CN104388539A - Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof - Google Patents
Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof Download PDFInfo
- Publication number
- CN104388539A CN104388539A CN201410033119.9A CN201410033119A CN104388539A CN 104388539 A CN104388539 A CN 104388539A CN 201410033119 A CN201410033119 A CN 201410033119A CN 104388539 A CN104388539 A CN 104388539A
- Authority
- CN
- China
- Prior art keywords
- plant
- detection method
- meat product
- camv
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and a detection kit thereof. According to the kit and the detection method, transgenic regulatory elements CaMV35S promoter, NOS terminator and marker gene NPTII are used as detection objects, and detection is carried out in allusion to multiple gene fragments. The problem that DNA in highly-processed products such as meat products and the like is damaged can be solved effectively. False-negative probability is reduced. In addition, the problem that genetically modified sources are uncertain is solved. Meanwhile, present detection requirements on speediness, sensitiveness, simple operation, high throughput and low cost are met, and effective analysis and monitoring of plant-originated transgenic ingredients of those products are realized.
Description
Technical field
The present invention relates to one and the present invention relates to plant-derived transgene component multiple fluorescence quantitative PCR detection method and detection kit in a kind of meat product, belong to biology field.
Background technology
At present, China's meat product output and consumption all occupy first place in the world.In the modern meat products course of processing, for improve meat product quality, optimizing product quality, guarantee balanced in nutrition, composition such as vegetable-protein, starch, food fibre, edible gum, vegetables oil and the various seasonings etc. of plant-sourced are applied in the processing of meat product.Along with the large-scale commercial of transgenic plant, multiple genetically modified crops beans, paddy rice, corn, Semen Brassicae campestris etc. and converted products thereof have been widely used in foodstuff manufacturing, therefore, while in the meat product year course of processing, vegetable-derived components is added, transgene component indirectly, inevitably penetrates into the field of meat product.Therefore, responsive, genetically modified food research that is qualitative and quantitative detecting method fast and accurately comes into one's own day by day.Nucleic acid detection method is the method for the most frequently used and the most applicable detection genetically modified food, mainly contain qualitative PCR method, quantitative fluorescent PCR, wherein quantitative fluorescent PCR is a kind of molecular Biological Detection technology that development in recent years is got up, owing to having highly sensitive, high specific, accountability, level of automation are high, are widely used in the detection fields such as genetically modified food, pathogenic micro-organism, disease control.But its detection is all with single target for detected object, and through the work program of complexity, DNA can be subject to the impact of the factors such as physics, chemistry or the enzyme factor, causes destruction in various degree.This brings very large challenge and risk to the method for single detected object of present, and the transgene component be introduced into source has very large uncertainty, adopts single detection method to carry out one by one, the complicated operation that is bound to, to waste time and energy and cost is larger.In a word, the detection method of simple target, in the deep processed product detection GMOs such as meat product, has very large leak and drawback, is difficult to effectively monitor this series products.Multiple fluorescence quantitative PCR arises at the historic moment on this basis, but current technology also imperfection, and also there is a lot of blank in its utilization field.Multiple fluorescence quantitative PCR is on the basis based on Taqman probe method quantitative fluorescent PCR, by using multipair primer and being marked with the probe of different fluorescent signals accordingly, in same reaction system, multiple target sequence is detected simultaneously, realize the detection demand of high-throughput, low cost.Therefore, the universal component conventional for transgenic technology and marker gene, exploitation multiple fluorescence PCR detection technique, carrying out detection to multiple target fragment is the task of top priority, to make up the blank in current many utilization fields.
Summary of the invention
An object of the present invention is to provide plant-derived transgene component multiple fluorescence quantitative PCR detection method and detection kit in a kind of new meat product.
The object of this invention is to provide the multiple fluorescence quantitative PCR detection method of planting property transgene component in source in a kind of meat product, comprise DNA extraction and PCR detects two steps, it is characterized in that: described DNA extraction step for by meat product sample after shredding or grinding homogeneous, carry out DNA extracting according to tissue gene group DNA extraction method; Described PCR detecting step is by the Auele Specific Primer of CaMV 35S promoter, NOS terminator and marker gene NPTII and probe, premix quantitative fluorescent PCR reaction system, DNA profiling and ddH
2o by a certain percentage consumption adds quantitative fluorescent PCR reaction tubes, then quantitative fluorescent PCR reaction tubes is put into quantitative real time PCR Instrument increases, and amplification terminates rear collection fluorescent signal, carries out parallel test simultaneously.
Further, the described Auele Specific Primer of CaMV 35S promoter, NOS terminator and marker gene NPTII and the base of probe put in order into:
CaMV 35S
Reverse primer: 5 '-CGACAGTGGTCCCAAAGA-3 '
Forward primer: 5 '-AAGACGTGGTTGGAACGTCTTC-3 '
Probe: 5 ' FAM-TGGACCCCCACCCACGAGGAGCATC-TAMRA 3 ';
NOS
Reverse primer: 5 '-TCT TAAGATTGAA TCCTGTT-3 '
Forward primer: 5 '-ATTGCGGGACTCTAATCATA-3 '
Probe: 5 ' HEX-CAGAAATTATATGATAATCATCGCAAGTCC – TAMRA 3 ';
NPTⅡ
Reverse primer: 5 '-AGGATCTCGTCGTGACCCAT-3 '
Forward primer: 5 '-GCACGAGGAAGCGGT-3 '
Probe: 5 ' ROX-CACCCAGCCGGCCACAGTCGAT-TAMRA 3 '.
Further, in described PCR detecting step, the add-on of each component is as shown in the table:
Further, described DNA profiling is the DNA of standard substance or extraction; As positive control pipe when described DNA profiling is standard substance; As testing tube when described DNA profiling is the DNA extracted.
Further, described standard substance sequence should comprise following sequence:
CaMV 35S：AAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCT CGTGGGTGGGGGTCCATCTTTGGGACCACTGTCG；
NOS:TCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATTAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGA TTAGAGTCCCGCAATTA；
NPTⅡ：GCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCA CGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTC ACGACGAGAT CCT。
Further, the reaction parameter that described quantitative real time PCR Instrument is arranged is 95 DEG C of sex change 1min30s, and with 95 DEG C of 5s, 58 DEG C of 30s, 72 DEG C of 30 s increases 40 and circulate, and starts to collect fluorescent signal after arranging 58 DEG C of end.
Another object of the present invention is to provide the test kit used in plant-derived transgene component multiple fluorescence quantitative PCR detection method in a kind of meat product, it is characterized in that: described test kit comprises transgenic regulation element, premix quantitative fluorescent PCR reaction system, standard substance and ddH
2o; Described transgenic regulation element comprises Auele Specific Primer and the probe of affiliated CaMV 35S promoter, NOS terminator and marker gene NPTII; Described standard substance comprise the target amplification fragment of CaMV 35S promoter, NOS terminator and marker gene NPTII.
Further, the Auele Specific Primer of described CaMV 35S promoter, NOS terminator and marker gene NPTII and probe are Auele Specific Primer and the probe of CaMV 35S promoter, NOS terminator and marker gene NPTII in meat product in plant-derived transgene component multiple fluorescence quantitative PCR detection method.
Further, the target amplification fragment of described CaMV 35S promoter, NOS terminator and marker gene NPTII is the target amplification fragment of CaMV 35S promoter, NOS terminator and marker gene NPTII in meat product in plant-derived transgene component multiple fluorescence quantitative PCR detection method.
Result judges: standard substance are set to positive control pipe as DNA profiling, extracting DNA is set to sample test cell as DNA profiling, replaced by ddH2O DNA profiling as negative control pipe, respectively make three parallel pipes, quantitative fluorescent PCR reaction terminates to carry out interpretation of result according to amplification curve afterwards, the precondition of result validity should meet negative control should without Ct value (without amplification curve) and positive control Ct < 35(typical case amplification curve), otherwise it is invalid to be considered as, when testing sample result three kinds of fluorescence are all without Ct value (without amplification curve), show sample not containing plant-derived transgene component, when testing sample result three kinds of fluorescence have wherein one to three kind of typical amplification curve, and during Ct value < 35, show that sample contains plant derived component, when amplification curve appears in testing sample, and during 35≤Ct < 40, be suspicious specimen, should retest, if result is still in this scope, show that sample contains a small amount of plant-derived transgene component.
Beneficial effect: the controlling element and the marker gene that the present invention is directed to transgenic technology, develop a kind of multiple fluorescence PCR detection technique, can detect multiple target fragment, not only the problem that in the deep processed products such as meat product, DNA wrecks can be successfully managed, reduce false negative probability, and solve the probabilistic problem in transgenosis source, meet current quick simultaneously, sensitive, easy and simple to handle, high-throughput, the testing requirement of low cost, reach the organic unity of complicated principle and ease of Use, realize effectively analyzing the plant-derived transgene component of this series products, monitoring.
Accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
Fig. 1 is the positive control amplification schematic diagram of multiple fluorescence quantitative PCR standard substance as DNA profiling.
Fig. 2 is the negative control amplification schematic diagram that in multiple fluorescence quantitative PCR, ddH2O replaces DNA profiling.
Fig. 3 is self-control sausage amplification.(adding NOS terminator and marker gene NPTII standard substance at random)
Fig. 4 is self-control bacon amplification.(adding CaMV 35S promoter, NOS terminator standard substance at random)
Fig. 5 is commercially available containing transgenic sample the result.
Embodiment
Implementation column below can make those skilled in the art more fully understand the present invention, but does not therefore limit the present invention among described scope of embodiments.
embodiment 1
NOS terminator and marker gene NPTII standard substance are added at random in self-control sausage process, the method provided according to test kit extracts genomic dna (genomic dna extracts test kit purchased from Tian Gen biochemical technology company limited), standard substance are set to positive control pipe as DNA profiling, extracting DNA is set to sample test cell as DNA profiling, replaced by ddH2O DNA profiling as negative control pipe, filling a prescription related reagent according to following table 1, (primer and probe entrust precious biotechnology (Dalian) company limited to synthesize, fluorescent probe 5 ｀ end FAM marks, 3 ｀ ends connect TAMRA mark) join fluorescent quantitation reaction tubes, the reaction tubes adding reagent is placed in real-time fluorescence quantitative PCR instrument (real-time fluorescence quantitative PCR reaction solution is purchased from Takara), it is as follows that reaction parameter is set: 95 DEG C of sex change 1 min 30 s, with sex change 95 DEG C of 5 s, anneal 58 DEG C of 30s, extend 72 DEG C of 30 s to increase 40 and circulate, 58 DEG C of end start to collect fluorescent signal, result as shown in figures 1 and 3, find that positive control is typical amplification curve, show in sample containing plant-derived transgene component.
Table 1
embodiment 2
Self-control bacon process adds CaMV 35S promoter, NOS terminator standard substance at random, repeat the test method described in embodiment 1 and each component proportion, result as shown in Figure 2 and Figure 4, finds that positive control is typical amplification curve, shows in sample containing plant-derived transgene component.
embodiment 3
Will through the sausage of SN/T 1204-2003 standard " plant and converted products in transgene component real-time fluorescence PCR qualitative reaction method " thereof qualification containing genetically engineered soybean composition, the method provided according to test kit extracts genomic dna, repeat the test method described in embodiment 1 and each component proportion, result as shown in Figure 5, find testing sample pipe FAM, there is typical amplification curve in HEX fluorescent signal, confirms in sample containing plant-derived transgene component.
Claims (9)
1. in a meat product, plant the multiple fluorescence quantitative PCR detection method of source property transgene component, comprise DNA extraction and PCR detects two steps, it is characterized in that: described DNA extraction step for by meat product sample after shredding or grinding homogeneous, carry out DNA extracting according to tissue gene group DNA extraction method; Described PCR detecting step is by the Auele Specific Primer of affiliated CaMV 35S promoter, NOS terminator and marker gene NPTII and probe, premix quantitative fluorescent PCR reaction system, DNA profiling and ddH
2o by a certain percentage consumption adds quantitative fluorescent PCR reaction tubes, then quantitative fluorescent PCR reaction tubes is put into quantitative real time PCR Instrument increases, and amplification terminates rear collection fluorescent signal, carries out parallel test simultaneously.
2. plant the multiple fluorescence quantitative PCR detection method of source property transgene component in meat product according to claim 1, it is characterized in that: described affiliated CaMV 35S promoter, NOS terminator and the Auele Specific Primer of marker gene NPTII and the base of probe put in order into:
CaMV 35S
Reverse primer: 5 '-CGACAGTGGTCCCAAAGA-3 '
Forward primer: 5 '-AAGACGTGGTTGGAACGTCTTC-3 '
Probe: 5 ' FAM-TGGACCCCCACCCACGAGGAGCATC-TAMRA 3 ';
NOS
Reverse primer: 5 '-TCT TAAGATTGAA TCCTGTT-3 '
Forward primer: 5 '-ATTGCGGGACTCTAATCATA-3 '
Probe: 5 ' HEX-CAGAAATTATATGATAATCATCGCAAGTCC – TAMRA 3 ';
NPTⅡ
Reverse primer: 5 '-AGGATCTCGTCGTGACCCAT-3 '
Forward primer: 5 '-GCACGAGGAAGCGGT-3 '
Probe: 5 ' ROX-CACCCAGCCGGCCACAGTCGAT-TAMRA 3 '.
3. plant the multiple fluorescence quantitative PCR detection method of source property transgene component in meat product according to claim 1, it is characterized in that: in described PCR detecting step, the add-on of each component is as shown in the table:
。
4. plant the multiple fluorescence quantitative PCR detection method of source property transgene component in meat product according to claim 1, it is characterized in that: described DNA profiling is the DNA of standard substance or extraction; As positive control pipe when described DNA profiling is standard substance; As testing tube when described DNA profiling is the DNA extracted.
5. plant the multiple fluorescence quantitative PCR detection method of source property transgene component in meat product according to claim 1, it is characterized in that: described standard substance sequence should comprise following sequence:
CaMV 35S：AAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCT CGTGGGTGGG GGTCCATCTTTGGGACCACTGTCG；
NOS:TCTTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATTAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTTTTTATGA TTAGAGTCCC GCAATTA；
NPTⅡ：GCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCA CGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTC ACGACGAGAT CCT。
6. plant-derived transgene component multiple fluorescence quantitative PCR detection method in meat product according to claim 1, it is characterized in that: the reaction parameter that described quantitative real time PCR Instrument is arranged is 95 DEG C of sex change 1min30s, with 95 DEG C of 5s, 58 DEG C of 30s, 72 DEG C of 30 s increases 40 and circulates, and starts to collect fluorescent signal after arranging 58 DEG C of end.
7. the test kit used in plant-derived transgene component multiple fluorescence quantitative PCR detection method in meat product according to claim 1, is characterized in that: described test kit comprises transgenic regulation element, premix quantitative fluorescent PCR reaction system, standard substance and ddH
2o; Described transgenic regulation element comprises Auele Specific Primer and the probe of affiliated CaMV 35S promoter, NOS terminator and marker gene NPTII; Described standard substance comprise the target amplification fragment of CaMV 35S promoter, NOS terminator and marker gene NPTII.
8. the test kit used in plant-derived transgene component multiple fluorescence quantitative PCR detection method in meat product according to claim 7, is characterized in that: the Auele Specific Primer of described affiliated CaMV 35S promoter, NOS terminator and marker gene NPTII and probe are Auele Specific Primer and the probe of affiliated CaMV 35S promoter, NOS terminator and marker gene NPTII in meat product in plant-derived transgene component multiple fluorescence quantitative PCR detection method.
9. the test kit used in plant-derived transgene component multiple fluorescence quantitative PCR detection method in meat product according to claim 7, is characterized in that: the target amplification fragment of described CaMV 35S promoter, NOS terminator and marker gene NPTII is the target amplification fragment of CaMV 35S promoter, NOS terminator and marker gene NPTII in meat product in plant-derived transgene component multiple fluorescence quantitative PCR detection method.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410033119.9A CN104388539A (en) | 2014-01-24 | 2014-01-24 | Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410033119.9A CN104388539A (en) | 2014-01-24 | 2014-01-24 | Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104388539A true CN104388539A (en) | 2015-03-04 |
Family
ID=52606496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410033119.9A Pending CN104388539A (en) | 2014-01-24 | 2014-01-24 | Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388539A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300717A (en) * | 2018-02-11 | 2018-07-20 | 云南省烟草农业科学研究院 | The specific primer pair of vegetable-derived components and its application in a kind of detection cigarette |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352075A (en) * | 2013-06-13 | 2013-10-16 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Transgenic component ultrasensitive detection probe and primers |
-
2014
- 2014-01-24 CN CN201410033119.9A patent/CN104388539A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103352075A (en) * | 2013-06-13 | 2013-10-16 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Transgenic component ultrasensitive detection probe and primers |
Non-Patent Citations (3)
| Title |
|---|
| FRANCISMAR CORREA MARCELINO等: "detection and quantification of Roundup Ready soybean residues in sausage samples by conventional and real-time PCR", 《CIENCIA E TECNOLOGIA DE ALIMENTOS》, 31 December 2008 (2008-12-31) * |
| 中华人民共和国国家质量监督检验检疫总局: "《中华人民共和国出入境检验检疫行业标准》", 17 March 2003, article "SN/T 1204-2003" * |
| 叶可萍等: "利用Taqman实时荧光PCR检测市售肉制品中转基因大豆成分", 《食品与发酵工业》, 31 December 2010 (2010-12-31) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300717A (en) * | 2018-02-11 | 2018-07-20 | 云南省烟草农业科学研究院 | The specific primer pair of vegetable-derived components and its application in a kind of detection cigarette |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105112569A (en) | Virus infection detection and identification method based on metagenomics | |
| Li et al. | A high-throughput, high-quality plant genomic DNA extraction protocol | |
| CN103993074B (en) | The molecule marker of Xanthomonas oryzae pv oryzae and application thereof | |
| CN105525012B (en) | A kind of method for identifying molecules of peanut hybridization kind | |
| CN102154454B (en) | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof | |
| CN105087759B (en) | Identify copy number of target genes and the method for screening low-copy plant in genetically modified plants | |
| Badali et al. | Molecular tools in medical mycology; where we are! | |
| CN103898100B (en) | CccDNA standard items and preparation method thereof, quantitatively detection hepatitis B cccDNA method and kit | |
| CN103276054A (en) | Primer for auxiliary detection of soybean hundred-grain weight, and detection method thereof | |
| CN104388539A (en) | Multiplex fluorescent quantitative PCR detection method of plant-originated transgenic ingredients in meat products and detection kit thereof | |
| CN103642934B (en) | A kind of method of genetically engineered soybean edible oil fluorescence quantitative PCR detection | |
| CN102534007B (en) | Specific sequence characterized amplified region (SCAR) marker for Trialeurodes vaporariorum, specific primers, and quick molecular identification method | |
| CN104498593A (en) | Primer pair and kit for identification or assisted identification of stored bean weevils | |
| CN104388580A (en) | Method for identifying homozygotic type or heterozygous type NK603 on basis of digital PCR (polymerase chain reaction) | |
| CN103589797A (en) | SNP (single nucleotide polymorphism) genotyping method and application thereof | |
| CN1932037A (en) | Method of screening transgenic wheat | |
| CN107058322A (en) | The miRNA related to Dunaliella salina cell saline-alkaline tolerance | |
| CN102965435A (en) | Universal quantitative detection method for CaMV 35S promoters | |
| CN109136386B (en) | Quantitative PCR method and kit for rapid typing and tracing of yarrowia carotovora | |
| CN102191326A (en) | Nucleic acid hybrid film strip for detecting exogenous gene and use thereof | |
| CN111218520A (en) | Transgenic soybean GTS-40-3-2 strain EFIRM detection probe and application thereof | |
| CN104830857A (en) | Primer, probe and method for specific quantitative PCR accurate detection of genetically modified corn MON88017 strain | |
| CN104531904A (en) | Apple chlorotic leaf spot virus real-time fluorescent quantitative PCR (polymerase chain reaction) detection method | |
| CN104561386A (en) | Real-time fluorescent quantitative PCR detection method for apple stem grooving virus | |
| CN117051145B (en) | Screening transgenic corn based on time-of-flight mass spectrometry |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150304 |
|
| RJ01 | Rejection of invention patent application after publication |