CN104388353B - A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method - Google Patents

A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method Download PDF

Info

Publication number
CN104388353B
CN104388353B CN201410696261.1A CN201410696261A CN104388353B CN 104388353 B CN104388353 B CN 104388353B CN 201410696261 A CN201410696261 A CN 201410696261A CN 104388353 B CN104388353 B CN 104388353B
Authority
CN
China
Prior art keywords
endophyte
lipase
bacterial strain
chinese pistache
yielding lipase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410696261.1A
Other languages
Chinese (zh)
Other versions
CN104388353A (en
Inventor
黄勇
陈东红
宋春竹
阮颖
刘春林
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Agricultural University
Original Assignee
Hunan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Agricultural University filed Critical Hunan Agricultural University
Priority to CN201410696261.1A priority Critical patent/CN104388353B/en
Publication of CN104388353A publication Critical patent/CN104388353A/en
Application granted granted Critical
Publication of CN104388353B publication Critical patent/CN104388353B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07Bacillus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation methods, by will seed alcohol, mercury chloride processing after, it is inoculated in beef extract-peptone culture and obtains endophyte, with liquid LB fermenting microbe, bacterium solution is inoculated in tributyrin solid medium culture, the strain for choosing transparent circle is inoculated in LB liquid medium fermentation, after taking fermentation liquid centrifuge separation filtering, by filtrate tributyrin solid medium culture, screening obtains bacterial strain PC1.Bacterial strain PC1 plate streaking obtains single colonie, white in appearance, and early growth period shows to moisten smooth, fold occurs with back edge and dries out;Gram's staining is positive, and it is in the shape of a rod to observe thallus under an electron microscope.

Description

A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method
Technical field
The invention belongs to field of biotechnology, and in particular to a kind of Chinese pistache seed yielding lipase endophyte PC1 and its point From method.
Background technique
Chinese pistache (Pistacia chinensis Bunge) also known as pattern wood, yellow chinaberry, medicine wood etc., are Anacardiaceae pistache Deciduous tree.Pistacia chinensis bge oil-containing 49.3%, unsaturated fatty acid is up to 82.4%, is a kind of excellent wild oil resource, Especially produce the ideal woody oleiferous plants of biodiesel.
Endophyte of plant (endophyte) refers to that those move in health in the certain phase of its history of life or whole stages Various tissues and the organ inside of plant or fungi, bacterium or the actinomyces in space between cells, infected host plant is (at least External symptom is not shown temporarily).Endophyte of plant is widely present in all plants studied, in agricultural, medicine There is major application value with environmental protection etc..But so far there are no about Chinese pistache endophyte report.
Lipase (Lipase, EC3.1.1.3) i.e. Lipase is that one kind can be urged in water-oil interface Change triglyceride hydrolysis, and the enzyme of ester synthesis reaction can be catalyzed in non-aqueous phase medium.Lipase is prevalent in animals and plants In microbial body, but microbial source lipase has broader reaction pH, preference temperature scope and stronger Substratspezifitaet And stereoselectivity, thus there is status more outstanding in zymetology theoretical research and practical application.
Summary of the invention
The present invention is intended to provide a kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method, by wherein The breeding that the bacterial strain of yielding lipase carries out, bacterial strain of gaining the upper hand, and its zymology is studied.
The invention is realized by the following technical scheme:
A kind of Chinese pistache seed yielding lipase endophyte PC1, the bacterial strain have carried out preservation, depositary institution: Chinese Typical Representative training Support object collection, address: Wuhan City, Hubei Province Hongshan District Bayi Road, Wuhan University, China typical culture collection center;It protects Hide the date: on October 9th, 2014;Deposit number are as follows: CCTCC M 2014461.
The nucleotide full length sequence such as SEQ ID NO.1 of the Chinese pistache seed yielding lipase endophyte PC1 lipase It is shown.
The PC1 bacterial strain flat board crosses to obtain single colonie, white in appearance, early growth period show to moisten it is smooth, then There is fold and dries out in edge;Gram's staining is positive, and it is in the shape of a rod to observe thallus under an electron microscope.
A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method, are completed especially by following steps:
1) the Chinese pistache fruit for choosing fresh and healthy, after the hard pericarp of physical removal, selects intact Seed impregnates 10min in 75% alcohol of at least 20 times volumes, impregnates 10min in 0.1% mercury chloride, with sterile water wash 5 It is secondary, each 1min;
2) 5 pieces of sterilized Chinese pistache seeds are put into sterile mortar, 500 μ L sterile waters is added and are ground into paste, add Enter sterile water and be diluted to 5mL, 100 μ L dilutions is taken to be inoculated on beef-protein medium, under the conditions of 28 DEG C cultivate 3~ 7 days, endogenetic bacteria is obtained, 4 DEG C of punctures save plate streaking after purification;
3) by the strain inoculated of acquisition in 5mL liquid LB, 28 DEG C, 150rpm overnight incubation takes 2 μ L bacterium solutions o'clock in three butyric acid Glyceride solid medium chooses the bacterial strain that periphery of bacterial colonies has obvious transparent circle after 48h, is inoculated in 5mL liquid LB culture again In base, 28 DEG C, 150rpm concussion fermentation 48h;
4) it takes 1mL fermentation liquid after 10000rpm is centrifuged 1min, by supernatant liquid filtering, takes filtrate in three butyric acid having openning hole In the hole of glyceride solid medium, the diameter of foundation transparent circle, screening obtain one plant of yielding lipase after 28 DEG C of culture 48h Dominant strain PC1.
The beef-protein medium are as follows: beef extract 3g/L, NaCl 5g/L, peptone 10g/L, pH 7.4~ 7.6。
The tributyrin solid medium are as follows: peptone 10g/L, yeast extract 5g/L, NaCl 5g/L, fine jade Rouge 18g/L, pH 8.0, tributyrin emulsion 2%, the tributyrin emulsion: tributyrin with 4% gum arabic solution volume ratio 1:3 aseptically emulsifies at least 5min.
The bacterial strain PC1 that the method for the present invention obtains can secrete yielding lipase, which has tolerance to a variety of organic solvents, Middle methanol and acetone are obviously promoted effect, optimal pH 8.0 to the enzyme, and have the pH stability of wide spectrum;Optimum temperature It is 35 DEG C, but non-refractory, is inactivated substantially at 50 DEG C;There is nearest affiliation with bacillus pumilus L5 lipase.
Beneficial effects of the present invention are the isolated endophyte in Chinese pistache seed for the first time, by wherein yielding lipase Bacterial strain carry out breeding, obtain a dominant strain PC1, provide technical support for its zymology Quality Research.
Detailed description of the invention
Fig. 1 is the Gram's staining figure of bacterial strain PC1 of the present invention;
Fig. 2 is the phylogenetic analysis of the 16S rDNA sequence of bacterial strain PC1 of the present invention;
Fig. 3 is the optimal pH and pH stability of bacterial strain PC1 institute of the present invention yielding lipase;
Fig. 4 is the optimum temperature and thermo qualitative of bacterial strain PC1 institute of the present invention yielding lipase;
Fig. 5 is surfactant on the active influence of bacterial strain PC1 institute yielding lipase of the present invention;
Fig. 6 is organic solvent on the active influence of bacterial strain PC1 institute yielding lipase of the present invention;
Fig. 7 is the nucleotide of bacterial strain PC1 lipase of the present invention and the amino acid sequence of supposition;
Specific embodiment
Technical solution of the present invention is further described below with reference to embodiment, it is as described below, it is only to of the invention Preferred embodiment not limits the present invention, any person skilled in the art possibly also with The technology contents of the disclosure above are changed or are modified as the equivalent embodiment changed on an equal basis.It is all without departing from the present invention program Hold, according to the technical essence of the invention any simple modification, equivalent change and modification made to the above embodiment, all falls within this In the protection scope of invention.
Embodiment 1
A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method, are completed especially by following steps:
1) the Chinese pistache fruit for choosing fresh and healthy, after the hard pericarp of physical removal, selects intact Seed impregnates 10min in 75% alcohol of at least 20 times volumes, and 10min is impregnated in 0.1% mercury chloride, and centre is shaken frequently, Then it uses sterile water wash 5 times, each 1min;
2) 5 pieces of sterilized Chinese pistache seeds are put into sterile mortar, 500 μ L sterile waters is added and are ground into paste, so Afterwards be added sterile water be diluted to 5mL, take 100 μ L dilutions be inoculated in beef-protein medium (beef extract 3g, NaCl 5g, Peptone 10g, water 1L, PH 7.4~7.6) on, while the sterile water for taking last time to clean and the seed not ground are as negative Control, is cultivated 3~7 days under the conditions of 28 DEG C, obtains endogenetic bacteria, 4 DEG C of punctures save plate streaking after purification;Test repeats 3 It is secondary, 3 parallel groups are set every time;
3) by the strain inoculated of acquisition in 5mL liquid LB, 28 DEG C, 150rpm overnight incubation takes 2 μ L bacterium solutions o'clock in three butyric acid The bacterial strain that periphery of bacterial colonies has obvious transparent circle is chosen on glyceride solid medium, after 48h, is inoculated in 5mL liquid LB training again It supports in base, 28 DEG C, 150rpm concussion fermentation 48h;
4) it takes 1mL fermentation liquid after 10000rpm is centrifuged 1min, supernatant is filtered with sterilised membrane filter, take filtrate in accomplishing fluently In the hole of the tributyrin solid medium in hole, the diameter of foundation transparent circle, screening obtain one after 28 DEG C of culture 48h The dominant strain of strain yielding lipase, is temporarily named as PC1.
The PC1 bacterial strain flat board of acquisition crosses to obtain single colonie, white in appearance, early growth period show to moisten it is smooth, then There is fold and dries out in edge;Gram's staining is positive, and it is (Fig. 1) in the shape of a rod to observe thallus under an electron microscope.
The PC1 bacterial strain has carried out preservation, depositary institution: China typical culture collection center, address: Wuhan City, Hubei Province Hongshan District Bayi Road, Wuhan University, China typical culture collection center;Preservation date: on October 9th, 2014;Deposit number are as follows: CCTCC M 2014461。
The 16S rDNA of PC1 bacterial strain is obtained by carrying out PCR amplification using bacterial 16 S rDNA universal primer and being sequenced Partial nucleotide sequence, the 16S rDNA sequence evolution network analysis by Clustalw and MEGA5.1 software to PC1 bacterial strain (Fig. 2) shows that it has nearest affiliation with Bacillus pumilus S7, shows the Pseudomonas in bacillus pumilus Bacillus pumilus, therefore the bacterium is named as Bacillus pumilus PC1.
Embodiment 2 measures the zymologic property of PC1 institute yielding lipase using para-nitrophenol method
1. measuring lipase activity using para-nitrophenol method
Solution A [30mg p-nitrophenyl palmitate (p-NPP) is dissolved in 10mL isopropanol] and solution B are prepared respectively [50mmol/L Tris-HCl(pH 8.0)].Solution A and B are mixed in 1:18 ratio and take 1.9mL in test tube, in addition 1mL 10% is added after 28 DEG C of accurate response 10min in clear crude enzyme liquid 0.1mL (setting the crude enzyme liquid of high-temperature inactivation as negative control) SDS solution terminate reaction.The absorption value for the paranitrophenol (pNP) that measurement catalysis generates under spectrophotometer OD410nm.
1 enzyme-activity unit definition of lipase: under the conditions of pH8.0,28 DEG C, discharged needed for 1 μm of ol pNP per minute Enzyme amount, enzyme activity calculation formula:
A=([Al- A0]×K+C0)×Vl×n/(V2×t)
In formula, A: sample enzyme activity (U/mL);A1: the absorbance OD value of sample enzyme solution;A0: the blank absorbency of corresponding enzyme solution OD value;K: the slope of paranitrophenol standard curve;C0: the intercept of paranitrophenol standard curve;N: extension rate;Vl: reaction solution Volume/mL;V2: volume/mL of enzyme solution;T: reaction time/min.
2. the zymologic property of lipase
The PC1 bacterium solution being incubated overnight is seeded in 50mL LB liquid medium by 1% inoculum concentration, 150rpm fermentation 48h. Fermentation liquid is centrifuged 15min through 5000rpm, the optimal pH of enzyme is surveyed after taking supernatant to react 10min under different pH environment, is allowed Crude enzyme liquid is mixed from the buffer of isometric different pH, is placed for 4 DEG C and is surveyed remaining enzyme activity afterwards for 24 hours, determines the pH stability of enzyme.It will Crude enzyme liquid reacts the optimum temperature of survey enzyme after 10min at different temperature;Crude enzyme liquid is allowed to place at different temperature Remaining enzyme activity is surveyed after 1h, determines the temperature stability of enzyme.By crude enzyme liquid and isometric different surfaces activating agent or organic solvent It mixes, 28 DEG C, 150rpm detects remaining enzyme activity after shaking 30min.
The result shows that showing this by the zymologic property for measuring PC1 bacterial strain institute yielding lipase using para-nitrophenol method The optimal pH of PC1 bacterial strain institute yielding lipase is 8.0 and has the pH stability (Fig. 3) of wide spectrum;Optimum temperature is 35 DEG C, but not High temperature resistant inactivates (Fig. 4) at 50 DEG C substantially.Surfactant significantly inhibits the enzymatic activity (Fig. 5).The enzyme is to a variety of organic molten Agent has tolerance, and wherein methanol and acetone are obviously promoted effect (Fig. 6) to the enzyme.
The clone of embodiment 3PC1 lipase gene
Pass through the nucleotide sequence to the part bacillus pumilus lipase announced in NCBI GenBank database Multiple sequence alignments analysis is carried out using Clustalw software, determines the section of strict conservation for designing amplification lipase gene Forward and reverse primer (P of overall length1: TAG AGTCGTATAAGATGAATAAGG and P2: TTAATTCGTATTCTGTCCT CCG).PCR Amplification system (50 μ L):Buffer 10μL、d NTP Mixture(2.5mM each)4μL、(2.5U/ μ L) 0.5 μ L, ddH2032.5 μ L, primer P1And P2(10 μM) each 1 μ L, PC1 genomic DNA 1μL.PCR reaction condition: 94 DEG C of initial denaturation 4min;95 DEG C of denaturation 20s, 58 DEG C of annealing 30s, 72 DEG C of extension 1min, totally 30 are followed Ring;72 DEG C of extension 5min.Amplified production is sent to company's sequencing.
The result shows that: the nucleotide full length sequence of PC1 lipase is obtained by homologous clone, as shown in SEQ ID NO.1, The bacillus pumilus PC1 lipase that the present invention identifies and the short and small gemma that NCBI is announced are further demonstrated that through phylogenetic analysis Bacillus L5Lipase has nearest affiliation (Fig. 7), but sequence is still had any different.

Claims (3)

1. a kind of Chinese pistache seed yielding lipase endophyte PC1, it is characterised in that: the bacterial strain is in preservation on October 9 in 2014 In China typical culture collection center, deposit number are as follows: CCTCC M 201446.
2. Chinese pistache seed yielding lipase endophyte PC1 according to claim 1, it is characterised in that: the Chinese pistache The nucleotide full length sequence of seed yielding lipase endophyte PC1 lipase is as shown in SEQ ID NO.1.
3. Chinese pistache seed yielding lipase endophyte PC1 according to claim 1, it is characterised in that: the PC1 bacterial strain Plate streaking obtains single colonie, white in appearance, and early growth period shows to moisten smooth, fold occurs with back edge and dries out;Leather Blue Albert'stain Albert is positive, and it is in the shape of a rod to observe thallus under an electron microscope.
CN201410696261.1A 2014-11-26 2014-11-26 A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method Expired - Fee Related CN104388353B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410696261.1A CN104388353B (en) 2014-11-26 2014-11-26 A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410696261.1A CN104388353B (en) 2014-11-26 2014-11-26 A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method

Publications (2)

Publication Number Publication Date
CN104388353A CN104388353A (en) 2015-03-04
CN104388353B true CN104388353B (en) 2019-06-21

Family

ID=52606314

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410696261.1A Expired - Fee Related CN104388353B (en) 2014-11-26 2014-11-26 A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method

Country Status (1)

Country Link
CN (1) CN104388353B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112795513A (en) * 2021-02-03 2021-05-14 南京翠京元生物科技有限公司 Enrichment and separation method for endophyte

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275898A (en) * 2013-05-28 2013-09-04 安徽师范大学 Lipase high-producing strain, screening method thereof and method for producing lipase by using strain through fermentation

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103275898A (en) * 2013-05-28 2013-09-04 安徽师范大学 Lipase high-producing strain, screening method thereof and method for producing lipase by using strain through fermentation

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
利用克雷伯氏菌B-36生产耐高温酸性脂肪酶发酵条件的优化;张开平等;《河南工业大学学报(自然科学版)》;20131231;第34卷(第6期);第60-64页 *
短小芽孢杆菌脂肪酶基因的克隆、表达及酶学性质研究;苏二正等;《生物技术通报》;20140605;第2014卷(第4期);第132-138页 *

Also Published As

Publication number Publication date
CN104388353A (en) 2015-03-04

Similar Documents

Publication Publication Date Title
Parte et al. Biotechnological applications of marine enzymes from algae, bacteria, fungi, and sponges
Xie et al. Implications of endophytic microbiota in Camellia sinensis: a review on current understanding and future insights
Alves-Prado et al. Screening and production study of microbial xylanase producers from Brazilian Cerrado
Bhagobaty et al. Enzymatic activity of fungi endophytic on five medicinal plant species of the pristine sacred forests of Meghalaya, India
CN103667117A (en) Compound microbial bacterium for aerobic fermentation stage
CN103361294B (en) The actinomycetes that anti-epidemic disease is mould and application thereof
CN107365728A (en) One plant degraded PAEs endophyte of plant and the application in PAEs contaminated soils are repaired
CN105838642B (en) A kind of actinomyces of cure plant disease of peanut and its application
CN105950495A (en) Bacillus methyltrophicus and application thereof in livestock and poultry breeding wastewater treatment
Zhang et al. Exophiala macquariensis sp. nov., a cold adapted black yeast species recovered from a hydrocarbon contaminated sub-Antarctic soil
CN108913604A (en) A kind of screening technique of the effectively hydrolyzing bacterial strain of spirit distiller grain
CN109097302A (en) A kind of bacillus is promoting the application in plant growth
Zhou et al. The Effect of Salt‐Tolerant Antagonistic Bacteria CZ‐6 on the Rhizosphere Microbial Community of Winter Jujube (Ziziphus jujuba Mill.“Dongzao”) in Saline‐Alkali Land
CN105925498B (en) One pseudomonas category bacterial strain ST4 and its application in prevention and treatment sugarcane whip smut
CN101139564A (en) Duganella bacterium and uses thereof
CN104560817B (en) Thermophilic bacillus licheniformis UTM102 for producing phytase and application of thermophilic bacillus licheniformis UTM102
CN103937731A (en) Separation, extraction and verification method of air-dried sludge beneficial microorganism components
CN103173386A (en) Bio-control strain G1 for preventing and controlling pepper phytophthora blights and applications thereof
CN104388353B (en) A kind of Chinese pistache seed yielding lipase endophyte PC1 and its separation method
CN105820958B (en) One plant of gentamicin degradative fungi and its application
CN102604841B (en) Trichoderma LJ245 capable of degrading aureomycin
CN104860401A (en) Application of Rhizopus oryzae strain JHSW01 to the fermentation of organic waste liquid and forestry and agricultural waste
CN101503658A (en) Method for separating endogenetic fungi producing spherosin
CN104109638B (en) The method that one Rhodotorula mucilaginose strain strain ZZR-1# and this bacterial strain produce at
Mishra et al. Psychrotolerant microbes: characterization, conservation, strain improvements, mass production, and commercialization

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Huang Yong

Inventor after: Chen Donghong

Inventor after: Song Chunzhu

Inventor after: Ruan Ying

Inventor after: Liu Chunlin

Inventor before: Chen Donghong

Inventor before: Song Chunzhu

Inventor before: Ruan Ying

Inventor before: Huang Yong

Inventor before: Liu Chunlin

GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20190621

Termination date: 20191126