CN104342417A - Aspergillus terreus-derived activity-enhanced acyltransferase mutant - Google Patents
Aspergillus terreus-derived activity-enhanced acyltransferase mutant Download PDFInfo
- Publication number
- CN104342417A CN104342417A CN201310345811.0A CN201310345811A CN104342417A CN 104342417 A CN104342417 A CN 104342417A CN 201310345811 A CN201310345811 A CN 201310345811A CN 104342417 A CN104342417 A CN 104342417A
- Authority
- CN
- China
- Prior art keywords
- acyltransferase
- mutant
- leu
- terreus
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an aspergillus terreus-derived activity-enhanced acyltransferase mutant which has improved activity compared with aspergillus terreus-derived wild type acyltransferase. The invention further provides a polynucleotide coding the acyltransferase mutant, a host cell capable of expressing the mutant, and a production method of the acyltransferase mutant. The aspergillus terreus-derived activity-enhanced acyltransferase mutant can be used for synthesizing important statins compound simvastatin on a large scale.
Description
Technical field
Present disclosure relates to the method and the material that generate Simvastatin for biocatalysis.More specifically, present disclosure relate to than wild-type acyltransferase compare have the acylase mutant improving active non-natural and exist, described acylase mutant of encoding polynucleotide, comprise the host cell of these type of polynucleotide, the production method of described acylase mutant and use described acylase mutant biocatalysis to generate method and the material of Simvastatin.
background of invention
Simvastatin is the hypolipidemic of Merck company development, trade(brand)name Zocor, Simvastatin (simvastatin) is the semi-synthetic derivative of lovastatin, and lovastatin is separated the natural product from terreus (Aspergillus terreus) fermented liquid.The pharmacological action of Simvastatin suppresses hydroxyl first glutaryl coenzyme A reductase enzyme (HMG-CoA reductase) vigor in liver cell as competitive inhibitor, restriction HMG-CoA to the conversion of methyldihydroxypentanoic acid, thus reduces the biosynthesizing total amount of endogenous total cholesterol.Compare with other HMG-CoA reductase inhibitor such as fluvastatins (fluvastatin) with the lovastatin (lovastatin) of same dose, Pravastatin (pravastatin), Simvastatin more effectively can reduce total cholesterol in serum and low density lipoprotein cholesterol.
1984, it took lovastatin as starting raw material that Hoffman etc. have delivered, the side-chain hydrolysis route of chemosynthesis Simvastatin, but the by product of this route is more, brought disadvantageous effect thus to product separation purifying.
1986, Sleiteinger etc. have delivered the direct route of methylation of lovastatin, this route improves through the amendment such as Verhoeven (1989), Kumar (1998), become and produce the maximum technique of upper use at present, but directly route of methylation needs the chemical reagent of multiple costliness and danger.
Because chemical method building-up process condition is harsh, side reaction is many, and separation and purification of products difficulty is large, and therefore causes the cost preparing Simvastatin at present higher.Therefore, pole needs a kind of energy low-cost high-efficiency to prepare the method for Simvastatin and related compound.
Xie etc. from Aspergillus. terreus bacterium clone obtain acyltransferase encoding gene and among E.coli high expression level.Utilize gained engineering bacteria can directly catalysis that crin J is not to the conversion of Simvastatin, transformation efficiency reaches 99%.Polyketide synthases (PKS) the function domain dna combined sequence of different sources is become multiple different lovastatin diketone synthase gene by India Ranganathan, and express in terreus (Aspergillus terreus), direct fermentation produces Simvastatin.
Alanine residue or the polarity natural amino acid such as Xie replace Cys40 and Cys60, significantly improve the solubility expression of acyltransferase.And further experiment proves that these sudden changes have additivity, wherein C40A/C60N double-mutant shows the growth of solubleness and Whole Cell Biocatalysis active nearly 50%.
Above mainly through intestinal bacteria (E.coli) engineering strain of process LAN acyltransferase as whole-cell biocatalyst, in single fermenting process, synthesize the Simvastatin of preparation amount.More than research proves that acyltransferase can be used for the biosynthesizing of the important cholesterol lowering drug thing such as Simvastatin, is a kind of enzyme had a great attraction.But in the experiment subsequently using the acyltransferase be separated to carry out, stability and speed of reaction are proved to be problematic.Specifically, find that acyltransferase easily precipitates when high protein concentration, and slowly precipitate when low concentration.In addition, find that product Simvastatin can compete acyltransferase, hinder total net rate of acidylate significantly.
Acyltransferase also highly tends to false folding and gathering during process LAN in intestinal bacteria, even make for Whole Cell Biocatalysis system industrial-scale production also not ideal.
Zhu Li equality expresses acyltransferase in e. coli bl21 (DE3); pass through optimization of fermentation conditions; fermention medium; inoculum size; inductor concentration and induction time etc.; last acyltransferase expression level is only 100mg/L, and Simvastatin output is also only 1.2g/L, does not reach the requirement of industrial-scale production far away.
Summary of the invention
The LovD genes encoding acyltransferase of terreus (Aspergillus terreus), this acyltransferase can make the hydrolysate citrinin J (Monacolin J) of natural product lovastatin be converted into Simvastatin.The catalytic activity of increase is shown compared with the wild-type acyltransferase (SEQ ID NO:2) that the acyltransferase that the contriver of present disclosure has found to be included in certain position sudden change produces with terreus (Aspergillus terreus)." wild-type acyltransferase ", " wild-type LovD enzyme " and " wild-type LovD acyltransferase " refer to be encoded by the wild-type acyl transferase gene SEQ ID NO:1 being derived from terreus (Aspergillus terreus), and have the acyltransferase of the aminoacid sequence of SEQ ID NO:2.This enzyme can use thioesters with the C8 oh group of regiospecific mode acidylate to produce Simvastatin." wild-type " refers to the form with the same material found in nature or material.The protein of such as wild-type or nucleotide sequence are can from the separation of occurring in nature and without artificial modification, the original series form existed in organism." catalytic activity of increase " refers to as measured compared with wild-type acyltransferase in vitro or in vivo test, and performance is sent as an envoy to the acyltransferase that substrate (such as citrinin J or its salt) increases to product (such as Simvastatin or its salt) transformation efficiency.
The invention provides to have compared with wild-type acyltransferase and carry highly active acylase mutant.Additionally provide the polynucleotide of encoding acyltransferases mutant, the host cell of described mutant and the production method of this acylase mutant can be expressed.Can be used for the statin compound Simvastatin that extensive synthesis is important.
The acylase mutant coming from the wild-type acyltransferase of terreus provided by the invention; it is characterized in that; it is the acylase mutant of the fermentative production that can be used for Simvastatin; wherein; sudden change is insertion in the aminoacid sequence of parent's acyltransferase, replaces or lack one or more amino acid; or add at one or two end of the aminoacid sequence of parent's acyltransferase or delete one or more amino acid; and compared with use parent acyltransferase, its acyltransferase activity strengthens 2-50 doubly.
Further, described mutant has the aminoacid replacement on following one or more amino acid positions, and each replacement triplet represents: alphabet-numeric playing-letter, wherein the position of numeral mutating acid, the amino acid of the letter correspondence sudden change design before numeral, letter representation after numeral is for replacing the front amino acid whose amino acid of numeral: R28H, D96K, L174H, A178V, N191M, A261W, H404R.
The described acylase mutant coming from the wild-type acyltransferase of terreus (Aspergillus terreus), can make the hydrolysate citrinin J (Monacolin J) of natural product lovastatin be converted into Simvastatin.Described acylase mutant, shows stronger catalytic activity compared with the wild-type acyltransferase of SEQ ID NO.2.The polynucleotide of acylase mutant and this mutant of coding can use the normally used method preparation of those skilled in the art.Mutant can by making the acquisitions such as the vitro recombination of this enzyme of coding, polynucleotide mutagenesis, DNA reorganization, fallibility PCR and directed evolution method.
Further, the invention provides a kind of acylase mutant coming from the wild-type acyltransferase of terreus, comprise the aminoacid sequence of SEQ ID NO.4.
The acyltransferase of total length sudden change is for keeping the catalytic activity of enzyme to be not required.Correspondingly, the analogue of the brachymemma of acylase mutant should be considered and have the fragment of catalytic activity.Such as, in some embodiments, 1 to 20 amino acid can be left out.In further embodiment, acylase mutant comprises the protein of following brachymemma: wherein can leave out from 1 to 20 amino acid from N-end and can leave out from 1 to 20 amino acid from C-end.The analogue of any specific brachymemma or fragment can utilize corresponding test to assess catalytic activity.Same, extra amino-acid residue can be added to one or two end and not affect catalytic activity.Additional sequences can be functional or non-functional.Such as, Additional amino acid sequences can be used to help purifying, as mark, or performs some other function.Therefore; the acylase mutant of present disclosure can be the form of fusion rotein, and wherein such as by the example of hydrotropy label (as SUMO albumen), purification tag (the His label as in conjunction with metal) and bacterium signal for locating (as secretion signal), unrestriced mode is fused to other oroteins to acylase mutant (or its fragment).
Further, the invention provides the above-mentioned encoding gene coming from the acylase mutant of the wild-type acyltransferase of terreus.
Further, the invention provides a kind of encoding gene coming from the acylase mutant of the wild-type acyltransferase of terreus, its encoding gene comprises the DNA sequence dna described in SEQ ID NO.3.Its codon optimization to be suitable at expression in escherichia coli.In some embodiments, polynucleotide comprise the codon being optimized for and expressing in the host cell of particular type.Known for the use of the codon of various dissimilar microorganism and Preference, because it is for the codon in the specific amino acid whose optimization of the expression of these microorganisms.
The invention provides a kind of recombinant plasmid, its sequence preference, from SEQ ID NO.5, is compared it than pET series and the serial expression vector of pQE and is had more rigorous expression control.In some embodiments, control sequence comprises promotor, leader sequence, Polyadenylation sequences, propeptide sequence, signal peptide sequence and transcription terminator etc.For bacterial host cell, the promotor be applicable to of transcribing of encoding sequence is instructed to include but not limited to from Phage T5, phage t7, phage lambda, intestinal bacteria lacUV5 operon, intestinal bacteria trp operon, intestinal bacteria tac operon etc.
The invention provides a kind of host cell, preferably from intestinal bacteria W3110, DH1, and the one in JM109.Express the expression vector of acylase mutant can comprise allow in vector integration to host cell gene group or carrier in bacterium independent of the element of genome self-replicating.For being incorporated in host cell gene group, carrier can make vector integration in genome by recombined engineering.
The invention provides a kind of method preparing acylase mutant, it is characterized in that comprising the following steps: the genetic engineering bacterium of (a) construction expression acylase mutant, described genetic engineering bacterium comprises host cell, expression vector and acylase mutant gene; B () screening obtains described genetic engineering bacterium; C () cultivates described genetic engineering bacterium; Genetic engineering bacterium described in (d) abduction delivering; E () is collected and is prepared acylase mutant.
The invention provides a kind of method of producing Simvastatin sodium salt, under being included in the existence of acylase mutant, make citrinin J (Monacolin J) sodium salt be converted into Simvastatin sodium salt.Acylase mutant catalyzing acyl group described herein from thioesters cosubstrate to the transfer of citrinin J (Monacolin J) and analogue thereof to produce important statin compound in a large number, such as Simvastatin.By citrinin J (Monacolin J) as parent material time, can obtain Simvastatin by means of only a step.Make alpha-alpha-dimethyl butyryl group under the condition of the C8 position transfer of citrinin J (Monacolin J) at acylase mutant, citrinin J (Monacolin J) substrate (or its sodium salt or ammonium salt) contacts to produce Simvastatin with acylase mutant under the existence of DMB-S-MMP cosubstrate.Alpha-alpha-dimethyl butyryl substrate can use commercially available parent material to use ordinary method preparation.Citrinin J (Monacolin J) can use ordinary method to obtain through the alkaline hydrolysis of lovastatin.The reaction conditions being suitable for acylase mutant described herein is as follows: citrinin J (Monacolin J) the sodium salt substrate of 40 to 100g/L; The DMB-S-MMP cosubstrate of 1.1-1.9 equivalent; The acylase mutant of 1.5-6g/L.Temperature of reaction about 20 DEG C to 30 DEG C and also be usually no more than 38 DEG C scope temperature under carry out, this depends on the best catalytic temperature of used acylase mutant, and the Keep agitation time is about 24 to 72 hours.Transformation efficiency and by product generation etc. can be detected by modes such as HPLC high-efficient liquid phase analysis in reaction process.According to this reaction, Simvastatin can be isolated from final reacting product, and be translated into the salt that there is important drug effect and be worth further by standard program.
The invention has the beneficial effects as follows: restructuring acyltransferase of the present invention has significantly high alive than enzyme, improves 2-50 doubly than wild-type acyltransferase.This method utilizes enzyme process biocatalysis citrinin J (Monacolin J) to be converted into Simvastatin.This method reaction conditions is gentle, and extremely low to equipment requirements, production process is without the need to high temperature or cooling, and energy consumption is low, because enzyme catalysis has efficiently, and single-minded selectivity, therefore produce the generation of Simvastatin no coupling product in this way, purifying is convenient.Reacting most solvent is water, and three waste discharge is low, environmental protection.
Embodiment
The structure of embodiment 1 wild-type and acylase mutant expression vector
(see Puigb ò P after the polynucleotide (SEQ ID NO:1) of the encoding wild type acyltransferase from terreus (Aspergillus terreus) are carried out sequence optimisation according to bacterial strain DH1 codon preference, Guzm á n E, Romeu A, Garcia-Vallv é S. OPTIMIZER:a web server for optimizing the codon usage of DNA sequences. Nucleic Acids Res. 2007), gene chemical synthesis is carried out by the full genome synthesis mode (PCR-based gene synthesis method) of PCR-based.Under the polynucleotide (SEQ ID NO:1) of the encoding acyltransferases after optimization are cloned into the control of the promotor of expression vector (SEQ ID NO. 5), obtain the plasmid can expressing wild-type acyltransferase.Gained plasmid is transformed in intestinal bacteria DH1 by standard method.Cloning process used is the mode of homologous recombination, and used amplimer (containing the homology arm carrying out homologous recombination) is:
F:5' TAACTTTTAGGAGGTAAAACATATGGGTTCTATCATCGACGCTGC 3';
R:5' TGGTGATGGTGATGCGATCCTCT TTAACCCTGCTGGTACTGAGCGTAG 3'。
Under the polynucleotide (SEQ ID NO:3) of encoding acyltransferases mutant being cloned into the control of the promotor of expression vector (SEQ ID NO. 5) by identical method, obtain the plasmid can expressing acylase mutant.Gained plasmid is transformed in intestinal bacteria DH1 by standard method.
The preparation of embodiment 2 acylase mutant
In the substratum of the mono-colony inoculation of intestinal bacteria DH1 that picking contains object expression vector after 10ml autoclaving: Tryptones 10 g/L, yeast extract 5 g/L, Sodium phosphate dibasic 3.55 g/L, potassium primary phosphate 3.4 g/L, ammonium chloride 2.68 g/L, sodium sulfate 0.71 g/L, magnesium sulfate heptahydrate 0.493 g/L, Iron trichloride hexahydrate 0.027 g/L, glycerine 5g/L, glucose 0.8g/L, adds kantlex to 50mg/L after sterilizing.30 DEG C, 250rpm incubated overnight.Get 1L triangular flask next day, be linked in the substratum after 200ml autoclaving by the inoculative proportion of 1:100: Tryptones 10 g/L, yeast extract 5 g/L, Sodium phosphate dibasic 3.55 g/L, potassium primary phosphate 3.4 g/L, ammonium chloride 2.68 g/L, sodium sulfate 0.71 g/L, magnesium sulfate heptahydrate 0.493 g/L, Iron trichloride hexahydrate 0.027 g/L, glycerine 5g/L, glucose 0.3g/L.Kantlex is added to 50mg/L after sterilizing.In 30 DEG C, be cultured to thalline OD 5-6, triangular flask be placed in 25 DEG C of shaking tables at once, 250rpm cultivates 1h.Add IPTG to final concentration 0.1mM, and in 25 DEG C, 250rpm continues to cultivate 15h.
After cultivation terminates, by nutrient solution in 4 DEG C, under 6000g, centrifugal 20min finally obtains wet thallus 4.8g.Then by precipitation distilled water cleaning twice, thalline is collected.Again use distilled water resuspended, under Ultrasonic Cell Disruptor, be crushed to clarification.In 4 DEG C after fragmentation, centrifugal 30min under 12000g, collects supernatant, prepares lyophilized powder after being chilled to-70 DEG C in advance with freeze drier.Finally obtain thick enzyme lyophilized powder 0.5g.
Embodiment 3: catalyzing and synthesizing of Simvastatin sodium salt
Use in embodiment 2 and describe prepared acylase mutant, catalysis citrinin J (Monacolin J) sodium salt generate Simvastatin sodium salt to possess implementation step as follows.In the 3 neck round-bottomed flask dresses of 500mL, add 10g citrinin J (Monacolin J), then add 50ml deionized water.Firmly stir mixture until dissolve all solids.Then add 67ml TE buffered soln (pH 8.5), and be 9.0 with dense HCl adjustment pH.Add 0.2g acylase mutant powder, within 3 minutes, make acylase mutant powder and liquid be mixed evenly in 25 DEG C of stirrings at once.Add DMB-S-MMP (7.1 mL, 16.27mmol), 25 DEG C, carry out enzymic catalytic reaction under 350rpm condition.After getting 5 μ L reaction mixture methanol dilution 6 times, under 12000g centrifugal 15 minutes, to remove precipitation and supernatant liquor HPLC analyzes.Result obtains the transformation efficiency of 95% after being presented at 50h.
SEQUENCE LISTING
Lang En bio tech ltd, <110> Nanjing
<120> comes from the acylase mutant of the increased activity of terreus
<130> 2013
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 1242
<212> DNA
<213> terreus (Aspergillus terreus)
<400> 1
atgggatcca tcattgatgc tgctgcggca gcggatccgg ttgttctgat ggaaaccgcc 60
ttccgcaagg ccgtgaaatc caggcagatc cccggggcgg tcatcatggc tcgagattgc 120
agtggcaatc taaattatac gcgctgcttc ggggctcgga cagtgcgacg ggacgagtgc 180
aatcagctgc cgccgctaca ggtcgacacc ccctgccggc tcgccagtgc gactaagctg 240
ctgaccacga tcatggccct acaatgcatg gagcgcggtc tcgtggactt ggatgagacg 300
gtggatcggc tgcttccgga tttgagtgcg atgcccgtgc tggagggttt tgacgacgcg 360
ggaaatgcaa gattgcgaga gcgtcggggg aagatcacgc tgcggcacct gctgacgcat 420
acatcgggac tgtcgtatgt cttcctccat ccgttgctcc gggaatacat ggcccagggc 480
cacctccagt cggcagaaaa gtttggcatc cagagtcgcc tggcgccgcc ggccgtcaac 540
gaccctgggg cggagtggat ctacggcgcc aacctggact gggcgggtaa gctcgtcgag 600
cgggccaccg gcctcgacct ggagcagtac ctgcaggaga atatctgtgc gccgctgggc 660
atcaccgaca tgacctttaa gctgcagcaa cggccggata tgcttgcgcg ccgggccgac 720
caaacccacc gcaactcggc ggatgggcgc ctgcgctacg acgactcggt ctacttccgg 780
gccgatggcg aggagtgctt cggcggccag ggggtgttct cggggcctgg gtcctatatg 840
aaggtgctcc actcgctgtt gaagcgagac gggctcctgc tgcagccaca gaccgtggac 900
atgatgtttc agcctgccct cgagccgcga ctcgaagagc agatgaacca gcacatggac 960
gccagcccgc acatcaacta cggtgggccg atgcccatgg tccttcgtcg cagctttggg 1020
ctggggggga tcatcgcctt ggaggatctg gacggcgagg actggcgccg aaaaggttcc 1080
ttgacctttg ggggtggtcc aaacattgtg tggcaaatcg accccaaggc cggcctgtgc 1140
acccttgcgt tcttccaact ggaaccctgg aatgacccgg tctgtcgtga tctgacacgc 1200
acattcgaac atgccatcta tgcgcagtac cagcagggat aa 1242
<210> 2
<211> 413
<212> PRT
<213> terreus (Aspergillus terreus)
<400> 2
Met Gly Ser Ile Ile Asp Ala Ala Ala Ala Ala Asp Pro Val Val Leu
1 5 10 15
Met Glu Thr Ala Phe Arg Lys Ala Val Lys Ser Arg Gln Ile Pro Gly
20 25 30
Ala Val Ile Met Ala Arg Asp Cys Ser Gly Asn Leu Asn Tyr Thr Arg
35 40 45
Cys Phe Gly Ala Arg Thr Val Arg Arg Asp Glu Cys Asn Gln Leu Pro
50 55 60
Pro Leu Gln Val Asp Thr Pro Cys Arg Leu Ala Ser Ala Thr Lys Leu
65 70 75 80
Leu Thr Thr Ile Met Ala Leu Gln Cys Met Glu Arg Gly Leu Val Asp
85 90 95
Leu Asp Glu Thr Val Asp Arg Leu Leu Pro Asp Leu Ser Ala Met Pro
100 105 110
Val Leu Glu Gly Phe Asp Asp Ala Gly Asn Ala Arg Leu Arg Glu Arg
115 120 125
Arg Gly Lys Ile Thr Leu Arg His Leu Leu Thr His Thr Ser Gly Leu
130 135 140
Ser Tyr Val Phe Leu His Pro Leu Leu Arg Glu Tyr Met Ala Gln Gly
145 150 155 160
His Leu Gln Ser Ala Glu Lys Phe Gly Ile Gln Ser Arg Leu Ala Pro
165 170 175
Pro Ala Val Asn Asp Pro Gly Ala Glu Trp Ile Tyr Gly Ala Asn Leu
180 185 190
Asp Trp Ala Gly Lys Leu Val Glu Arg Ala Thr Gly Leu Asp Leu Glu
195 200 205
Gln Tyr Leu Gln Glu Asn Ile Cys Ala Pro Leu Gly Ile Thr Asp Met
210 215 220
Thr Phe Lys Leu Gln Gln Arg Pro Asp Met Leu Ala Arg Arg Ala Asp
225 230 235 240
Gln Thr His Arg Asn Ser Ala Asp Gly Arg Leu Arg Tyr Asp Asp Ser
245 250 255
Val Tyr Phe Arg Ala Asp Gly Glu Glu Cys Phe Gly Gly Gln Gly Val
260 265 270
Phe Ser Gly Pro Gly Ser Tyr Met Lys Val Leu His Ser Leu Leu Lys
275 280 285
Arg Asp Gly Leu Leu Leu Gln Pro Gln Thr Val Asp Met Met Phe Gln
290 295 300
Pro Ala Leu Glu Pro Arg Leu Glu Glu Gln Met Asn Gln His Met Asp
305 310 315 320
Ala Ser Pro His Ile Asn Tyr Gly Gly Pro Met Pro Met Val Leu Arg
325 330 335
Arg Ser Phe Gly Leu Gly Gly Ile Ile Ala Leu Glu Asp Leu Asp Gly
340 345 350
Glu Asp Trp Arg Arg Lys Gly Ser Leu Thr Phe Gly Gly Gly Pro Asn
355 360 365
Ile Val Trp Gln Ile Asp Pro Lys Ala Gly Leu Cys Thr Leu Ala Phe
370 375 380
Phe Gln Leu Glu Pro Trp Asn Asp Pro Val Cys Arg Asp Leu Thr Arg
385 390 395 400
Thr Phe Glu His Ala Ile Tyr Ala Gln Tyr Gln Gln Gly
405 410
<210> 3
<211> 1242
<212> DNA
<213> artificial sequence
<400> 3
atgggttcta tcatcgacgc tgctgctgct gctgacccgg ttgttctgat ggaaaccgct 60
ttccgtaaag ctgttaaatc tcaccagatc ccgggtgctg ttatcatggc tcgtgactgc 120
tctggtaacc tgaactacac ccgttgcttc ggtgctcgta ccgttcgtcg tgacgaatgc 180
aaccagctgc cgccgctgca ggttgacacc ccgtgccgtc tggcttctgc taccaaactg 240
ctgaccacca tcatggctct gcagtgcatg gaacgtggtc tggttaaact ggacgaaacc 300
gttgaccgtc tgctgccgga cctgtctgct atgccggttc tggaaggttt cgacgacgct 360
ggtaacgctc gtctgcgtga acgtcgtggt aaaatcaccc tgcgtcacct gctgacccac 420
acctctggtc tgtcttacgt tttcctgcac ccgctgctgc gtgaatacat ggctcagggt 480
cacctgcagt ctgctgaaaa attcggtatc cagtctcgtc acgctccgcc ggttgttaac 540
gacccgggtg ctgaatggat ctacggtgct atgctggact gggctggtaa actggttgaa 600
cgtgctaccg gtctggacct ggaacagtac ctgcaggaaa acatctgcgc tccgctgggt 660
atcaccgaca tgaccttcaa actgcagcag cgtccggaca tgctggctcg tcgtgctgac 720
cagacccacc gtaactctgc tgacggtcgt ctgcgttacg acgactctgt ttacttccgt 780
tgggacggtg aagaatgctt cggtggtcag ggtgttttct ctggtccggg ttcttacatg 840
aaagttctgc actctctgct gaaacgtgac ggtctgctgc tgcagccgca gaccgttgac 900
atgatgttcc agccggctct ggaaccgcgt ctggaagaac agatgaacca gcacatggac 960
gcttctccgc acatcaacta cggtggtccg atgccgatgg ttctgcgtcg ttctttcggt 1020
ctgggtggta tcatcgctct ggaagacctg gacggtgaag actggcgtcg taaaggttct 1080
ctgaccttcg gtggtggtcc gaacatcgtt tggcagatcg acccgaaagc tggtctgtgc 1140
accctggctt tcttccagct ggaaccgtgg aacgacccgg tttgccgtga cctgacccgt 1200
accttcgaac gtgctatcta cgctcagtac cagcagggtt aa 1242
<210> 4
<211> 413
<212> PRT
<213> artificial sequence
<400> 4
Met Gly Ser Ile Ile Asp Ala Ala Ala Ala Ala Asp Pro Val Val Leu
1 5 10 15
Met Glu Thr Ala Phe Arg Lys Ala Val Lys Ser His Gln Ile Pro Gly
20 25 30
Ala Val Ile Met Ala Arg Asp Cys Ser Gly Asn Leu Asn Tyr Thr Arg
35 40 45
Cys Phe Gly Ala Arg Thr Val Arg Arg Asp Glu Cys Asn Gln Leu Pro
50 55 60
Pro Leu Gln Val Asp Thr Pro Cys Arg Leu Ala Ser Ala Thr Lys Leu
65 70 75 80
Leu Thr Thr Ile Met Ala Leu Gln Cys Met Glu Arg Gly Leu Val Lys
85 90 95
Leu Asp Glu Thr Val Asp Arg Leu Leu Pro Asp Leu Ser Ala Met Pro
100 105 110
Val Leu Glu Gly Phe Asp Asp Ala Gly Asn Ala Arg Leu Arg Glu Arg
115 120 125
Arg Gly Lys Ile Thr Leu Arg His Leu Leu Thr His Thr Ser Gly Leu
130 135 140
Ser Tyr Val Phe Leu His Pro Leu Leu Arg Glu Tyr Met Ala Gln Gly
145 150 155 160
His Leu Gln Ser Ala Glu Lys Phe Gly Ile Gln Ser Arg His Ala Pro
165 170 175
Pro Val Val Asn Asp Pro Gly Ala Glu Trp Ile Tyr Gly Ala Met Leu
180 185 190
Asp Trp Ala Gly Lys Leu Val Glu Arg Ala Thr Gly Leu Asp Leu Glu
195 200 205
Gln Tyr Leu Gln Glu Asn Ile Cys Ala Pro Leu Gly Ile Thr Asp Met
210 215 220
Thr Phe Lys Leu Gln Gln Arg Pro Asp Met Leu Ala Arg Arg Ala Asp
225 230 235 240
Gln Thr His Arg Asn Ser Ala Asp Gly Arg Leu Arg Tyr Asp Asp Ser
245 250 255
Val Tyr Phe Arg Trp Asp Gly Glu Glu Cys Phe Gly Gly Gln Gly Val
260 265 270
Phe Ser Gly Pro Gly Ser Tyr Met Lys Val Leu His Ser Leu Leu Lys
275 280 285
Arg Asp Gly Leu Leu Leu Gln Pro Gln Thr Val Asp Met Met Phe Gln
290 295 300
Pro Ala Leu Glu Pro Arg Leu Glu Glu Gln Met Asn Gln His Met Asp
305 310 315 320
Ala Ser Pro His Ile Asn Tyr Gly Gly Pro Met Pro Met Val Leu Arg
325 330 335
Arg Ser Phe Gly Leu Gly Gly Ile Ile Ala Leu Glu Asp Leu Asp Gly
340 345 350
Glu Asp Trp Arg Arg Lys Gly Ser Leu Thr Phe Gly Gly Gly Pro Asn
355 360 365
Ile Val Trp Gln Ile Asp Pro Lys Ala Gly Leu Cys Thr Leu Ala Phe
370 375 380
Phe Gln Leu Glu Pro Trp Asn Asp Pro Val Cys Arg Asp Leu Thr Arg
385 390 395 400
Thr Phe Glu Arg Ala Ile Tyr Ala Gln Tyr Gln Gln Gly
405 410
<210> 5
<211> 6061
<212> DNA
<213> artificial sequence
<400> 5
aattttgtgt cgcccttaat tgtgagcgga taacaattac gagcttcatg cacagtgaaa 60
tcatgaaaaa tttatttgct ttgtgagcgg ataacaatta taatatgtgg aattgtgagc 120
gctcacaatt ccacaacggt ttccctctag aaataatttt gtttaacttt taggaggtaa 180
aacatatggg ttctatcatc gacgctgctg ctgctgctga cccggttgtt ctgatggaaa 240
ccgctttccg taaagctgtt aaatctcacc agatcccggg tgctgttatc atggctcgtg 300
actgctctgg taacctgaac tacacccgtt gcttcggtgc tcgtaccgtt cgtcgtgacg 360
aatgcaacca gctgccgccg ctgcaggttg acaccccgtg ccgtctggct tctgctacca 420
aactgctgac caccatcatg gctctgcagt gcatggaacg tggtctggtt aaactggacg 480
aaaccgttga ccgtctgctg ccggacctgt ctgctatgcc ggttctggaa ggtttcgacg 540
acgctggtaa cgctcgtctg cgtgaacgtc gtggtaaaat caccctgcgt cacctgctga 600
cccacacctc tggtctgtct tacgttttcc tgcacccgct gctgcgtgaa tacatggctc 660
agggtcacct gcagtctgct gaaaaattcg gtatccagtc tcgtcacgct ccgccggttg 720
ttaacgaccc gggtgctgaa tggatctacg gtgctatgct ggactgggct ggtaaactgg 780
ttgaacgtgc taccggtctg gacctggaac agtacctgca ggaaaacatc tgcgctccgc 840
tgggtatcac cgacatgacc ttcaaactgc agcagcgtcc ggacatgctg gctcgtcgtg 900
ctgaccagac ccaccgtaac tctgctgacg gtcgtctgcg ttacgacgac tctgtttact 960
tccgttggga cggtgaagaa tgcttcggtg gtcagggtgt tttctctggt ccgggttctt 1020
acatgaaagt tctgcactct ctgctgaaac gtgacggtct gctgctgcag ccgcagaccg 1080
ttgacatgat gttccagccg gctctggaac cgcgtctgga agaacagatg aaccagcaca 1140
tggacgcttc tccgcacatc aactacggtg gtccgatgcc gatggttctg cgtcgttctt 1200
tcggtctggg tggtatcatc gctctggaag acctggacgg tgaagactgg cgtcgtaaag 1260
gttctctgac cttcggtggt ggtccgaaca tcgtttggca gatcgacccg aaagctggtc 1320
tgtgcaccct ggctttcttc cagctggaac cgtggaacga cccggtttgc cgtgacctga 1380
cccgtacctt cgaacgtgct atctacgctc agtaccagca gggttaaaga ggatcgcatc 1440
accatcacca tcacggatcc gcatgcgagc tcggtacccc gggtcgacct gcagccaagc 1500
ttaattagct gagcttggac tcctgttgat agatccagta atgacctcag aactccatct 1560
ggatttgttc agaacgctcg gttgccgccg ggcgtttttt attggtgaga atccaagcta 1620
gcttggcgag attttcagga gctaaggaag ctaaaatgga gaaaaaaatc actggatata 1680
ccaccgttga tatatcccaa tggcatcgta aagaacattt tgaggcattt cagtcagttg 1740
ctcaatgtac ctataaccag accgttcagc tggatattac ggccttttta aagaccgtaa 1800
agaaaaataa gcacaagttt tatccggcct ttattcacat tcttgcccgc ctgatgaatg 1860
ctcatccgga atttcgtatg gcaatgaaag acggtgagct ggtgatatgg gatagtgttc 1920
acccttgtta caccgttttc catgagcaaa ctgaaacgtt ttcatcgctc tggagtgaat 1980
accacgacga tttccggcag tttctacaca tatattcgca agatgtggcg tgttacggtg 2040
aaaacctggc ctatttccct aaagggttta ttgagaatat gtttttcgtc tcagccaatc 2100
cctgggtgag tttcaccagt tttgatttaa acgtggccaa tatggacaac ttcttcgccc 2160
ccgttttcac catgggcaaa tattatacgc aaggcgacaa ggtgctgatg ccgctggcga 2220
ttcaggttca tcatgccgtt tgtgatggct tccatgtcgg cagaatgctt aatgaattac 2280
aacagtactg cgatgagtgg cagggcgggg cgtaattttt ttaaggcagt tattggtgcc 2340
cttaaacgcc tggggtaatg actctctagc ttgaggcatc aaataaaacg aaaggctcag 2400
tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg tgaacgctct cctgagtagg 2460
acaaatccgc cctctagatt acgtgcagtc gatgataagc tgtcaaacat gagaattgtg 2520
cctaatgagt gagctaactt acattaattg cgttgcgctc actgcccgct ttccagtcgg 2580
gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 2640
gtattgggcg ccagggtggt ttttcttttc accagtgaga cgggcaacag ctgattgccc 2700
ttcaccgcct ggccctgaga gagttgcagc aagcggtcca cgctggtttg ccccagcagg 2760
cgaaaatcct gtttgatggt ggttaacggc gggatataac atgagctgtc ttcggtatcg 2820
tcgtatccca ctaccgagat atccgcacca acgcgcagcc cggactcggt aatggcgcgc 2880
attgcgccca gcgccatctg atcgttggca accagcatcg cagtgggaac gatgccctca 2940
ttcagcattt gcatggtttg ttgaaaaccg gacatggcac tccagtcgcc ttcccgttcc 3000
gctatcggct gaatttgatt gcgagtgaga tatttatgcc agccagccag acgcagacgc 3060
gccgagacag aacttaatgg gcccgctaac agcgcgattt gctggtgacc caatgcgacc 3120
agatgctcca cgcccagtcg cgtaccgtct tcatgggaga aaataatact gttgatgggt 3180
gtctggtcag agacatcaag aaataacgcc ggaacattag tgcaggcagc ttccacagca 3240
atggcatcct ggtcatccag cggatagtta atgatcagcc cactgacgcg ttgcgcgaga 3300
agattgtgca ccgccgcttt acaggcttcg acgccgcttc gttctaccat cgacaccacc 3360
acgctggcac ccagttgatc ggcgcgagat ttaatcgccg cgacaatttg cgacggcgcg 3420
tgcagggcca gactggaggt ggcaacgcca atcagcaacg actgtttgcc cgccagttgt 3480
tgtgccacgc ggttgggaat gtaattcagc tccgccatcg ccgcttccac tttttcccgc 3540
gttttcgcag aaacgtggct ggcctggttc accacgcggg aaacggtctg ataagagaca 3600
ccggcatact ctgcgacatc gtataacgtt actggtttca cattcaccac cctgaattga 3660
ctctcttccg ggcgctatca tgccataccg cgaaaggttt tgcaccattc gatggtgtcg 3720
gaatttcggg cagcgttggg tcctggccac gggtgcgcat gatctagagc tgcctcgcgc 3780
gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt 3840
gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg 3900
ggtgtcgggg cgcagccatg acccagtcac gtagcgatag cggagtgtat actggcttaa 3960
ctatgcggca tcagagcaga ttgtactgag agtgcaccat atgcggtgtg aaataccgca 4020
cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc 4080
gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 4140
gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 4200
ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 4260
cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 4320
ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 4380
taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 4440
ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 4500
ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 4560
aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 4620
tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 4680
agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 4740
ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 4800
tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 4860
tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 4920
cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 4980
aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 5040
atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 5100
cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 5160
tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 5220
atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 5280
taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 5340
tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 5400
gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 5460
cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 5520
cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 5580
gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 5640
aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 5700
accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 5760
ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 5820
gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 5880
aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 5940
taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac 6000
cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtcttca 6060
c 6061
Claims (10)
1. come from the acylase mutant of the increased activity of terreus (Aspergillus terreus); it is characterized in that; it is the acylase mutant of the fermentative production that can be used for Simvastatin; wherein; sudden change is insertion in the aminoacid sequence of parent's acyltransferase, replaces or lack one or more amino acid; or add at one or two end of the aminoacid sequence of parent's acyltransferase or delete one or more amino acid; and compared with use parent acyltransferase, its acyltransferase activity strengthens 2-50 doubly.
2. the acylase mutant coming from the increased activity of terreus (Aspergillus terreus) according to claim 1; it is characterized in that; described mutant has the aminoacid replacement on following one or more amino acid positions; each replacement triplet represents: alphabet-numeric playing-letter; the wherein position of numeral mutating acid; the amino acid of the letter correspondence sudden change design before numeral; letter representation after numeral is for replacing front amino acid whose amino acid: the R28H of numeral; D96K; L174H, A178V, N191M; A261W, H404R.
3. the acylase mutant coming from the increased activity of terreus (Aspergillus terreus) according to claim 2, it is characterized in that, described mutant comprises the aminoacid sequence of SEQ ID NO.4.
4. described in any one of claim 1-3, come from the encoding gene of the acylase mutant of the increased activity of terreus (Aspergillus terreus).
5. encoding gene according to claim 4, is characterized in that, it comprises the DNA sequence dna described in SEQ ID NO.3.
6. the recombinant vectors containing encoding gene according to claim 4.
7. a recombinant plasmid, is characterized in that: the sequence comprising SEQ ID NO.5.
8. the host cell containing carrier described in claim 6.
9. the acylase mutant coming from the wild-type acyltransferase of terreus described in any one of claim 1-3 is producing the application in Simvastatin sodium salt.
10. produce a method for Simvastatin sodium salt, it is characterized in that, described method for substrate, under the katalysis of the mutant described in any one of claim 1-3, obtains Simvastatin sodium salt with citrinin J sodium salt.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310345811.0A CN104342417A (en) | 2013-08-09 | 2013-08-09 | Aspergillus terreus-derived activity-enhanced acyltransferase mutant |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310345811.0A CN104342417A (en) | 2013-08-09 | 2013-08-09 | Aspergillus terreus-derived activity-enhanced acyltransferase mutant |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104342417A true CN104342417A (en) | 2015-02-11 |
Family
ID=52498879
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310345811.0A Pending CN104342417A (en) | 2013-08-09 | 2013-08-09 | Aspergillus terreus-derived activity-enhanced acyltransferase mutant |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104342417A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007139871A2 (en) * | 2006-05-24 | 2007-12-06 | The Regents Of The University Of California | Methods and materials for making simvastatin and related compounds |
US7531317B2 (en) * | 2003-11-25 | 2009-05-12 | Wisconsin Alumni Research Foundation | Fluorescence polarization assay to detect protease cleavage |
CN102574896A (en) * | 2009-09-30 | 2012-07-11 | 科德克希思公司 | Variant lovd polypeptides and their uses |
CN102695792A (en) * | 2009-10-08 | 2012-09-26 | 加利福尼亚大学董事会 | LovD mutants exhibiting improved properties towards simvastatin synthesis |
-
2013
- 2013-08-09 CN CN201310345811.0A patent/CN104342417A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7531317B2 (en) * | 2003-11-25 | 2009-05-12 | Wisconsin Alumni Research Foundation | Fluorescence polarization assay to detect protease cleavage |
WO2007139871A2 (en) * | 2006-05-24 | 2007-12-06 | The Regents Of The University Of California | Methods and materials for making simvastatin and related compounds |
CN102574896A (en) * | 2009-09-30 | 2012-07-11 | 科德克希思公司 | Variant lovd polypeptides and their uses |
CN102695792A (en) * | 2009-10-08 | 2012-09-26 | 加利福尼亚大学董事会 | LovD mutants exhibiting improved properties towards simvastatin synthesis |
Non-Patent Citations (1)
Title |
---|
BIRREN,B., ET AL.: "Genbank accession number:XM_001209266.1", 《GENBANK》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102056651B1 (en) | Pichia ciferrii cells and use thereof | |
CN111909958B (en) | Construction of vascular smooth muscle cell conditional knockout Yap1 gene mouse model | |
CN108715825B (en) | Gene overexpression, strain obtained by gene overexpression and application of gene overexpression | |
CN1886425A (en) | Methods, kits, and compositions for the development and use of monoclonal antibodies specific to antigens traditionally of low immunogenicity | |
CN102010870B (en) | High-expression streptolysin O (SLO) gene as well as secreting expression vector and application thereof | |
CN108998464B (en) | pSP107 plasmid and application and construction method thereof | |
CN112680477B (en) | Seamless cloning technology-based H9N2 subtype avian influenza virus rescue method | |
CN108004274B (en) | Method for producing acrylic acid by fermentation of saccharomyces cerevisiae | |
KR20160019451A (en) | Whole-cell system for cytochrome p450 monooxygenases biocatalysis | |
CN113388612A (en) | Primer designed for TCR with epitope point of IYVLVMLVL and application thereof | |
CN113215155A (en) | Primer designed for TCR with epitope point of FLYALALLL and application thereof | |
KR20190133940A (en) | Recombinant Corynebacterium Producing 1,3-PDO and Inhibited 3-HP Production and Method for Preparing 1,3-PDO Using Thereof | |
CN104342417A (en) | Aspergillus terreus-derived activity-enhanced acyltransferase mutant | |
CN114195884B (en) | Recombinant human collagen and preparation method thereof | |
CN113493800B (en) | Method for improving secretion or surface display expression of heterologous protein in saccharomyces cerevisiae | |
CN110331148B (en) | Gene for coding IFN alpha protein, recombinant vector pELSH-IFN alpha, recombinant lactobacillus casei and application | |
KR102009266B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type SAT2 ZIM | |
CN110777146A (en) | Construction method of PDGFB (platelet-derived growth factor receptor) promoter activity report plasmid | |
CN113308466A (en) | Primer designed for TCR with epitope point of TYGPVFMSL and application thereof | |
JP2711326B2 (en) | Yellowtail growth hormone structural gene DNA | |
KR20190096910A (en) | Vaccine vector for porcine epidemic diarrhea virus(pedv) inducibly expressed under bile acid, transformed recombinant lactic acid bacteria and manufacturing method thereof | |
JPH09191888A (en) | Yellowtail growing hormone protein | |
KR102009267B1 (en) | Recombinant foot-and-mouth disease virus expressing protective antigen of type SAT3 ZIM | |
KR102176556B1 (en) | Strain with increased squalene production and method for producing squalene using the same | |
CN1212402C (en) | Multi copy yeast expression carrier for proceeding correct secretory expression against exogenous gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150211 |
|
RJ01 | Rejection of invention patent application after publication |