CN104372003A - Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker - Google Patents
Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker Download PDFInfo
- Publication number
- CN104372003A CN104372003A CN201410580713.XA CN201410580713A CN104372003A CN 104372003 A CN104372003 A CN 104372003A CN 201410580713 A CN201410580713 A CN 201410580713A CN 104372003 A CN104372003 A CN 104372003A
- Authority
- CN
- China
- Prior art keywords
- wheat
- fringe
- plant height
- strain
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a molecular marker closely linked with the major QTL of wheat height and uppermost internode length as well as an acquisition method and application of the molecular marker. The acquisition method comprises the following steps: carrying out PCR amplification on DNA of a wheat variety Kenong9204 by adopting a marked primer Xcnl10; carrying out electrophoretic separation on the amplified product on 6.0% native polyacrylamide gel to obtain the amplified product with molecular weight of 700bp, namely the molecular marker of major QTL of wheat height and uppermost internode length. The molecular marker can be used for detecting whether a wheat variety or line contains QTL capable of reducing plant height and uppermost internode length, or not, so that the wheat variety or line containing QTL capable of reducing the plant height and uppermost internode length can be quickly screened for breeding, and the breeding progress for excellent wheat plant variety can be greatly accelerated.
Description
Technical field
The present invention relates to wheat molecular biotechnology and Breeding Application field, specifically a kind of molecule marker with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe and acquisition methods thereof and application.
Background technology
plant Height in Wheat and lodging resistance closely related, be the important character affecting improving yield of wheat, stable yields, reducing plant height and improving lodging property is the important goal of Yield Potential Breeding of Wheat always.By polygene or minority key-gene, the plant height of wheat adds that a series of minor gene or modifying factor control, show as typical Inheritance of Quantitative Characters feature.The existing genetic mechanism of many Chinese scholars to Plant Height in Wheat is studied, and many plant height QTL of locating are almost throughout 21 karyomit(e)s of wheat.From the first in the world time " Green Revolution " (Khush that Borlaug doctor NE of the International Maize and Wheat Improvement Centers sixties in 20th century (CIMMYT) initiates, Nature Reviews Genetics. 2:815 – 822,2001), since " No. 10, agricultural " dwarf gene is used to wheat breeding, the research of dwarf gene is paid attention to by increasing breeding expert.Although the dwarf gene named at present has 25 more than, carry the dwarf gene from No. 10, agricultural and duckbill wheat in Wheat Production up to the of short stem and Semi-dwarf cultivar of more than 90%, the hereditary basis that the simplification in short source result in Bred Wheat Varieties is narrow.Therefore, constantly create and find new short source, enrich the diversity of dwarf gene, and pass through molecular marking technique, the gene that under research and development Plant Height in Wheat and fringe, internode is long, under reducing Plant Height in Wheat and fringe, internode is long, is extremely important in breeding work.
So far, being positioned the chromosomal Dwarfing gene named of 4B is Rht-B1b, is positioned at (McVittie et al., Heredity. 40:67 – 70,1978) on 4B the short arm of a chromosome; Analyzed by quantitative character gene locus therefor (Quantitative trait locus, QTL), utilize multiple mapping population plant height QTL site (McCartney et al., Genome, 48:870 – 883,2005 to be detected at 4BS; Marza et al., Theoretical and Applied Genetics. 112:688 – 698,2006; Zhang et al., Journal of Genetics and Genomics. 35:119 – 127,2008; Mao et al., Euphytica. 174:343 – 356,2010; Cui et al., Theoretical and Applied Genetics. 122:1517 – 1536,2011).At present, the relevant report of being positioned at of having named internode long closely linked molecule marker under 4BL Dwarfing gene and fringe is not yet had.
Summary of the invention
Object of the present invention is just to provide a kind of molecule marker with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe and acquisition methods thereof and application, by obtain with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe, detect in wheat breed or strain whether to have and reduce the long QTL of internode under plant height and fringe, to accelerate the seed selection process of Distinctive Wheat plant type kind.
The object of the invention is to be achieved through the following technical solutions:
With a molecule marker for the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe, this molecule marker is
xcnl10, molecule marker described in it
xcnl10upstream primer sequence: CTTACCTAGTACAATGTACTCTCTCT(is as described in SEQ ID NO:1), downstream primer sequence: ATGATGGTCTGGATCTGG(is as described in SEQ ID NO:2).
Described molecule marker
xcnl10acquisition methods, comprise the following steps: adopt
xcnl10labeled primer,
Upstream primer sequence: CTTACCTAGTACAATGTACTCTCTCT(is as described in SEQ ID NO:1),
Downstream primer sequence: ATGATGGTCTGGATCTGG(is as described in SEQ ID NO:2),
Carry out pcr amplification to the DNA of wheat breed section agriculture 9204, its PCR amplification system is 20 μ l, comprising: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, the ddH of 7 μ l
2o; Adopt the amplification of gradient touchdown PCR amplification program, step is as follows:
(1) 94 DEG C of sex change 4 min,
The renaturation temperature fall program of (2) 15 circulations, each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, and 72 DEG C extend 55 s;
The regular-PCR program of (3) 30 circulations: 94oC sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s;
(4) 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of preservations;
Amplified production is voltage stabilizing 120 V electrophoretic separation on the non-denaturing polyacrylamide gel of 6%, argentation, and the molecular weight obtaining corresponding amplified production is 700bp, is the molecule marker with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe.
The DNA obtained after the DNA of wheat breed section of the present invention agriculture 9204 refers to wheat section agriculture 9204 plant leaf separation and Extraction.
Utilize above-mentioned molecule marker
xcnl10detect the method for wheat breed or strain, comprise the following steps:
A. use
xcnl10the DNA of labeled primer to wheat breed to be measured or strain carries out pcr amplification, and its PCR amplification system is 20 μ l, comprises: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, and the ddH2O of 7 μ l; Adopt the amplification of gradient touchdown PCR amplification program: 94 DEG C of sex change 4 min; The renaturation temperature fall program of 15 circulations, each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, and 72 DEG C extend 55 s; The regular-PCR program of 30 circulations: 94oC sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s; 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of preservations;
B. by above-mentioned amplified production on the non-denaturing polyacrylamide gel of 6% after voltage stabilizing 120 V electrophoretic separation, if obtaining the molecular weight of amplified production is the amplified fragments of 700bp, then this wheat breed or product are on this gene locus, have the wheat breed or strain that reduce the long gene of internode under plant height and fringe; Otherwise it is do not have the wheat breed or strain that reduce the long gene of internode under plant height and fringe that this wheat breed or strain belong in this site.
Described wheat breed to be detected or strain can be wheat section agriculture 9204 is parent, by adopting conventional hybridization and multiplying seed selection to F2 for above section's agriculture 9204 wheat derived varieties or strain, also can be other arbitrarily small wheat variety or strains.
The DNA of wheat breed described in detection method or strain refers to the DNA will obtained after wheat plant blade separation and Extraction.
The non-denaturing polyacrylamide gel of 6% described in the present invention refers in 100ml polyacrylamide gel solution containing 5.85 g acrylamides and 0.15 g methene acrylamide.
In the present invention, 2 × Taq PCR StarMix is the high purity Taq archaeal dna polymerase containing optimization concentration, dNTPs, Mg of premix
2+, the composition such as reaction buffer and stablizer the PCR solution of instant 2 times of concentration, this product brand is GenStar, by commercial goods, Kang Run Cheng Ye bio tech ltd, Beijing.
Wheat breed capital 411 of the present invention is Approved variety, in 1991 by Beijing's variety certification; 1992 by Tianjin, Shanxi Province and national variety certification; Capital 411 can be asked for from national Germplasm Resources of Farm Crop storehouse, and national Unified number is ZM020984; Section's agriculture 9204 is Approved variety, passes through Hebei province crop varietal approval committee in 2002; Within 2003, by national variety certification, variety certification is numbered state and examines wheat 2003037.
The long closely linked molecule marker of internode under Plant Height in Wheat disclosed by the invention and fringe
xcnl10fully demonstrate the long main effect QTL of internode under the plant height of wheat breed or strain and fringe, by molecule marker to wheat breed or strain pcr amplification, whether can have to wheat breed or strain the QTL that internode is long under plant height and fringe quickly to judge, thus the wheat breed or strain that have and reduce the long QTL of internode under plant height and fringe can be filtered out, accelerate the seed selection process of wheat breed.
Wheat breeding is used for the long closely linked molecule marking method of internode under Plant Height in Wheat and fringe by provided by the invention, only need detect the amplified band characteristic of these marks, can judge that whether the synergy variation of plant height major gene loci exists, predict the plant height phenotype of wheat, be used to guide the breeding work of Plant Height in Wheat improvement, not only screen fast accurate, not affected by environment, select target is clear and definite, and saved production cost, substantially increase efficiency of selection and the quality of wheat breed or strain, directly achieve the qualification of target gene in Wheat Germplasm Resources and breeding progeny, for the more short bar genetic resourcess newly of wheat plant types breeding developing.
Accompanying drawing explanation
Fig. 1 is that under the plant height of wheat breed section agriculture 9204 and fringe, the mapping of the long main effect QTL of internode on karyomit(e) 4BL is interval; In figure: hollow rectangle represents karyomit(e), its upper end dash area represents centromere position, and right side is the title of molecule marker, and left side numeral is the position marked on chromosome, and unit is cM; Have six kinds of molecule markers in figure, Leaftype is morphological markers, and Xme is SRAPs mark, and wPt is DArTs mark, Xwmc and Xbarc is g-SSR mark, Xcnl and Xcfe is e-SSR mark, and Xmag is STS mark, indicates being labeled as of black underscore
xcnl10; Under the rectangle of karyomit(e) lower right black and grey represents plant height and fringe respectively, the QTL mapping of internode length under each environment is interval, and wherein Ph represents plant height, and under Pl represents fringe, internode is long.
Fig. 2 is the labeled primer with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe in section's agriculture 9204
xcnl10and with the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087result statistical graph is transmitted in the heredity of 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being).
The F of Fig. 3 to be wheat breed section agriculture 9204 be parent
641 derivative strains for RIL colony are used
xcnl10labeled primer carries out the electrophoretic band figure of pcr amplification.
Embodiment
Embodiment is for further describing the present invention below, but does not limit the present invention in any form.
Embodiment 1
With the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe,
Adopt labeled primer
xcnl10,
Upstream primer sequence: CTTACCTAGTACAATGTACTCTCTCT(is as described in SEQ ID NO:1),
Downstream primer sequence: ATGATGGTCTGGATCTGG(is as described in SEQ ID NO:2);
Carry out pcr amplification to the DNA of wheat breed section agriculture 9204, its PCR amplification system is 20 μ l, comprising: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, the ddH of 7 μ l
2o; Adopt gradient touchdown PCR amplification program, step is as follows: first 94 DEG C of sex change 4 min, and next carries out the renaturation temperature fall program of 15 circulations, each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, 72 DEG C extend 55 s; Again carry out the regular-PCR program of 30 circulations, that is: 94oC sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s; Last 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of Refrigerator stores; By amplified production voltage stabilizing 120 V electrophoretic separation on the non-denaturing polyacrylamide gel of 6%, argentation, the molecular weight obtaining corresponding amplified production is 700bp.
The model that PCR program adopts is: TaKaRa PCR Thermal Cycler, pcr amplifications all in the present invention all adopts this model PCR instrument, and this PCR instrument does not limit summary of the invention.
Screening method with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe provided by the invention, specifically comprises the following steps:
(i) be female parent with the long shorter wheat breed section agriculture 9204 of internode under semi-short-stalked, fringe, carry out hybridization with the wheat breed capital 411 that internode under high bar, fringe is longer for male parent and obtain Hybrids F1, the F2 that F1 selfing produces, adopts the F6 of single seed descent acquisition containing 188 familys for RIL colony;
(ii) use improved method of CTAB, namely cetyl trimethylammonium bromide method (the Vander Beek et al. improved, 1992) DNA of each strain of above-mentioned RIL colony is extracted, adopt diversity microarray technology (DArTs mark), simple sequence repeats mark (SSR marker), based on the simple sequence repeat marker (EST-SSR mark) of expressed sequence tag, based on expressed sequence tag pcr amplification mark (STS mark), between simple repeated sequence, amplification label (ISSR mark) and SRAP mark (SRAP mark) carry out gene type assay to described family, obtain the genotype value material of described RIL colony, DArTs labeled analysis is the method being distinguished polymorphism between different genes group by the technology of chip hybridization, by the digestion with restriction enzyme of each strain genomic dna through two kinds of different cutting frequencies, the joint of the lower restriction endonuclease recognition sequence of recycling cutting frequency is connected with endonuclease bamhi, then by realizing to this specific fragment pcr amplification with this enzyme cut-grafting corresponding primer.Amplicon is used for building clone library, and then by it through fluorescent mark, puts on chip as probe after sex change.The target dna detected also needs, through the cutting of same restriction endonuclease and pcr amplification, by it and through fluorescently-labeled target sequence probe hybridization after allowing, to obtain the genotype value data of described RIL colony;
The step that improved method of CTAB extracts leaf DNA comprises: the fresh blade getting about 0.2g puts into 2.0ml centrifuge tube, adds about 10 s in liquid nitrogen fast, wears into fine powder fast; Add CTAB extracting solution 0.6ml, shake up, 65 DEG C of water-bath 30min; The centrifugal 10min of 12000rpm, gets supernatant, moves to another pipe; Add isopyknic chloroform/primary isoamyl alcohol, mixing 10min; The centrifugal 10min of 12000rpm, gets supernatant (not inhaling egg white layer), moves to another pipe; Add isopyknic chloroform/primary isoamyl alcohol, mixing 10min; The centrifugal 10min of 1200rpm, gets supernatant (not inhaling egg white layer), moves to the centrifugal 10min of another pipe 1200rpm, gets supernatant (not inhaling egg white layer), moves to another pipe; Add 1/10V 3M NaAc (Ph=5.2), mixing, adds the dehydrated alcohol of 2 times of volumes, shakes up gently, and white flock precipitate produces, and puts-20 DEG C of refrigerators about 20 min, increases DNA output; The centrifugal 6min of 8000 rpm, pours out supernatant liquor; Precipitation is used 70% ethanol wash, pour out 70% alcohol, air-dry; To alcohol-free taste, add 100ul TE and dissolve, put-20 DEG C of refrigerators and preserve for a long time;
(iii) utilize MAPMAKER 3.0 mapping software, the RIL colony genotype data of acquisition is built the wheat molecular marker genetic linkage maps with 591 marker sites, with LOD >=2.5 for standard; 287 DArTs marks, 178 g-SSR marks, 50 e-SSR marks, 17 STS marks, 45 SRAPs marks, 5 ISSRs marks, 7 functional PCR marks and 2 morphological markers are comprised in 591 marks;
(iv) 2 years field planting of totally 8 testing circumstances and phenotypic evaluation RIL colony have been carried out, investigate different year respectively, under the plant height of each strain under different location and Different nitrogen levels treatment condition and fringe, internode is long, wherein 8 environment namely: 2011 – 2012, continuous 2 years of 2012 – 2013 are at agroecosystem testing station, Luancheng of the Chinese Academy of Sciences (T1 and T2:37 ° of 53 ' N, 114 ° of 41 ' E), 2012 – 2013 are setting in Inst. of Genetics and Development Biology, CAS Beijing farm, mansion (T3:40 ° of 06 ' N, 116 ° of 24 ' E) and test base, industry research institute Huixian, Xinxiang City, Henan Province (T4:35 ° of 27 ' N, 113 ° of 48 ' E) plantation, every testing circumstance divides high nitrogen (High nitrogen, and low nitrogen (Low nitrogen HN), LN) two process.
Wherein LN process, the whole year does not apply fertilizer; And HN process, execute 300 kghm-2 phosphoric acid diamines and 225 kghm-2 urea before annual sowing as base fertilizer, the jointing stage executes 150 kghm-2 urea and topdresses;
Wherein wheat planting method: 2 row are planted by each system, often row broadcasts 40; Row long 3m, spacing in the rows 7.5 cm, line-spacing 25 cm, normal growth and results; Plant height measuring method: each strain Stochastic choice 5 after results, measures end portion on the ground and, to the length (not comprising awn length) on top, fringe portion, gets each family plant height of its mean value calculation; Internode long (Peduncle length, PL, cm) under fringe: each strain Stochastic choice 5 after results, measure length long between the first segment of fringe bottom, under getting its mean value calculation each family fringe, internode is long;
(v) utilize MAPMAKER/EXP 3.0 software (Lander et al., 1987) to build linkage map.The long phenotypic number of internode under the plant height obtain direct surveys in 8 single environments and fringe, after requiring to arrange, carries out additivity QTL location according to the BIP block format of IciMapping v3.3.Be that stepping is interval with 1cM, carry out 1000 permutation tests, determine LOD threshold value;
(vi) can be obtained by qtl analysis, karyomit(e) 4BL detects the long QTL of internode respectively under the fringe of stably express under the plant height QTL of stably express under 8 environment and 5 environment, and its fiducial interval is
xmag4087 – wPt-1046, as shown in figure 1 and table 1;
The qtl analysis result that under table 1 plant height and fringe, internode is long
As shown in Table 1, these 13 QTL peak values all exist
xcnl10near, wherein Hebei (the high and low nitrogen of 2011 – 2012, the high and low nitrogen of 2012 – 2013), Beijing (the low nitrogen of 2012 – 2013), the high and low nitrogen of Henan 2012 – 2013) amount to plant height QTL peak value distance under 7 environment
xcnl10distance be only 0.20 cM; Internode long QTL peak value distance under fringe under plant height QTL peak value under Beijing (the high nitrogen of 2012 – 2013) environment and Hebei (the high nitrogen of 2012 – 2013) environment
xcnl10distance be 0.80 cM; Internode long QTL peak value distance under fringe under Hebei (the high nitrogen of 2011 – 2012), Hebei (the low nitrogen of 2012 – 2013), Henan (the high nitrogen of 2012 – 2013) and Henan (the low nitrogen of 2012 – 2013) environment
xcnl10distance be respectively 9.20 cM, 6.20 cM, 6.20 cM and 8.20 cM.The contribution rate of these 13 QTL is up to 30.91%, and minimum is 9.33%, and all QTL additive effect values are negative value.?
xmag4087 – wPt-1046in interval, in 8 environment, detect plant height QTL, and the average contribution rate of QTL is 23.10%; Under 5 environment, detect the long QTL of internode under fringe, average contribution rate is 14.80%.Illustrate
xmag4087 – wPt-1046that detect in interval is the QTL of long chain stable, the main effect with internode under Plant Height in Wheat and fringe, its labeled primer
xcnl10the amplified production molecular weight obtained in the DNA of wheat breed section agriculture 9204 is 700bp, is the molecule marker chain with the long QTL of internode under Plant Height in Wheat and fringe.
Embodiment 2
Molecule marker with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe provided by the invention is the application in 574 semi-dwarf mutant derived varietiess (being) of parent in wheat line section agriculture 9204.
574 section's agriculture 9204 semi-dwarf mutants derived varieties (being) are utilized to carry out the molecule marker application verification research of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe.Its concrete steps are as follows:
(1) 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being) are carried out field planting, the blade getting the plant of each strain adopts the CTAB method of described improvement to carry out the DNA of separation and Extraction acquisition;
574 described section's agriculture 9204 semi-dwarf mutants derived varieties (being) and pedigree thereof in table 2, by with section's agriculture 9204 for parent, by adopt conventional hybridization procreation to F
2more than generation, the new variety of wheat then obtained by being choosing in conjunction with plant height and yield traits general performance or strain;
Table 2 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being) and genealogical table thereof
(2) labeled primer with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe is adopted
xcnl10and with the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087the DNA of acquisition is carried out pcr amplification, and its PCR amplification system is: the DNA profiling of 1 μ l, the forward primer of 1 μ l, the reverse primer of 1 μ l, 10 μ l 2 ×
taqpCR StarMix, the ddH of 7 μ l
2o; Amplification condition is gradient touchdown PCR: 94 DEG C of sex change 4 min, the renaturation temperature fall program of then 15 circulations, each circulation 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s (–, 1 DEG C/circulation) and 72 DEG C of extension 55 s; Last 30 circulation regular-PCR programs namely: 94 DEG C of sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s; Last 72 DEG C extend 5 min; Amplification terminates rear 15 DEG C of preservations; Amplified production is voltage stabilizing 120 V electrophoretic separation on the non-denaturing polyacrylamide gel of 6%, and argentation detects its amplified fragments size;
(3) with the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087sequence in table 3, it amplifies the DNA fragmentation of 195bp and 530bp respectively in section's agriculture 9204;
Table 3 and the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087dNA sequence dna and expansion fragments molecules amount
(4) detected result is analyzed,
xcnl10amplified production molecular weight be that the molecule marker of 700bp occurs, the kind that namely amplified production is consistent with the amplified production of section agriculture 9204 or product are have the derivative strain that internode under semi-dwarf mutant, shorter fringe grows;
xmag2055,
xmag4087amplified production molecular weight be respectively 195bp and 530bp molecule marker occur, show that section's agriculture 9204 derives the genetic material of descendant inheritting section agriculture 9204.
Concrete outcome is as follows: adopt the labeled primer with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe
xcnl10and with the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087carry out pcr amplification to the DNA of 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being), the amplified fragments of the section's agriculture 9204 correspondence transmission result in its derivative offspring as shown in Figure 2.
As can be seen from Figure 2, with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe
xcnl10all identical with section agriculture 9204 at the amplification banding pattern of 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being), the plant height semi-dwarf mutant proterties corresponding with it is completely corresponding; With the not closely linked labeled primer of the long main effect QTL of internode under Plant Height in Wheat and fringe
xmag2055,
xmag4087showing
xcnl10have 52.8% and 55.9% identical with section agriculture 9204 respectively at the amplification banding pattern of 574 section's agriculture 9204 semi-dwarf mutants derived varieties (being), the plant height semi-dwarf mutant proterties corresponding with it is not exclusively corresponding; The above results proves molecule marker
xcnl10for closely linked molecule marker long with internode under Plant Height in Wheat and fringe, this molecule marker can very effectively among the wheat plant types molecular marker assisted selection procedure of breeding.
Embodiment 3
The major gene loci closely linked molecule marker long with internode under Plant Height in Wheat and fringe provided by the invention
xcnl10be the F of parent in wheat breed section agriculture 9204
6for the application in 41 derivative strains of RIL colony and section's agriculture 9204 and capital 411.
With section's agriculture 9204 for male parent preparation combination is done in maternal, capital 411, construct F7 recombinant inbred lines (RIL colony) by single seed descent (SSD method).Use labeled primer
xcnl10capital 411, section's agriculture 9204 and 41 derivative strains are analyzed.Its concrete steps are as follows:
(1) wheat breed section agriculture 9204, capital 411 and 41 derivative strains are carried out field planting, the plant leaf getting each strain adopts described SDS method to carry out separation and Extraction DNA; Wherein the derivative strain of section's agriculture 9204 refers to: make female parent with section's agriculture 9204, and male parent is made in capital 411, the strain obtained by single seed descent;
(2) adopt
xcnl10upstream primer (as described in SEQ ID NO:1) and downstream primer (as described in SEQ ID NO:1) DNA of acquisition is carried out pcr amplification, pcr amplification is carried out to the DNA of wheat breed section agriculture 9204, its PCR amplification system is 20 μ l, comprise: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, the ddH of 7 μ l
2o; Adopt the amplification of gradient touchdown PCR amplification program: first 94 DEG C of sex change 4 min, next carries out the renaturation temperature fall program of 15 circulations, and each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, 72 DEG C extend 55 s; Again carry out the regular-PCR program of 30 circulations, that is: 94oC sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s; Last 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of Refrigerator stores; By amplified production voltage stabilizing 120 V electrophoretic separation on the non-denaturing polyacrylamide gel of 6%, argentation detects;
(3) detected result is analyzed, as
xcnl10occur in the amplified production that labeled primer obtains that molecular size range is the band of 700 bp, the product that namely amplified production is all consistent with the amplified production of section agriculture 9204 are have the strain reducing the long gene locus of internode under plant height and fringe.
As shown in Figure 3, in Fig. 3, swimming lane 1-44 is respectively capital 411(J to result), section agriculture 9204(KN), DNA Marker(M) and 41 derivative strain 1-41 of section's agriculture 9204.Wherein, the derivative strain for carrying the long gene locus of internode under described reduction plant height and fringe that banding pattern is identical with section agriculture 9204 banding pattern, i.e. derivative strain 1,6,10,11,12,13,14,18,22,27,30,32,34,37,38 and 41, these derivative strains are the strains that can be used for the excellent strain type high-yield breeding of next step short bar; And the electrophoretic separation banding pattern of capital 411 and derivative strain 2,3,4,5,7,8,9,15,16,17,19,20,21,23,24,25,26,28,29,31,33,35,36,39 and 40 amplified production is different from section agriculture 9204 banding pattern, namely these strains do not have the gene locus of internode under described reduction plant height and fringe.
Prove thus: utilize
xcnl10carry out molecular marker assisted selection, can Effective selection have reduce plant height, the kind of the major gene loci that internode is long or strain under fringe, this mark is used for efficiency of selection and the quality that wheat assistant breeding can substantially increase High-Yield Wheat Cultivar or strain.
Claims (8)
1., with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe, it is characterized in that, this molecule marker is
xcnl10, its molecule marker
xcnl10upstream primer sequence as described in SEQ ID NO:1, downstream primer sequence is as described in SEQ ID NO:2.
2., with the acquisition methods of the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe, it is characterized in that, comprise the following steps:
With
xcnl10the DNA of labeled primer to wheat breed section agriculture 9204 carries out pcr amplification, and its PCR amplification system is 20 μ l, comprising: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, the ddH of 7 μ l
2o; Adopt the amplification of gradient touchdown PCR amplification program, step is as follows:
(1) 94 DEG C of sex change 4 min,
The renaturation temperature fall program of (2) 15 circulations, each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, and 72 DEG C extend 55 s;
The regular-PCR program of (3) 30 circulations: 94 DEG C of sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s;
(4) 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of preservations;
Amplified production is voltage stabilizing 120 V electrophoretic separation on the non-denaturing polyacrylamide gel of 6%, and the molecular weight obtaining corresponding amplified production is 700bp, is the molecule marker with the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe; Wherein
xcnl10the upstream primer sequence of mark is as described in SEQ ID NO:1, and downstream primer sequence is as described in SEQ ID NO:2.
3. the acquisition methods with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe according to claim 2, it is characterized in that, the DNA obtained after the DNA of described wheat breed section agriculture 9204 refers to wheat section agriculture 9204 plant leaf separation and Extraction.
4. the acquisition methods with the molecule marker of the long main effect QTL compact linkage of internode under Plant Height in Wheat and fringe according to claim 2, it is characterized in that, the non-denaturing polyacrylamide gel of described 6% refers in 100ml polyacrylamide gel solution containing 5.85 g acrylamides and 0.15 g methene acrylamide.
5. the Markers for Detection wheat breed of utilization as claim 2 acquisition or a method for strain, is characterized in that, comprise the following steps:
A. use
xcnl10the DNA of labeled primer to wheat breed to be measured or strain carry out pcr amplification, its PCR amplification system is 20 μ l, comprises: the DNA profiling of 1 μ l, the upstream primer of 1 μ l, the downstream primer of 1 μ l, 2 × Taq PCR StarMix of 10 μ l, and the ddH2O of 7 μ l; Adopt the amplification of gradient touchdown PCR amplification program: 94 DEG C of sex change 4 min; The renaturation temperature fall program of 15 circulations, each circulation is 94 DEG C of sex change 45 s, 65 DEG C of renaturation 50 s, reduction by 1 DEG C on each basis circulating in 65 DEG C, and 72 DEG C extend 55 s; The regular-PCR program of 30 circulations: 94oC sex change 40 s, 50 DEG C of renaturation 40 s, 72 DEG C extend 40 s; 72 DEG C extend 5 min; Terminate amplification, 15 DEG C of preservations; Wherein
xcnl10the upstream primer sequence of labeled primer as described in SEQ ID NO:1, downstream primer sequence is as described in SEQ ID NO:2;
B. by above-mentioned amplified production on the non-denaturing polyacrylamide gel of 6% after voltage stabilizing 120 V electrophoretic separation, if obtaining the molecular weight of amplified production is the amplified fragments of 700bp, then this wheat breed or product are on this gene locus, have the wheat breed or strain that reduce the long gene of internode under plant height and fringe; Otherwise it is do not have the wheat breed or strain that reduce the long gene of internode under the high and fringe of plant height that this wheat breed or strain belong in this site.
6. the method for detection wheat breed according to claim 5 or strain, it is characterized in that, described wheat breed or product are with wheat section agriculture 9204 for parent, by adopting conventional hybridization and multiplying seed selection to F2 for above section's agriculture 9204 wheat derived varieties or strain.
7. the detection wheat breed according to claim 5 or 6 or the method for strain, is characterized in that, the DNA of described wheat breed or strain refers to the DNA will obtained after wheat plant blade separation and Extraction.
8. the detection wheat breed according to claim 5,6 or 7 or the method for strain, it is characterized in that, the non-denaturing polyacrylamide gel of described 6% refers in 100ml polyacrylamide gel solution containing 5.85 g acrylamides and 0.15 g methene acrylamide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410580713.XA CN104372003B (en) | 2014-10-27 | 2014-10-27 | Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410580713.XA CN104372003B (en) | 2014-10-27 | 2014-10-27 | Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104372003A true CN104372003A (en) | 2015-02-25 |
| CN104372003B CN104372003B (en) | 2017-05-24 |
Family
ID=52551199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410580713.XA Expired - Fee Related CN104372003B (en) | 2014-10-27 | 2014-10-27 | Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104372003B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148331A (en) * | 2015-04-01 | 2016-11-23 | 中国农业大学 | Molecular marker and application thereof with Plant Height in Wheat main effect QTL compact linkage |
| CN109439788A (en) * | 2018-11-20 | 2019-03-08 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | KASP molecular labeling and its application with Plant Height in Wheat major gene loci close linkage |
| CN109913573A (en) * | 2019-04-08 | 2019-06-21 | 鲁东大学 | The molecular labeling of the close linkage of wheat grains per spike main effect QTL and its application |
| CN110982933A (en) * | 2020-03-02 | 2020-04-10 | 鲁东大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of wheat grain length and application thereof |
| CN110982932A (en) * | 2020-03-02 | 2020-04-10 | 鲁东大学 | Molecular marker closely linked with major QTL of wheat plant height and application thereof |
| CN111269966A (en) * | 2020-03-18 | 2020-06-12 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | Method for obtaining specific molecular marker of aegilops tauschii and application thereof |
| CN113151576A (en) * | 2021-06-07 | 2021-07-23 | 鲁东大学 | Molecular marker closely linked with major QTL of wheat plant height as well as acquisition method and application thereof |
| CN113817860A (en) * | 2021-09-28 | 2021-12-21 | 鲁东大学 | Wheat single plant spike number major QTL-qSnpp-5D linked molecular marker method and application |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003839A (en) * | 2007-01-11 | 2007-07-25 | 江苏省农业科学院 | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application |
| WO2007103738A3 (en) * | 2006-03-01 | 2007-12-27 | Pioneer Hi Bred Int | Compositions related to the quantitative trait locus 6 (qtl6) in maize and methods of use |
| WO2009029771A2 (en) * | 2007-08-29 | 2009-03-05 | Monsanto Technology Llc | Methods and compositions for breeding for preferred traits |
| CN103275975A (en) * | 2013-05-21 | 2013-09-04 | 四川农业大学 | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application |
| CN103290002A (en) * | 2013-05-13 | 2013-09-11 | 四川农业大学 | Molecular marker of wheat tiller QTL (quantitative trait locus) QMtn. sicau-2B.1 and application thereof |
-
2014
- 2014-10-27 CN CN201410580713.XA patent/CN104372003B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007103738A3 (en) * | 2006-03-01 | 2007-12-27 | Pioneer Hi Bred Int | Compositions related to the quantitative trait locus 6 (qtl6) in maize and methods of use |
| CN101003839A (en) * | 2007-01-11 | 2007-07-25 | 江苏省农业科学院 | Molecule tag close linked to resistance QTL of wheat sharp eyespot, and application |
| WO2009029771A2 (en) * | 2007-08-29 | 2009-03-05 | Monsanto Technology Llc | Methods and compositions for breeding for preferred traits |
| CN103290002A (en) * | 2013-05-13 | 2013-09-11 | 四川农业大学 | Molecular marker of wheat tiller QTL (quantitative trait locus) QMtn. sicau-2B.1 and application thereof |
| CN103275975A (en) * | 2013-05-21 | 2013-09-04 | 四川农业大学 | Wheat new few-tillering QTL (quantitative trait locus), primer pair, molecular marker, molecular marking method and application |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106148331A (en) * | 2015-04-01 | 2016-11-23 | 中国农业大学 | Molecular marker and application thereof with Plant Height in Wheat main effect QTL compact linkage |
| CN106148331B (en) * | 2015-04-01 | 2019-01-08 | 中国农业大学 | Molecular labeling and its application with Plant Height in Wheat main effect QTL compact linkage |
| CN109439788A (en) * | 2018-11-20 | 2019-03-08 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | KASP molecular labeling and its application with Plant Height in Wheat major gene loci close linkage |
| CN109439788B (en) * | 2018-11-20 | 2022-05-13 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | KASP molecular marker closely linked with major gene locus of wheat plant height and application thereof |
| CN109913573A (en) * | 2019-04-08 | 2019-06-21 | 鲁东大学 | The molecular labeling of the close linkage of wheat grains per spike main effect QTL and its application |
| CN109913573B (en) * | 2019-04-08 | 2022-06-14 | 鲁东大学 | Closely linked molecular marker of wheat ear grain number major QTL and application thereof |
| CN110982933A (en) * | 2020-03-02 | 2020-04-10 | 鲁东大学 | Molecular marker closely linked with major QTL (quantitative trait locus) of wheat grain length and application thereof |
| CN110982932A (en) * | 2020-03-02 | 2020-04-10 | 鲁东大学 | Molecular marker closely linked with major QTL of wheat plant height and application thereof |
| CN111269966A (en) * | 2020-03-18 | 2020-06-12 | 中国科学院遗传与发育生物学研究所农业资源研究中心 | Method for obtaining specific molecular marker of aegilops tauschii and application thereof |
| CN113151576A (en) * | 2021-06-07 | 2021-07-23 | 鲁东大学 | Molecular marker closely linked with major QTL of wheat plant height as well as acquisition method and application thereof |
| CN113817860A (en) * | 2021-09-28 | 2021-12-21 | 鲁东大学 | Wheat single plant spike number major QTL-qSnpp-5D linked molecular marker method and application |
| CN113817860B (en) * | 2021-09-28 | 2023-11-10 | 鲁东大学 | Molecular marking method and application of wheat single plant spike number major QTL-qSnpp-5D linkage |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104372003B (en) | 2017-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104372003A (en) | Molecular marker closely linked with major QTL of wheat height and uppermost internode length as well as acquisition method and application of molecular marker | |
| Septiningsih et al. | Applying genomics tools for breeding submergence tolerance in rice | |
| CN103952402B (en) | A kind of SNP site relevant to root system of plant proterties and application thereof | |
| CN102373278B (en) | SNP (Single Nucleotide Polymorphism) locus related to maize plant high character | |
| CN105349684B (en) | With the molecular labeling of the anti-rough dwarf disease main effect QTL compact linkage of corn | |
| CN103451183B (en) | Molecular marker tightly interlocked with major gene locus of wheat spikelet number as well as obtaining method and application of molecular marker | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| CN109825639B (en) | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage | |
| CN110117673A (en) | The molecular labeling of the short bar character site of cabbage type rape and its application | |
| CN109913573A (en) | The molecular labeling of the close linkage of wheat grains per spike main effect QTL and its application | |
| CN110157829A (en) | A kind of and the associated molecular marker SNP A9-5 of rape mass of 1000 kernel and application | |
| CN110184373A (en) | A kind of and the associated molecular labeling of rape mass of 1000 kernel and application | |
| CN105219858B (en) | Grain Weight in Common Wheat gene TaGS5 3A single nucleotide polymorphisms and its application | |
| CN107177667B (en) | Wheat head density QTL (quantitative trait locus) linked HRM (high resolution melting) molecular marker and application thereof | |
| CN103436533B (en) | Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker | |
| CN105039335B (en) | The molecular labeling of Protein Content in Barley Grain main effect QTL and its application | |
| CN108203737B (en) | SNP molecular marker of corn ear row number related gene GRMZM2G098557 and application | |
| CN105296472B (en) | The molecular labeling and its screening technique in Sand Pear ' faint scent ' pericarp brown character gene site entirely | |
| CN106701751B (en) | Molecular labeling and application with the long QTL QFll.sicau-4D close linkage of wheat flag leaf | |
| CN116334300B (en) | Molecular marker closely linked with main effect QTL of wheat spike number per spike and application thereof | |
| CN107988414A (en) | A kind of dCAPS marks for aiding in detection soybean 100-grain weight and its application | |
| CN105821153B (en) | The relevant molecular labeling of rape cracking resistance angle character main effect QTL and application | |
| CN104531882A (en) | Molecular marker primer pair, method and application for authenticating new dwarf main effect QTL of wheat | |
| CN109439788B (en) | KASP molecular marker closely linked with major gene locus of wheat plant height and application thereof | |
| CN103834647B (en) | Wheat Dwarfing gene Rht dC20closely linked SSR marker Xgwm537 and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170524 Termination date: 20171027 |