CN104388549A - Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof - Google Patents
Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof Download PDFInfo
- Publication number
- CN104388549A CN104388549A CN201410605342.6A CN201410605342A CN104388549A CN 104388549 A CN104388549 A CN 104388549A CN 201410605342 A CN201410605342 A CN 201410605342A CN 104388549 A CN104388549 A CN 104388549A
- Authority
- CN
- China
- Prior art keywords
- probe
- sequence
- cell
- detection probes
- capture probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
Abstract
The invention discloses a method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and an application thereof, and particularly discloses a probe group for detecting leukemia cells and an application thereof. The probe group comprises a magnetic-bead capturing probe and a detecting probe or a precursor of the detecting probe; the magnetic-bead capturing probe consists of a magnetic bead and a capturing probe which is fixed on the magnetic bead, and the capturing probe is a single-stranded DNA molecule shown as the sequence 1; the precursor of the detecting probe consists of a target sequence and a phosphoric acid labeled lock-type probe, and the target sequence is a single-stranded DNA molecule shown as the sequence 2, and the nucleotide sequence of the phosphoric acid labeled lock-type probe is a single-stranded DNA molecule shown as the sequence 3; and the detecting probe is formed by cyclizing the phosphoric acid labeled lock-type probe and combing the cyclized phosphoric-acid labeled lock-type probe with the target sequence. Experiments prove that the probe group can be used for specifically and sensitively detecting 100 leukemia cells from 2,000,000 normal human peripheral blood cells.
Description
Technical field
The invention belongs to the clinical medicine Application Areas of biomaterial, relate to the enrichment of a kind of aptamers magnetic and RCA dual signal amplification detection tumour cell method and application, particularly a kind of probe groups of amplifying based on magnetic enrichment and RCA dual signal for detecting leukemia cell and application thereof.
Background technology
Leukemia is a class hemopoietic stem cell malignant clone disease.Clonal leukemia cell breeds accumulation in a large number because of mechanism such as proliferation out of control, dysdifferentiation, apoptosis are obstructed in marrow and other hemopoietic tissues, and infiltrates its hetero-organization and organ, and normal hematopoiesis is suppressed simultaneously.Clinical visible anaemia in various degree, hemorrhage, infectious fever and liver, spleen, lymphadenectasis and skeleton pain.
Leukemia is one of tumour occurred frequently of China, and its classification diagnosis needs the various means such as associating morphology, immunophenotype, cytogenetics and molecular biology.Due to the diversity of cellular form, simple dependence morphological examination is difficult to accurate somatotype; Leukemia cell's monoclonal antibody specific is not found yet, leukemia is as a kind of height heterogeneity disease, antigen presentation is sometimes more disorderly, and interdepartmental list reaches comparatively common, part leukemia-associated antigen over the course for the treatment of or recurrence time can lose or occur series change; Utilize cytogenetics (karyotype and aobvious band) and molecular biological inspection method, the objectivity of diagnosis and accuracy rate are significantly improved, but only have the acute lymphoblastic leukemia of 40% (ALL) to have chromosomal exception, and the not corresponding specific chromosomal of various clinical subtype is abnormal, in addition, these inspections are consuming time, cost is high, make it popularization and acquire a certain degree of difficulty.
Summary of the invention
An object of the present invention is to provide a kind of probe groups detected for leukemia cell.
The probe groups detected for leukemia cell provided by the present invention, is specifically made up of following (a) and (b):
(a) magnetic capture probe;
Described magnetic capture probe is made up of magnetic bead and the capture probe (aptamers) be fixed on described magnetic bead; Described capture probe is the single strand dna shown in sequence in sequence table 1;
The precursor of (b) detection probes or described detection probes;
The padlock probe that the precursor of described detection probes is marked by target sequence and phosphoric acid forms; Described target sequence is the single strand dna shown in sequence in sequence table 2; The nucleotides sequence of the padlock probe of described phosphoric acid mark is classified as the single strand dna shown in sequence 3 in sequence table;
Described detection probes is combined into by the padlock probe of the described phosphoric acid mark of cyclisation and described target sequence.
Described detection probes specifically can be prepared by the precursor of described detection probes according to the method comprised the steps: be 1:(2-4 by the padlock probe of described target sequence and described phosphoric acid mark according to mol ratio) the ratio mixing of (as 1:3), 95 DEG C hatch 5-10min (as 10min) after, add DNA ligase 15-20 DEG C (as 16 DEG C) and hatch 10-16h (as 12h), obtain described detection probes.
More concrete, in one embodiment of the invention, the preparation method of described detection probes is as follows: the padlock probe of described target sequence and described phosphoric acid mark is all used binding buffer liquid (solvent is water by (1), solute and concentration as follows: NaCl 8g/L, KCl 0.2g/L, CaCl
20.14g/L, Na
2hPO
4h
2o 0.1g/L, MgCl
26H
2o 1.42g/L, NaHCO
30.35g/L, KH
2pO
40.2g/L, glucose 4.5g/L) be made into 5 μMs of concentration, then the padlock probe solution of gained target sequence solution, phosphoric acid mark and sterilized water are mixed according to the ratio that volume ratio is 1:3:6,95 DEG C are heated 10 minutes, slowly cool to 25 DEG C; (2) in the system of step (1), add E.coli DNA ligase, be 0.04U/ μ l to its final concentration, hatch 12h for 16 DEG C.
Described magnetic capture probe specifically can prepare according to the method comprised the steps: jointly hatch through biotin labeled described capture probe and the described magnetic bead through marked by streptavidin, obtain described magnetic capture probe.
In the present invention, described vitamin H is specifically marked on 3 ' end of described capture probe.
In described method, when hatching described in carrying out, be 75pmol:1mg through biotin labeled described capture probe and the proportioning through the described magnetic bead of marked by streptavidin.
Further, hatch described in be specially 20-30 DEG C (as 25 DEG C) 80-150rpm (as 100rpm) concussion hatch 10-30 (as 15min).Described liquid environment of hatching is binding buffer liquid; The solvent of described binding buffer liquid is water, solute and concentration as follows: NaCl 8g/L, KCl 0.2g/L, CaCl
20.14g/L, Na
2hPO
4h
2o 0.1g/L, MgCl
26H
2o 1.42g/L, NaHCO
30.35g/L, KH
2pO
40.2g/L, glucose 4.5g/L.
More concrete, in one embodiment of the invention, the preparation method of described magnetic capture probe comprises the steps: to get respectively the described magnetic bead solution through marked by streptavidin (solvent is described binding buffer liquid) that the solution through biotin labeled described capture probe (solvent is described binding buffer liquid) that concentration is 500nM (with DNA metering) and concentration are 10mg/ml (measuring with magnetic bead), mix according to the proportioning of volume ratio 3:2, 10-30min (as 15min) is hatched in 20-30 DEG C (as 25 DEG C) 80 ~ 150rpm (as 100rpm) concussion, namely described magnetic capture probe is obtained.
Test kit containing described probe groups also belongs to protection scope of the present invention.
Also containing molecular beacon in described test kit; Described molecular beacon is by one end with fluorophor, and the other end is with quenching group, and nucleotides sequence is classified as the neck ring structure that in sequence table, the molecule of strand DAN shown in sequence 4 is formed.
In the present invention, 5 ' end of described molecular beacon is marked with fluorophor FITC, and 3 ' end is marked with quenching group DABCYL.
Described probe groups, or described test kit, the application in arbitrary as follows also belongs to protection scope of the present invention:
A test kit that () is detected for the preparation of leukemia cell;
B () is for the preparation of the test kit of leukemia state of illness monitoring.
In the present invention, described leukemia cell is detected as and detects leukemia cell from the periphery whole blood of person to be measured, medullary cell, white corpuscle or lymphocyte.
In the application, when carrying out described leukemia state of illness monitoring, the sample to be tested of employing can be the periphery whole blood of person to be measured, medullary cell, white corpuscle or lymphocyte.
Described person to be measured can be leukaemic, healthy normal people or suffers from the non-leukaemic of other diseases (as thalassemia, marrow abnormal increase disease or hypoferric anemia).
In the present invention, described leukemia is specially acute lymphoblastic leukemia (ALL), as Pancytopenia (T-ALL).
The precursor of described detection probes or described detection probes also belongs to protection scope of the present invention above.
The present invention adopts magnetic enrichment and rolling circle amplification (rolling circle amplification, RCA) dual signal mode of amplifying to define a kind of high specific and high-sensitive tumour cell detection method.Magnetic capture probe by the target cell concentration of trace from a large amount of compared with control cells, and therefrom can be separated, relative to centrifugal separation technique, easy and simple to handle, not easily loses cell, effectively reduces the signal caused because of cell loss and reduces; The present invention is also optimized the reaction times etc., and whole experiment carries out under condition best in optimization range; In order to improve the susceptibility of aptamers probe in detecting, detection probes detection signal amplifies through RCA signal by the present invention.The present invention additionally uses molecular beacon and does signal reporter molecules, the circular part of this molecular beacon can with the tumor-necrosis factor glycoproteins complete complementary of RCA product.Only there occurs RCA reaction, the long-chain products of RCA has partial sequence and molecular beacon to hybridize, and molecular beacon self is hybridized and opens, fluorescent signal just can recover.The use of molecular beacon significantly reduces background fluorescence, improves the sensitivity of detection.In addition, the present invention carries out in homogeneous phase, compares surface reaction, has more touch opportunity between cell and aptamers, ensure that reaction more fast with complete.Due to above reason, present invention achieves high specific and high-sensitive detection, 100 leukemia cells can be detected from 2,000,000 Normal human peripheral's hemocytes, sensitivity reaches 20,000/.
Accompanying drawing explanation
Fig. 1 is that the RCA reaction signal of associating magnetic capture probe and detection probes amplifies electrophoresis detection result and luminoscope detected result.A is electrophoretic image result; B is luminoscope detected result.
Fig. 2 is the situation of RCA amplification on fluorescence microscope cell.Image to left is optical microphotograph Microscopic observation, and right side is fluorescence microscopy Microscopic observation.A, B: be latter 0 minute of RCA reaction; C, D: be latter 10 minutes of RCA reaction; E, F: be latter 30 minutes of RCA reaction; G, H: be latter 60 minutes of RCA reaction; I, J: be latter 90 minutes of RCA reaction; K, L are latter 120 minutes of RCA reaction.
Fig. 3 detects by fluidic cell the situation of RCA amplification on cell.A is RCA expanding effect on flow cytomery cem cell; For aptamers RCA expanding effect on flow cytomery Ramos cell; C is that CEM and Ramos geometric mean fluorescence intensity compares histogram.
Fig. 4 be FITC mark capture probe with combine magnetic capture probe and detection probes detects cem cell RCA signal amplification effect comparison diagram.
Fig. 5 catches figure for associating magnetic capture probe and detection probes to cem cell is specific.A is blank magnetic bead; B is capture probe catching Ramos cell; C is capture probe catching 293-T cell; D is capture probe catching cem cell.
Fig. 6 is for associating magnetic capture probe and detection probes are to cem cell specific detection fluorescent microscope result figure.Image to left is light field figure, and Image to right is fluorescence imaging figure.A, B are blank magnetic bead; C, D are Ramos cell; E, F are 293T cell; G, H are cem cell.
Fig. 7 is for associating magnetic capture probe and detection probes are to cem cell specific detection fluorescence spectrum figure.
Fig. 8 catches results contrast microscope imaging figure for associating magnetic capture probe and detection probes to cem cell system and T-ALL patient lymphocytes.A is before cem cell system catches; B is after cem cell system catches; C is before T-ALL patient peripheral blood lymphocyte is caught; D is after T-ALL patient peripheral blood lymphocyte is caught.
For associating magnetic capture probe and detection probes detect, leukemia is micro-remains little pathology result (RQ-PCR instrument detected result) to Fig. 9.In figure, lines 1 represent 0 cem cell; Lines 2 represent 50 cem cells; Lines 3-6 represents 100,500,1000,2000 cem cells respectively.
Figure 10 is the detected result of associating magnetic capture probe and detection probes to Leukemia Patients periphery complete blood cell.A is periphery whole blood test result fluorescence spectrum figure; B is healthy normal people and ALL patient peripheral whole blood test result difference comparison diagram.
Figure 11 is different time points peripheral blood detected result before and after ALL patient treatment (RQ-PCR instrument detected result).
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Cem cell (human T lymphocyte leukemia cell): purchased from bio tech ltd of upper Haifeng county longevity, article No.: Cell-3720.
Ramos cell (Human B lymphoma cell): purchased from Bai Li bio tech ltd, Shanghai, article No.: RAMOS.
293T cell (human embryonic kidney epithelial cells that Sv40 transforms): purchased from Bai Li bio tech ltd, Shanghai, article No.: 293T.
Embodiment 1, the preparation of probe groups detected for leukemia cell
One, the preparation of magnetic capture probe
(1) through the preparation of biotin labeled capture probe
Described biotin labeled capture probe is biotin labeled single strand dna, is DaLian, China precious biotech firm product, and this probe single-stranded DNA sequence used is as follows:
5 '-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAAAAAA-3 ' (sequence 1), wherein biotin labeling molecule is at 3 ' end of nucleic acid chains.
(2) through the magnetic bead of marked by streptavidin
The magnetic bead of described marked by streptavidin is the Dynabeads Streptavidin MagneSphere M280 that Invitrogen company produces, and the design parameter of this magnetic bead is as follows: as magnetic bead mean diameter 2.8 μm, surface-area: 4-8m2/g, density: 1.4g/cm3, magnetic bead content: 10mg/ml, iso-electric point: pH 5.0, low electric charge :-10mV (pH 7), CV value <3%, iron level (ferrite): 12% (17%).
(3) preparation of magnetic capture probe
1, be mixed with through biotin labeled capture probe binding buffer liquid the solution that concentration is 500nM (with DNA metering) by what obtain in step ().Wherein, (for the 1L solution) composed as follows of binding buffer liquid: NaCl 8g, KCl 0.2g, CaCl
20.14g, Na
2hPO
4h
2o 0.1g, MgCl
26H
2o 1.42g, NaHCO
30.35g, KH
2pO
40.2g, glucose 4.5g; Surplus is water.
2, (concentration is 10mg/ml to get the magnetic bead through marked by streptavidin that 200 μ l steps (two) obtain, calculate with the gauge of magnetic bead), after binding buffer liquid (filling a prescription the same) washing 2 times, then magnetic bead is suspended in the binding buffer liquid of 200 μ l.
3, getting concentration that 300 μ l steps 1 obtain is after the magnetic bead of the marked by streptavidin processed through step 2 through biotin labeled capture probe solution and 200 μ l of 500nM (with DNA metering) fully mixes, 15 minutes are hatched in 25 DEG C of 100rpm concussions, put on magnetic frame, after Magneto separate, abandon supernatant, gained precipitation binding buffer liquid (filling a prescription the same) is resuspended.
4, with the binding buffer liquid (filling a prescription the same) of 50 μ l cleaning twice, finally use the resuspended magnetic bead being fixed with DNA of 200 μ l binding buffer liquid (filling a prescription the same) to 10mg/ml (in magnetic bead).
Two, the preparation of detection probes
1, the padlock probe of target sequence and phosphoric acid mark is designed and synthesized
Target sequence is:
5 '-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAAAAAAAAAATGTCCG TGCTAGAAGGAAACAGTTAC-3 ' (sequence 2);
The padlock probe of phosphoric acid mark is (5 '-3 '):
PO3-TAGCACGGACATATATGATGGTACCGCAGACTAAGCCACCGTGATCACTACT AAGTGGAAGAAATGTAACTGTTTCCTTC (sequence 3).
2, the padlock probe of target sequence and phosphoric acid mark all uses binding buffer liquid (filling a prescription the same) to be made into 5 μMs of concentration, the padlock probe solution of target sequence solution, phosphoric acid mark and sterilized water are mixed according to the ratio that volume ratio is 1:3:6,95 DEG C are heated 10 minutes, slowly cool to 25 DEG C.The object of this step allows target sequence and padlock probe combine.
3, in the system (20 μ l) of step 2,4.5 μ l E. coli ligase reaction solns are added (containing 10 × ligaseBuffer 2 μ l, 10 × BSA 2 μ l, E.coli DNA ligase 0.5 μ l (concentration is 2U/ μ l), 16 DEG C of night incubation (12h).The object of this step allows padlock probe connect into ring.
Embodiment 2, the application example of probe groups detected for leukemia cell
One, cell catch the detection with fluorescent signal
1, RCA reaction detects with reaction times signal situation of amplifying
A. cell to be checked: cem cell (human T lymphocyte leukemia cell).
(1) get 4 μ l concentration be 10mg/ml (in magnetic bead) embodiment 1 step one obtain magnetic capture probe and 4 μ l concentration be 500nM (with DNA metering) embodiment 1 step 2 obtain detection probes mixing, add 25 DEG C, cell to be checked and hatch 25 minutes.
(2) with binding buffer liquid (filling a prescription the same) washing 2 times, by cell suspension in the binding buffer liquid (filling a prescription the same) of 30.1 μ l, add 9.9 μ l Phi29DNA and be polymerized mixed reaction solution (10 × Phi 29DNA polymerase Buffer4 μ l; 100 × BSA 0.4 μ l; 2.5mM dNTP 3 μ l; 10 μMs of molecular beacon 2 μ l; Phi29DNA polymerase0.5 μ l), 30 DEG C of laggard row agarose gel electrophoresis of reaction 30min detect and luminoscope detection, and 0min, 10min, 30min, 60min, 90min and 120min of reaction carry out fluorescence microscope respectively.
Wherein, the nucleotides sequence of molecular beacon is classified as: 5 '-TC TAC GG CAC TAC TAA GTG GAA GCCGTA GA-3 ' (sequence 4).
5 ' end of molecular beacon is marked with fluorophor FITC, and 3 ' end is marked with quenching group DABCYL.
As shown in Figure 1, the A in Fig. 1 can see the visible bright band at the place of portalling of sepharose to the detected result of agarose gel electrophoresis detection and luminoscope, shows to define the very large RCA product of molecular weight; B in Fig. 1 can produce a large amount of fluorescent signals after can seeing RCA product and molecular beacon hybridization.
Fluorescence microscope result as shown in Figure 2, can see, on cell, fluorescence intensity strengthens along with the increase of rolling the ring iodine time, shows that associating magnetic capture probe and detection probes can carry out RCA amplification on cell, and along with the prolongation of time, product increases gradually.When roll the ring iodine time maintain about 60 minutes time, can observe cell fluorescence, when 120 minutes, fluorescence is the strongest.
B. cell to be checked: cem cell (human T lymphocyte leukemia cell) and Ramos cell (Human B lymphoma cell).
(1) carry out with reference to (1) in A.
(2) carry out with reference to (2) in A, 0min, 10min, 30min, 60min, 90min and 120min of reaction adopt flow cytometer to detect fluorescent signal respectively.
Experiment arranges the contrast adopting the capture probe (FITC-ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGAAAAAA) of FITC mark to substitute probe groups and molecular beacon simultaneously.Specific as follows: to get the capture probe that 4 μ l concentration are the FITC mark of 500nM (with DNA metering), add 25 DEG C, cell to be checked and hatch 25 minutes.With binding buffer liquid (filling a prescription the same) washing 2 times, by cell suspension in the binding buffer liquid (filling a prescription the same) of 32.1 μ l, add 7.9 μ l Phi29DNA and be polymerized mixed reaction solution (10 × Phi 29DNA polymerase Buffer 4 μ l; 100 × BSA 0.4 μ l; 2.5mM dNTP 3 μ l; Phi29DNA polymerase 0.5 μ l), 30 DEG C of reactions adopted flow cytometer to detect fluorescent signal after 1.5 hours.
Experiment arranges the blank substituting magnetic capture probe with blank magnetic bead simultaneously.
In experimental group, cem cell and Ramos cell are along with the carrying out in reaction times, and the fluorescent signal detected by fluidic cell is concrete as shown in Figure 3.Can see the prolongation along with the time, cem cell fluorescence intensity strengthens (in Fig. 3 A) gradually, and Ramos cell fluorescence intensity change little (in Fig. 3 B); Along with time lengthening, experimental group cem cell FITC-A Gea Mean is multiplied, RCA increase 120 minutes time, geometric mean fluorescence intensity increases to nearly 40 times of blank, and control group Ramos cell is without obviously increasing (in Fig. 3 C).Above result shows that the fluorescence intensity of cem cell is obviously better than Ramos cell, and associating magnetic capture probe and detection probes can effectively for the specific detection of target cell.
In addition, the capture probe marked with FITC combines with cem cell and compares, and capture probe obviously moves to right (Fig. 4) through the sample of rolling circle amplification after 1.5 hours (i.e. probe groups processing sample of the present invention) curve.Show that associating magnetic capture probe and detection probes detection signal signal after RCA obviously amplify.
2, associating magnetic capture probe and detection probes are to the specificity analyses of catching leukemia cell
Cell to be checked: cem cell (human T lymphocyte leukemia cell), Ramos cell (Human B lymphoma cell) and 293T cell (human embryonic kidney epithelial cells that Sv40 transforms).
(1) carry out with reference to (1) in step 1A.
(2) carry out with reference to (2) in step 1A, after reaction 25min, adopt light microscopic and the catch situation of fluorescent microscope to each cell to observe, and adopt luminoscope to detect the fluorescence signal intensity of each group.
Experiment arranges the contrast substituting magnetic capture probe with blank magnetic bead simultaneously.
Om observation result as shown in Figure 5, can see visible magnetic bead around cem cell, and other cell is at large obtains or cell peripheral has no magnetic bead, shows that capture probe only catches cem cell.
Fluorescence microscope result as shown in Figure 6, can be seen, blank magnetic bead, Ramos and 293T cell sample are showed no obvious fluorescence, and in cem cell sample, visible magnetic bead and cell all have fluorescent signal.Show that associating magnetic capture probe and detection probes can realize cem cell specific detection.
Fluorescence spectrum figure as shown in Figure 7, can see, the fluorescent signal of cem cell sample is obviously better than 293T cell and Ramos cell.Show that associating magnetic capture probe and detection probes can realize cem cell specific detection.
Two, magnetic capture probe and detection probes to Leukemia Patients lymphocytic detection is combined
Sample to be tested: take from the clinical periphery whole blood confirming as healthy normal people, and take from the periphery whole blood that clinical definite is T-ALL patient.
Add in periphery whole blood to be measured containing heparin solution (10 ~ 50U/ml blood sample), mixing, makes blood anticoagulant.Then operate in accordance with the following steps:
(1) lymphocytic acquisition: the anticoagulation of 1ml is diluted according to volume ratio 1:1 with the PBS of pH 7.2; Draw 1ml lymphocyte separation medium (Solarbio Products, its catalog number is P8610) and be placed in graduated centrifuge tube.The whole blood of dilution is slowly added to above lymphocyte separation medium along tube wall; At 18 DEG C ~ 20 DEG C, with horizontal centrifuge with the centrifugal 20min of 2000r/min, collect PBMC, with PBS liquid washed cell 3 times, each 1600rpm, centrifugal 10 minutes.With binding buffer liquid (filling a prescription the same) re-suspended cell, mixing, adds complete 1640 substratum after counting, moves in 6 well culture plates and cultivates 30 ~ 45min, collects suspension cell and is lymphocyte.
(2) 1 × 10 is got respectively
6lymphocyte, is placed in 96 orifice plates.
(3) get 4 μ l concentration be 10mg/ml (in magnetic bead) embodiment 1 step one obtain magnetic capture probe and 4 μ l concentration be 500nM (with DNA metering) embodiment 1 step 2 obtain detection probes mixing, add 25 DEG C, cell to be checked and hatch 25 minutes.
(4) with binding buffer liquid (filling a prescription the same) washing 2 times, by cell suspension in the binding buffer liquid (filling a prescription the same) of 30.1 μ l, add 9.9 μ lPhi29DNA and be polymerized mixed reaction solution (10 × Phi 29DNA polymerase Buffer4 μ l; 100 × BSA 0.4 μ l; 2.5mM dNTP 3 μ l; 10 μMs of molecular beacon 2 μ l; Phi29DNA polymerase0.5 μ l), 30 DEG C of reaction 120min, then observe with fluorescent microscope.
Experiment is arranged with the lymphocytic contrast of GEM cell replacement leukaemic simultaneously.
Result as shown in Figure 8, can be seen, associating magnetic capture probe and detection probes to GEM cell and leukaemic lymphocytic catch similar.Show to utilize cem cell to set up minimal residual disease varying model.
Three, the foundation of minimal residual disease varying model and the detection of minimal change
1, the foundation of minimal residual disease varying model
50,100,500,1000,2000 cem cells are mixed with the clinical lymphocyte confirming as healthy normal people respectively and sets up minimal change model, make total cellular score reach 2,000,000, obtain minimal residual disease varying model.
2, the detection of minimal change
Cell to be checked: microresidual disease model cell.
(1) carry out with reference to (1) in step one 1A.
(2) carry out with reference to (2) in step one 1A, after reaction 25min, employing RQ-PCR instrument detects the fluorescence signal intensity of each group.
Experiment arranges the normal people's group that with the addition of 0 cem cell (namely 2,000,000 cells are the lymphocyte of healthy normal people) simultaneously.
As shown in Figure 9, the fluorescence intensity of minimal residual disease varying models more than visible 100 cem cells is all apparently higher than normal controls, and detection sensitivity reaches 2 × 10 for result
-4.Experiment obtains same result in triplicate.
Four, the detection of magnetic capture probe and detection probes to Leukemia Patients periphery complete blood cell is combined
Sample to be tested: take from the clinical periphery whole blood confirming as healthy normal people, and take from the periphery whole blood that clinical definite is T-ALL patient.
Add in periphery whole blood to be measured containing heparin solution (10 ~ 50U/ml blood sample), mixing, makes blood anticoagulant.Then operate in accordance with the following steps:
(1) healthy normal people and the T-ALL patient periphery whole blood 100 μ l through anti-freezing process is got respectively, centrifugal 5 minutes of 1000rpm, abandon supernatant, inhale bottom centrifuge tube and abandon most red corpuscle, add in the binding buffer liquid of 2ml washing 3 times of (filling a prescription the same), cell suspension (is filled a prescription the same) in the binding buffer liquid of 100 μ l the most at last, stand-by.
(2) get the magnetic capture probe that 4 μ l concentration are embodiment 1 step one acquisition of 10mg/ml (in magnetic bead), join in the final cell suspending liquid obtained of 20 μ l steps (1), hatch 25 minutes for 25 DEG C.The binding buffer liquid (filling a prescription the same) slowly adding 100 ~ 200 μ l washs 2-3 time, adds the detection probes that 2 μ l concentration are the embodiment 1 step 2 acquisition of 500nM (with DNA metering), hatches 25 minutes for 25 DEG C.
(3) with binding buffer liquid (filling a prescription the same) washing 2 times, cell suspension is added in the binding buffer liquid (filling a prescription the same) of 30.1 μ l 9.9 μ l Phi29DNA and be polymerized mixed reaction solution (10 × Phi 29DNA polymerase Buffer4 μ l; 100 × BSA 0.4 μ l; 2.5mM dNTP 3 μ l; 10 μMs of molecular beacon 2 μ l; Phi29DNA polymerase0.5 μ l), 30 DEG C of reactions adopt luminoscope to detect the fluorescent signal of each group after 2 hours.
Result as shown in Figure 10, can see, detect through associating magnetic capture probe and detection probes, the obvious calibration ordinary person of fluorescence intensity of ALL patient whole blood strengthens (in Figure 10 A), and difference has statistical significance, P < 0.01 (in Figure 10 B).Show that associating magnetic capture probe and detection probes detection technique can specific detection leukemia cells.
Five, associating magnetic capture probe and detection probes are used for leukemia state of illness monitoring
Sample to be tested: take from the periphery whole blood that clinical definite is before T-ALL Chemotherapy in Patients, chemotherapy starts 3 days, 4 days and the 13rd day.
Add in periphery whole blood to be measured containing heparin solution (10 ~ 50U/ml blood sample), mixing, makes blood anticoagulant.Then operate in accordance with the following steps:
(1) same to step 4 (1).
(2) same to step 4 (2).
(3) with binding buffer liquid (filling a prescription the same) washing 2 times, by cell suspension in the binding buffer liquid (filling a prescription the same) of 30.1 μ l, add 9.9 μ l Phi29DNA and be polymerized mixed reaction solution (10 × Phi 29DNA polymerase Buffer4 μ l; 100 × BSA 0.4 μ l; 2.5mM dNTP 3 μ l; 10 μMs of molecular beacon 2 μ l; Phi29DNA polymerase0.5 μ l), 30 DEG C are reacted 2 hours, and employing RQ-PCR instrument detects the fluorescence signal intensity of each group.
Result as shown in figure 11, can be seen, along with the prolongation for the treatment of time, fluorescent signal weakens gradually.Show that detection technique of the present invention may be used for the dynamic monitoring of the leukemia state of an illness.
Claims (10)
1., for the probe groups that leukemia cell detects, be made up of following (a) and (b):
(a) magnetic capture probe;
Described magnetic capture probe is made up of magnetic bead and the capture probe be fixed on described magnetic bead; Described capture probe is the single strand dna shown in sequence in sequence table 1;
The precursor of (b) detection probes or described detection probes;
The padlock probe that the precursor of described detection probes is marked by target sequence and phosphoric acid forms; Described target sequence is the single strand dna shown in sequence in sequence table 2; The nucleotides sequence of the padlock probe of described phosphoric acid mark is classified as the single strand dna shown in sequence 3 in sequence table;
Described detection probes is combined into by the padlock probe of the described phosphoric acid mark of cyclisation and described target sequence.
2. probe groups according to claim 1, it is characterized in that: described detection probes prepares according to the precursor of the method comprised the steps by described detection probes: be 1:(2-4 by the padlock probe of described target sequence and described phosphoric acid mark according to mol ratio) ratio mixing, 95 DEG C hatch 5-10min after, add DNA ligase 15-20 DEG C and hatch 10-16h, obtain described detection probes.
3. probe groups according to claim 1 and 2, it is characterized in that: described magnetic capture probe prepares according to the method comprised the steps: jointly hatch through biotin labeled described capture probe and the described magnetic bead through marked by streptavidin, obtain described magnetic capture probe.
4., according to described probe groups arbitrary in claim 1-3, it is characterized in that: when hatching described in carrying out, be specially 75pmol:1mg through biotin labeled described capture probe and the proportioning through the described magnetic bead of marked by streptavidin;
Described hatching is specially 20-30 DEG C of 80-150rpm concussion and hatches 10-30min;
Described liquid environment of hatching is specially binding buffer liquid; The solvent of described binding buffer liquid is water, solute and concentration as follows: NaCl8g/L, KCl0.2g/L, CaCl
20.14g/L, Na
2hPO
4h
2o0.1g/L, MgCl
26H
2o1.42g/L, NaHCO
30.35g/L, KH
2pO
40.2g/L, glucose 4.5g/L.
5. the test kit containing described probe groups arbitrary in claim 1-4.
6. test kit according to claim 5, is characterized in that: also containing molecular beacon in described test kit;
Described molecular beacon is by one end with fluorophor, and the other end is with quenching group, and nucleotides sequence is classified as the neck ring structure that in sequence table, the molecule of strand DAN shown in sequence 4 is formed.
7. arbitrary described probe groups in claim 1-4, or the test kit described in claim 5 or 6, the application in arbitrary as follows:
A test kit that () is detected for the preparation of leukemia cell;
B () is for the preparation of the test kit of leukemia state of illness monitoring.
8. according to described probe groups arbitrary in claim 1-8 or test kit or application, it is characterized in that: described leukemia cell is detected as and detects leukemia cell from the periphery whole blood of person to be measured, medullary cell, white corpuscle or lymphocyte.
9. application according to claim 7, is characterized in that: when carrying out described leukemia state of illness monitoring, and the sample to be tested of employing is the periphery whole blood of person to be measured, medullary cell, white corpuscle or lymphocyte.
10. the precursor of the detection probes described in claim 1 or described detection probes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410605342.6A CN104388549B (en) | 2014-10-31 | 2014-10-31 | Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410605342.6A CN104388549B (en) | 2014-10-31 | 2014-10-31 | Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388549A true CN104388549A (en) | 2015-03-04 |
| CN104388549B CN104388549B (en) | 2017-01-18 |
Family
ID=52606506
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410605342.6A Active CN104388549B (en) | 2014-10-31 | 2014-10-31 | Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388549B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087772A (en) * | 2015-06-26 | 2015-11-25 | 上海恒健生物技术有限公司 | Liquid-phase gene chip, and method and reagent kit for detecting liquid-phase gene chip |
| CN105087772B (en) * | 2015-06-26 | 2018-06-01 | 上海恒健生物技术有限公司 | A kind of liquid phase genetic chip detection method, liquid phase genetic chip and kit |
| CN109517722A (en) * | 2018-09-28 | 2019-03-26 | 张珝 | A kind of device and its making and use method capturing specific few cells |
| CN109797233A (en) * | 2019-03-13 | 2019-05-24 | 湖北朗德医疗科技有限公司 | A kind of RCA method detecting streptococcus pneumonia |
| CN110687280A (en) * | 2019-10-14 | 2020-01-14 | 河南省商业科学研究所有限责任公司 | Preparation method of immunomagnetic beads for detecting ethylenediamine tetraacetate and immunomagnetic beads prepared by same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103087899A (en) * | 2013-01-17 | 2013-05-08 | 湖南大学 | Aptamer-based microfluidic chip capable of capturing cancer cells and preparation thereof as well as separation method of cancer cells |
-
2014
- 2014-10-31 CN CN201410605342.6A patent/CN104388549B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103087899A (en) * | 2013-01-17 | 2013-05-08 | 湖南大学 | Aptamer-based microfluidic chip capable of capturing cancer cells and preparation thereof as well as separation method of cancer cells |
Non-Patent Citations (1)
| Title |
|---|
| 乔婉琼等: "滚环扩增原理及其在医药领域的应用", 《中国药科大学学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105087772A (en) * | 2015-06-26 | 2015-11-25 | 上海恒健生物技术有限公司 | Liquid-phase gene chip, and method and reagent kit for detecting liquid-phase gene chip |
| CN105087772B (en) * | 2015-06-26 | 2018-06-01 | 上海恒健生物技术有限公司 | A kind of liquid phase genetic chip detection method, liquid phase genetic chip and kit |
| CN109517722A (en) * | 2018-09-28 | 2019-03-26 | 张珝 | A kind of device and its making and use method capturing specific few cells |
| CN109517722B (en) * | 2018-09-28 | 2022-04-01 | 德拜至臻医学科技(杭州)有限公司 | Device for capturing specific trace cells and manufacturing and using methods thereof |
| CN109797233A (en) * | 2019-03-13 | 2019-05-24 | 湖北朗德医疗科技有限公司 | A kind of RCA method detecting streptococcus pneumonia |
| CN110687280A (en) * | 2019-10-14 | 2020-01-14 | 河南省商业科学研究所有限责任公司 | Preparation method of immunomagnetic beads for detecting ethylenediamine tetraacetate and immunomagnetic beads prepared by same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388549B (en) | 2017-01-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cho et al. | Selective isolation and noninvasive analysis of circulating cancer stem cells through Raman imaging | |
| Lee et al. | Efficient isolation and accurate in situ analysis of circulating tumor cells using detachable beads and a high‐pore‐density filter | |
| CN102827845B (en) | Nucleic acid aptamer of epithelial cell adhesion molecule and preparation method thereof | |
| CN105115878A (en) | Circulating tumor cell detection kit, preparing method thereof and application thereof | |
| CA3106271A1 (en) | Methods, compositions, kits, and systems for selective enrichment of target cells | |
| CN101955939B (en) | Aptamer for grouping different subtype non-small cell lung cancers and screening method thereof | |
| CN107860912B (en) | Detection method of bifunctional aptamer-mediated A549 tumor cells | |
| JP2012503475A5 (en) | ||
| Tang et al. | A DNA-based hydrogel for exosome separation and biomedical applications | |
| Pham et al. | Bovine extracellular vesicles contaminate human extracellular vesicles produced in cell culture conditioned medium when ‘exosome-depleted serum’is utilised | |
| Sasse et al. | Angiogenic potential of bone marrow derived CD133+ and CD271+ intramyocardial stem cell trans-plantation post MI | |
| CN104388549A (en) | Method for detecting tumor cells by aptamer magnet enrichment and dual-signal RCA (rolling circle amplification) and application thereof | |
| CN110004149A (en) | A kind of aptamer of programmed death receptor-ligand 1 and its application | |
| CN106520764A (en) | Nano di-cyclic aptamer probe and application thereof | |
| Ashley et al. | Point‐of‐critical‐care diagnostics for sepsis enabled by multiplexed micro and nano sensing technologies | |
| CN108430336A (en) | Circulating cells, the internal collection of protein and nucleic acid and Local Quantitative and signature analysis | |
| CN104208723B (en) | MiR-638 application in anti-acute myeloid leukemia | |
| CN108866064B (en) | Aptamer of targeted metastatic human breast cancer cells and application thereof | |
| Alsop et al. | A novel tissue atlas and online tool for the interrogation of small RNA expression in human tissues and biofluids | |
| CN107884377B (en) | Cell exosome-based nanocluster probe and application thereof in preparation of imaging preparation | |
| CN107525920B (en) | Poly ion liquid magnetic nanocomposites and its application to trace enriching specificity of circulating tumor cell and detection | |
| Keller et al. | On-slide detection of enzymatic activities in selected single cells | |
| CN104293921A (en) | Magnetic nano composite for treating lung cancer and preparation method thereof | |
| CN101914543B (en) | Nucleic acid aptamer for classification of different-subtype non-small cell lung cancers and screening method thereof | |
| Luo et al. | Identification and biological characteristics of clear cell renal cell carcinoma associated urine-derived stem cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |