knockout the mouse model that Sirt1 twoly to strike (Sirt1-/-), found that the Sirt1 deficient mice life-span can shorten, the bodily form diminishes, male mice can generate more abnormal sperm.After Sirt1 gene knockout, in mouse testis, the stem spermatogonium number of the Oct4 positive significantly declines, and spermatogenesis is blocked, and mature sperm obviously reduces.Further research finds, there occurs more DNA damage in the mature sperm of Sirt1 knock out mice.Find after the gene expression spectrum analysis of Sirt1 knock out mice, 85 genetic expressions relating to spermatogenesis and albumen sumoization there occurs change (Coussens M, Maresh JG, Yanagimachi R, Maeda G, Allsopp R.Sirt1deficiency attenuates spermatogenesis and germ cell function.PLoS One 2008; 3:e1571.).

Summary of the invention

The problem that the present invention solves is to provide a kind of and promotes the self of milk goat stem spermatogonium and the carrier of propagation and application thereof, by building gSirt1 carrier for expression of eukaryon and being transfected into milk goat stem spermatogonium, promote self-renewal capacity and the ability of cell proliferation of milk goat stem spermatogonium.

The present invention is achieved through the following technical solutions:

Promoting the self of milk goat stem spermatogonium and a carrier for propagation, is the carrier for expression of eukaryon comprising milk goat gSirt1 gene.

The nucleotide sequence of described milk goat gSirt1 gene is as shown in SEQ.ID.NO.1.

Described comprise the eukaryotic expression vector transfection milk goat stem spermatogonium of milk goat gSirt1 gene after, make its gSirt1 gene overexpression or overexpression.

Described carrier for expression of eukaryon is also provided with antibiotic-screening gene and marker gene.

Described carrier for expression of eukaryon is pSirt1-IRES2-AcGFP, and by milk goat gSirt1 gene clone in pIRES2-AcGFP expression vector, wherein gSirt1 with AcGFP is connected by IRES2, forms bicistronic mRNA.

The described self of promotion milk goat stem spermatogonium and the carrier of propagation are promoting the self of milk goat stem spermatogonium, are maintaining versatility and the application in breeding.

GSirt1 gene overexpression or overexpression after described eukaryotic expression vector transfection milk goat stem spermatogonium, and raise the expression with self and versatility genes involved, raise cell proliferation related because of and the expression of cyclin.

Described self and versatility genes involved comprise Oct4 and Plzf, and described is cell proliferation related because comprising Myc and PCNA, and cyclin is CCNA1.

Impel it to enter the S phase of cell cycle after described eukaryotic expression vector transfection milk goat stem spermatogonium, accelerate cell proliferation.

Promote the self of milk goat stem spermatogonium and a method for propagation, comprise following operation:

1) the milk goat gSirt1 gene of clone as shown in SEQ.ID.NO.1, and be cloned in carrier for expression of eukaryon and build gSirt1 carrier for expression of eukaryon;

2) in DMEM-F12 nutrient solution, be cell to be transfected with milk goat stem spermatogonium, add the gSirt1 carrier for expression of eukaryon of mixing in Opti-MEM, then add transfection reagent TurboFect and carry out transfection, incubated at room;

3) the milk goat stem spermatogonium of gSirt1 process LAN or overexpression, its self-renewal capacity increases, and cell proliferation is accelerated.

Compared with prior art, the present invention has following useful technique effect:

The self of promotion milk goat stem spermatogonium provided by the invention and the carrier of propagation, build carrier for expression of eukaryon using the Sirt1 gene relevant to spermatogenesis as goal gene, with milk goat stem spermatogonium for host transduces, impel gSirt1 gene overexpression or overexpression in stem spermatogonium.Carrier for expression of eukaryon constructed by the present invention achieves process LAN in milk goat stem spermatogonium or overexpression, detect through RT-PCR, Western blot and cell cycle and confirm, gSirt1 gene contributes to the self of stem spermatogonium, dryness (versatility) maintains and cell proliferation.

The self of promotion milk goat stem spermatogonium provided by the invention and the carrier of propagation, after transfection milk goat stem spermatogonium, gSirt1 gene overexpression (relative expression quantity reaches 125 times compared with the control).

Due to gSirt1 gene overexpression, it has raised self and versatility genes involved Plzf, and its relative expression quantity has raised 56 times; Also raise that cell proliferation related wherein Myc relative expression quantity has raised 2.5 times because of Myc, PCNA and cyclin CCNA1, PCNA relative expression quantity has raised 5 times, CCNA1 relative expression quantity has raised 4.5 times, expresses compared with the control and significantly raises.And the gene upregulation of these and self, versatility and cell proliferation, disclose gSirt1 gene and can promote the self of milk goat stem spermatogonium after milk goat stem spermatogonium process LAN, maintain versatility and propagation.And the Flow cytometry of cell cycle finds further, in milk goat stem spermatogonium after overexpression Sirt1, the cell significance being in the G1/G0 phase reduces, and the cell significance being in the S phase increases.

The self of promotion milk goat stem spermatogonium provided by the invention and the carrier of propagation, the self-renewal capacity of milk goat stem spermatogonium can be impelled to increase, cell proliferation is accelerated, Sirt1 also can play the effect regulating and maintain self and versatility in stem spermatogonium, can play potential active effect in the research building immortalization milk goat stem spermatogonium.

Accompanying drawing explanation

Fig. 1 is the plasmid map of pSirt1-IRES2-AcGFP expression vector;

Fig. 2 is positive recombinant plasmid pSirt1-IRES2-AcGFP, gSirt1 gene fragment and the pIRES2-AcGFP carrier of EcoRI and BamHI double digestion;

Fig. 3 is the reporter gene EGFP expression of the milk goat stem spermatogonium of fluorescence microscope pSirt1-IRES2-AcGFP carrier positive expression and the result figure of Sirt1 antibody staining;

Fig. 4-1 ~ Fig. 4-3 be Sirt1 in milk goat stem spermatogonium after overexpression quantitative PCR and Western Blot detect;

Fig. 5 be Sirt1 in milk goat stem spermatogonium after overexpression 48h cell cycle detect.

Embodiment

Below in conjunction with specific embodiment, the present invention is described in further detail, and the explanation of the invention is not limited.

The self of promotion milk goat stem spermatogonium provided by the invention and the carrier of propagation, build carrier for expression of eukaryon using the Sirt1 gene relevant to spermatogenesis as goal gene, with milk goat stem spermatogonium for host transduces, impel gSirt1 gene overexpression or overexpression in stem spermatogonium.

Concrete, first the present invention builds the carrier for expression of eukaryon pSirt1-IRES2-AcGFP containing gSirt1 and green fluorescent protein (AcGFP) gene, this carrier transfection is imported milk goat male germ stem cells, fluorescence microscope marker gene AcGFP and Sirt1 antibody staining detect its expression, confirm that goal gene gSirt1 expresses well in milk goat male germ stem cells.

Involved main agents is as follows: DMEM-F12 substratum equal purchased from American GIBCO (Invitrogen) company, EDTA purchased from American Sigma company, foetal calf serum is U.S. HYCLONE (HYCLONE) company, Tissue Culture Plate and culture dish are Denmark Nunclon Products, plasmid extraction kit is purchased from Tian Gen company, Reverse Transcription box and TurboFect transfection reagent are all purchased from Thermo company, and Sirt1 antibody is purchased from Bioworld company.Archaeal dna polymerase is purchased from TAKARA company.

Below in conjunction with accompanying drawing, the present invention is described in further detail with experiment.

1, the structure of carrier for expression of eukaryon pSirt1-IRES2-AcGFP

The clone of a, goal gene milk goat gSirt1

According to gSirt1mRNA primers P1 and P2 that GeneID:XM_005699096.1 announces, with the cDNA of milk goat spermatogonium for template primer P1, P2 carry out pcr amplification, primer sequence is as follows:

Forward direction primer P1:CGAGAATTCGTTGAAAGATGGCGG 24

Backward primer P2:GCGCGGATCCCATTCAATTTGACAT 25

The PCR reaction system of 50 μ L is: 5 × Fly Buffer:5 μ L, dNTPs (2.5mmol/L): 2 μ L, P1 (5 μm of ol/L): 1 μ L, P2 (5 μm of ol/L): 1 μ L, FastPfu polysaccharase (5U/ μ L): 0.15 μ L, template: 1.5 μ L, Mg ²⁺(50mmol/L): 1 μ L, ultrapure water to 50 μ L is added.

PCR reaction conditions is: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 62 DEG C of annealing 30s, and 72 DEG C extend 3min, 30 PCR circulations, and 72 DEG C extend 7min again;

PCR primer is cut (EcoRI and BamHI double digestion) latter 4 DEG C to be connected to spend the night with pMD-18T Vector enzyme, transformed competence colibacillus cell E.coli DH5 α, by ammonia benzyl resistance screening, select recon, identify positive recombinant plasmid pMD-18T-gSirt1 through EcoRI and BamHI double digestion and deliver the order-checking of Shanghai biotechnology Services Co., Ltd.GSirt1 gene sequencing result is as shown in SEQ.ID.NO.1, and be 99.7% with gSirt1mRNA sequence (GeneID:XM_005699096.1) homology announced, therefore, the gene of cloning is the gSirt1 gene of milk goat.

The carrier structure of b, pSirt1-IRES2-AcGFP

The present invention specifically comprises the carrier for expression of eukaryon pSirt1-IRES2-AcGFP (its plasmid map as shown in Figure 1) of goal gene gSirt1 with pIRES2-AcGFP carrier and pMD-18T-gSirt1 vector construction.

The structure of pSirt1-IRES2-AcGFP carrier is as follows:

With EcoRI and BamHI double digestion respectively, from gSirt1 and pIRES2-AcGFP (being commercially available) that pMD-18T-gSirt1 carrier is cloned, glue reclaims fragment, connect with T4DNA ligase enzyme 4 DEG C and spend the night, and transformed competence colibacillus cell E.coli DH5 α, identify positive recombinant plasmid through EcoRI and BamHI double digestion.Detected result as shown in Figure 2, wherein, swimming lane 1 identifies positive recombinant plasmid for EcoRI and BamHI double digestion, can see two band of 5360bp and 2121bp, illustrates that gSirt1 has been cloned on carrier pIRES2-AcGFP by EcoRI and BamHI restriction enzyme site; Swimming lane 2 is the gSirt1 fragment of EcoRI and BamHI double digestion, 2121bp; Swimming lane 3 is the pIRES2-AcGFP carrier of EcoRI and BamHI double digestion, can see a band being about 5360bp; Swimming lane M is Marker, and size represents 500bp, 750bp, 2500bp, 1000bp, 2000bp, 3000bp, 500bp and 15000bp respectively; By the recombinant plasmid called after pSirt1-IRES2-AcGFP obtained.

PSirt1-IRES2-AcGFP carrier comprises neomycin resistance screening-gene neo ^rwith marker gene AcGFP; Marker gene AcGFP can in mammalian cell high expression level produce fluorescence; Goal gene gSirt1 to be inserted into the multiple clone site on pIRES2-AcGFP by the present invention by multiple clone site EcoRI and BamHI, make gSirt1 gene at the cells of transfection.

Because plasmid is bred in intestinal bacteria, easily bacterial endotoxin is taken in end product by common plasmid extraction method, the existence of bacterial endotoxin can affect plasmid transfection efficiency and Growth of Cells, so this research employs endotoxic plasmid extraction kit, to reduce the negative impact of intracellular toxin to test-results.Extract with the endotoxic plasmid purification kit that goes of Tian Gen company the concentration and the purity that measure plasmid after plasmid with nucleic acid-protein determinator, after measured, the concentration of plasmid is 389ng/ μ l, and OD260/280 is 1.89, illustrates that plasmid is purer, can be used for transfection.

2, pSirt1-IRES2-AcGFP eukaryotic expression vector transfection milk goat male germ stem cells

The cultivation of c, milk goat male germ stem cells

From liquid nitrogen, get a pipe milk goat male germ stem cells thaw in 37 DEG C, the DMEM-F12 cell culture fluid adding 0.8ml is centrifugal, abandons supernatant, adds cell culture fluid resuspended, gets 4ml cell suspending liquid and is inoculated in the culture dish of diameter 6cm, be placed in CO ₂cultivate under 37 DEG C of conditions in incubator.

Until milk goat male germ stem cells reach 80% converge time, inhale and abandon nutrient solution, with without Ca ²⁺, Mg ²⁺pBS rinse cell, add pancreatin and EDTA mixture slaking liquid, peptic cell.Observation of cell under inverted microscope, when most cells retraction, change circle, intercellular substance expand, with the DMEM-F12 cell culture fluid termination digestion containing 10% foetal calf serum, after pipettor piping and druming, collected by centrifugation, suspends, ratio in 1: 3 is inoculated in 12 orifice plates, puts into CO ₂cultivate in incubator.Milk goat male germ stem cells, is cultured to cell and reaches 80% and converge for transfection.

D, pSirt1-IRES2-AcGFP eukaryotic expression vector transfection milk goat male germ stem cells

The present invention specifically adopts transfection reagent TurboFect to carry out transfection, pSirt1-IRES2-AcGFP carrier for expression of eukaryon is imported milk goat male germ stem cells, is specially:

Day before transfection, by milk goat male germ stem cells with 1 × 10 ⁵be inoculated in 12 orifice plates, overnight incubation makes cell reach 70-80% to converge.For every porocyte, the fresh DMEM-F12 nutrient solution of preheating is changed before transfection, again 1 μ g pSirt1-IRES2-AcGFP carrier for expression of eukaryon is added in 100 μ lOpti-MEM and mix, then the TurboFect piping and druming mixing of 2 μ l is added, after incubated at room 20min, slowly joined in cell culture fluid; Fresh DMEM-F12 nutrient solution is renewed after 6h; Fluorescence microscope after 48h.

Transfection reagent TurboFect is a kind of cationic polymer aqueous solution of uniqueness, and itself and potent damping fluid are with the use of can efficiently by albumen, antibody and polypeptide transfered cell matter.No matter in substratum whether containing serum, this reagent all can transfected proteins.Carry out transgenosis compared with other method with TurboFect, easy and simple to handle, reproducible, by DNA size restriction, toxicity is little, transduction efficiency is high.

3, the qualification of pSirt1-IRES2-AcGFP carrier for expression of eukaryon positive expression cell

After 48h, the transfection positive milk goat male germ stem cells of pSirt1-IRES2-AcGFP carrier for expression of eukaryon, carries out immunofluorescent staining: 1). and cell 4%PFA room temperature is fixed 15min, and PBS washes 2 times, each 5min; 2). with 0.1%Triton-X 100 room temperature rupture of membranes 10min, PBS washes 2 times, each 5min; 3) .1%BSA incubated at room 45min; 4) suck BSA, drip the primary antibodie of diluting in proportion in right amount, 4 DEG C of overnight incubation; 5). suck primary antibodie, PBS washes 3 times, each 5min; 6). drip two resisting of diluting in proportion in right amount, incubated at room 1h, PBS wash 3 times, each 5min; 7). add the cell dye karyolymph containing Hoechst 33342, incubated at room 3min, PBS wash 3 times, each 5min; 8). drip appropriate PBS, fluorescence microscope is also taken a picture.

Detected result as shown in Figure 3, wherein, AcGFP is the AcGFP expression of results observed under green fluorescence, SIRT1 is the SIRT1 expression of results observed under red fluorescence, AcGFP/SIRT1 is that SIRT1 antibody staining (redness) overlaps with AcGFP (green) fluorocyte, Hoechst 33342 is contrast, and result shows that AcGFP and SIRT1 obtains expression simultaneously, and goal gene gSirt1 is successful expression in milk goat male germ stem cells.

4, Sirt1 promotes self and the propagation of milk goat stem spermatogonium

Carry out RT-PCR, Western blot respectively to the stem spermatogonium of gSirt1 successful expression to detect.As Fig. 4-1 is depicted as Sirt1 and PLZF in quantitative PCR detection overexpression Sirt1 cell, wherein gSirt1 gene relative expression quantity reaches 125 times, and the relative expression quantity of Plzf has raised 56 times; Fig. 4-2 is depicted as Myc, PCNA, CCNA1, CCND1 in quantitative PCR detection overexpression Sirt1 cell, and wherein Myc relative expression quantity has raised 2.5 times, and PCNA relative expression quantity has raised 5 times, and CCNA1 relative expression quantity has raised 4.5 times; Fig. 4-3 detects SIRT1, PLZF, OCT4 and the MYC in overexpression Sirt1 cell for Western Blot, obviously can find that Sirt1, PLZF express and significantly raise, and the expression of OCT4 and MYC is also obviously raised.

In stem spermatogonium, Plzf and Oct4 is very important self and versatility genes involved.And in milk goat stem spermatogonium after overexpression Sirt1, detect the self in discovery milk goat stem spermatogonium and the equal up-regulated (Fig. 4-1 of versatility genes involved Oct4 and Plzf, shown in Fig. 4-3), cell proliferation related because of Myc, PCNA and cyclin CCNA1 also up-regulated expression (shown in Fig. 4-2, Fig. 4-3).And the up-regulated of these genes involveds obviously can promote the self of milk goat stem spermatogonium and the maintenance of polymorphism.

The Flow cytometry of cell cycle finds further, and in milk goat stem spermatogonium after overexpression Sirt1, the cell significance being in the G1/G0 phase reduces, and the cell significance being in the S phase increases.As shown in Figure 5, wherein A is the cell cycle after milk goat stem spermatogonium transfection pSirt1-IRES2-AcGFP; B is the cell cycle after milk goat stem spermatogonium transfection pIRES2-AcGFP; C is the cell cycle of milk goat stem spermatogonium; D is the data statistics in A, B and C figure, and result display G1/G0 phase, S phase cell count have significant difference, and increasing of S phase cell quantity also represents that cell proliferation is accelerated.

To these results suggest that in milk goat stem spermatogonium after overexpression Sirt1, the self-renewal capacity of milk goat stem spermatogonium increases, cell proliferation is accelerated, Sirt1 also can play the effect regulating and maintain self and versatility in milk goat stem spermatogonium, can play potential active effect in the research building immortalization milk goat stem spermatogonium.

Claims (10)

1. promoting the self of milk goat stem spermatogonium and a carrier for propagation, it is characterized in that, is the carrier for expression of eukaryon comprising milk goat gSirt1 gene.

2. the self of promotion milk goat stem spermatogonium as claimed in claim 1 and the carrier of propagation, it is characterized in that, the nucleotide sequence of described milk goat gSirt1 gene is as shown in SEQ.ID.NO.1.

3. the self of promotion milk goat stem spermatogonium as claimed in claim 1 and the carrier of propagation, it is characterized in that, after comprising the eukaryotic expression vector transfection milk goat stem spermatogonium of milk goat gSirt1 gene, make its gSirt1 gene overexpression or overexpression.

4. the self of promotion milk goat stem spermatogonium as claimed in claim 1 and the carrier of propagation, is characterized in that, described carrier for expression of eukaryon is also provided with antibiotic-screening gene and marker gene.

5. the self of promotion milk goat stem spermatogonium as claimed in claim 1 and the carrier of propagation, it is characterized in that, described carrier for expression of eukaryon is pSirt1-IRES2-AcGFP, by milk goat gSirt1 gene clone in pIRES2-AcGFP expression vector, wherein gSirt1 with AcGFP is connected by IRES2, forms bicistronic mRNA.

6. the self of promotion milk goat stem spermatogonium according to claim 1 and the carrier of propagation are promoting the self of milk goat stem spermatogonium, are maintaining versatility and the application in breeding.

7. apply as claimed in claim 6, it is characterized in that, gSirt1 gene overexpression or overexpression after described eukaryotic expression vector transfection milk goat stem spermatogonium, and raise the expression with self and versatility genes involved, raise cell proliferation related because of and the expression of cyclin.

8. apply as claimed in claim 7, it is characterized in that, described self and versatility genes involved comprise Oct4 and Plzf, and described is cell proliferation related because comprising Myc and PCNA, and cyclin is CCNA1.

9. apply as claimed in claim 6, it is characterized in that, after described eukaryotic expression vector transfection milk goat stem spermatogonium, impel it to enter the S phase of cell cycle, accelerate cell proliferation.

10. promote the self of milk goat stem spermatogonium and a method for propagation, it is characterized in that, comprise following operation:

1) the milk goat gSirt1 gene of clone as shown in SEQ.ID.NO.1, and be cloned in carrier for expression of eukaryon and build gSirt1 carrier for expression of eukaryon;

2) in DMEM-F12 nutrient solution, be cell to be transfected with milk goat stem spermatogonium, add the gSirt1 carrier for expression of eukaryon of mixing in Opti-MEM, then add transfection reagent TurboFect and carry out transfection, incubated at room;

3) the milk goat stem spermatogonium of gSirt1 process LAN or overexpression, its self-renewal capacity increases, and cell proliferation is accelerated.