CN104313161A - Nucleotide sequence and method for verifying milk components and beef bone powder components in feed - Google Patents
Nucleotide sequence and method for verifying milk components and beef bone powder components in feed Download PDFInfo
- Publication number
- CN104313161A CN104313161A CN201410592622.8A CN201410592622A CN104313161A CN 104313161 A CN104313161 A CN 104313161A CN 201410592622 A CN201410592622 A CN 201410592622A CN 104313161 A CN104313161 A CN 104313161A
- Authority
- CN
- China
- Prior art keywords
- bone meal
- beef bone
- feed
- seq
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kit and an oligonucleotide for verifying beef bone powder components in a feed, and particularly relates to a group of oligonucleotides for verifying the beef bone powder components as shown in sequence tables SEQ ID No.3 and SEQ ID No.4, and a kit containing these oligonucleotides and a detection method thereof. The kit provided by the invention is high in sensitivity, strong in specificity, low in cost and simple to operate.
Description
Technical field
The present invention relates to inspection and quarantine and biological technical field, specifically, relate to a kind of method differentiating milk elements and beef bone meal component in feed.
Background technology
For preventing mad cow disease from importing China into by feed and other animal product, China according to the BSE trade ban that OIE code is formulated define forbid from the direct or indirect import in mad cow disease countries and regions except ox-hide, ox Milk and milk products, ox seminal fluid, ox embryo, without the ox except albumen grease and products thereof, bone secondary calcium phosphate (not containing albumen or grease), the industrial gelatin processed by leather or hide completely and collagen, photographic gelatin, non-ruminant animal source feed and product (exporting country or area prohibit the use except) and dairy products.The raw material deriving from cattle and sheep that may add in feed and feed additive production comprises: digested tankage, bone meal, blood and its derivatives, internal organ and goods thereof, milk and goods thereof.In these possibility raw materials, except milk and goods permission thereof exist in import feedstuff by PCR assay and additive, other composition is all do not allow to add.
The domestic and international Study on Identification for same kind different tissues ingredient origin is also fewer at present, after mainly containing enzyme-linked immunosorbent assay (ELISA), chloroform separation, PCR detection method, water and clorox wash rear PCR detection method, the use range of these methods is very narrow, and specificity is not high, therefore also seldom apply in practice.Whether check on main adopt regular-PCR method or the real time fluorescent PCR method of current China to import animal-feed and fodder additives detects containing calf-derived Cyclospora in feed, but these class methods differentiate Species origin, cannot the tissue-derived of composition be differentiated and be distinguished, namely cannot distinguish wherein add be allow add milk-derived composition, still add the structural constituent within the scope of trade ban.What this technology was set up is a kind of detection method can carrying out tissue-derived discriminating to the calf-derived Cyclospora in feed, differentiate with extraneous ox source property structural constituent within the scope of trade ban in feed, meet the needs that in enter the territory feed and fodder additives, mad cow disease Hazardous substances detects, to realize science, effective law enforcement is checked on, also can be used to the fodder production of specification China simultaneously, ensure livestock product safety and people's life health.
Summary of the invention
First technical problem that the present invention will solve is to provide a kind of oligonucleotide for differentiating beef bone meal component.
Second technical problem that the present invention will solve is to provide a kind of highly sensitive, high specificity, the test kit for differentiating beef bone meal component easy and simple to handle.
The 3rd technical problem that the present invention will solve is to provide a kind of method differentiating beef bone meal component in feed.
For achieving the above object, the present invention is by the following technical solutions:
The invention provides and organize subject matter for what differentiate beef bone meal component: the RNA sequence of one section of 98bp of ox bone Fibronectin mRNA, it has the base sequence as shown in sequence table SEQ ID No.1.
5’-GAUGGUGCUGAGGAAACCGAAGAGGAGGUGGUGGCCGAGAACCCCUGCCAGAACCACCACUGCAAACACGGCAAGGUGUGCGAACUGGACGAGAACAA-3’
Wherein, the base sequence that ox bone Fibronectin is corresponding is as shown in SEQ ID No.2.
According to the mRNA sequence of the above-mentioned ox bone Fibronectin chosen, the invention provides one group for differentiating the oligonucleotide of beef bone meal component, it has the base sequence shown in SEQ ID No.3 and SEQ ID No.4, and concrete sequence is as follows:
Upstream primer sequence: 5 '-GATGGTGCTGAGGAAACCGA-3 ' (SEQ ID No.3)
Downstream primer sequence: 5 '-TTGTTCTCGTCCAGTTCGCA-3 ' (SEQ ID No.4)
Present invention also offers a kind of test kit of highly sensitive, high specificity, discriminating beef bone meal component easy and simple to handle, comprise following reagent:
1) RT-PCR reaction solution, it comprises:
Upstream primer, downstream primer, reversed transcriptive enzyme, Taq polysaccharase and RT-PCR buffer;
Wherein, upstream primer and downstream primer are the nucleotide sequence shown in SEQ ID No.3 and SEQ ID No.4 respectively;
Further, the present invention's reversed transcriptive enzyme used is generally commercial reagents, such as
rT Enzyme Mix II, purchased from Takara company; The present invention's Taq polysaccharase used is generally commercial reagents, such as TaKaRa Ex
hS (5U/ μ l), purchased from Takara company; The present invention RT-PCR buffer used is generally commercial reagents, such as 2 × One Step
rT-PCR Buffer III, purchased from Takara company.
2)RNase Free dH
2O；
3) negative control, described negative control is the total serum IgE extracted from cow's milk;
4) positive control, described positive control is the total serum IgE extracted from beef bone meal.
Present invention also offers a kind of using method differentiating the test kit of beef bone meal component, the method, based on the mRNA sequence of ox bone Fibronectin and Auele Specific Primer, the method being differentiated beef bone meal component in feed by real-time fluorescence RT-PCR method, is comprised the following steps:
1) get testing sample grinding, extract total serum IgE;
Wherein, extract total serum IgE to extract according to method for extracting total RNA such as Trizol method or commercial reagents methods;
2) carry out fluorescence RT-PCR amplification, the primer wherein used is the upstream and downstream primer shown in sequence table SEQ ID No.3 and SEQ ID No.4; This reaction system is according to the preparation of single stage method reaction system, and concrete component and proportioning are in table 1:
Table 1 real-time fluorescence RT-PCR reaction system component and proportioning (cumulative volume 20 μ l)
The exemplary amount having enumerated each reactive component when total reaction system is 20 μ l of table 1, in the present invention, also can adjust the amount of each reactive component according to appliance requires.
Fluorescence RT-PCR reaction parameter is as follows:
Reverse transcription reaction: 42 DEG C 5 minutes, 95 DEG C 10 seconds, 1 circulation;
PCR react: 95 DEG C 5 seconds, 64 DEG C 20 seconds, 40 circulations;
Solubility curve analyze: 95 DEG C 0 second, 65 DEG C 15 seconds, 95 DEG C 0 second;
Fluorescent PCR instrument 530 passage collects signal, and reaction terminates rear confirmation amplification curve and solubility curve;
For the ease of analyzing and testing result, can use positive control and negative control in RT-PCR amplification step, described negative control is the total serum IgE extracted from cow's milk, and described positive control is the total serum IgE extracted from beef bone meal.
Further, for the ease of analyzing and testing result, also can set up without Template Controls, namely replace template ribonucleic acid with sterilized water.
3) result judges:
Beef bone meal and cow's milk can amplify object fragment.The dissolving peak of beef bone meal is at 83 DEG C, and cow's milk does not dissolve peak near 83 DEG C.
Negative result: S shape amplification curve all appears in negative control, positive control; Negative control does not dissolve peak near 83 DEG C, and positive control has at 83 DEG C and obviously dissolves peak; And sample does not occur dissolving peak at 83 DEG C, then judge in sample not containing beef bone meal component.
Positive test symbol: S shape amplification curve all appears in negative control, positive control; Negative control does not dissolve peak near 83 DEG C, and positive control has at 83 DEG C and obviously dissolves peak; And sample occurs dissolving peak at 83 DEG C, then judge in sample containing beef bone meal component.
Test is false: detected result is invalid in a case where, and test is false: negative control and/or positive control do not occur at 83 DEG C, S shape amplification curve, negative control occur that dissolving peak or positive control do not occur dissolving peak at 83 DEG C.
The present invention has following beneficial effect:
(1) the present invention provides a kind of method of the calf-derived Cyclospora for distinguishing different tissue sources first, namely distinguishing feed ban allows the milk elements of interpolation and feed ban to forbid the method for the beef bone meal component added, this method solve current method therefor and can only detect Species origin, and can not dividing tissue source problem, there is good application prospect.
(2) the testing goal thing that the present invention selects is the fragment of one section of 98bp of ox bone Fibronectin mRNA, and experiment proves, the stability of this fragment is comparatively strong, still can detect after the high temperature working processes of meat meal tankage.
(3) method that the present invention sets up has higher susceptibility, can detect the mixed feed containing 0.5% meat meal tankage;
(4) method that the present invention sets up has very high tissue specificity, effectively can distinguish cow's milk and beef bone meal; The method also has good species specificity simultaneously, beef bone meal component and chicken, duck, pig derived component can be distinguished very well, there is a small amount of cross reaction with sheep derived material, but because sheep derived material is also in the scope that feed ban is forbidden, therefore do not affect the practical application of method.
(4) the present invention adopts one-step method real-time fluorescent RT-PCR method, precise and high efficiency, simple and easy to do, is convenient to promote in actual applications.
Below in conjunction with specification drawings and specific embodiments, the invention will be further described, and the equivalent replacement of all any this areas of doing according to the disclosure of invention, all belongs to protection scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, the method provided according to molecular biosciences ordinary method or manufacturers.
Accompanying drawing explanation
Fig. 1 is the solubility curve of ox bone Fibronectin; Wherein, 1 be beef bone meal 1,2 be beef bone meal 2,3 is skim-milk, and 4 is whey powder;
Fig. 2 is the solubility curve that embodiment 4 fluorescence RT-PCR method detects the sensitivity test each sample of beef bone meal component; Wherein, 1 is the feed of 20% beef bone meal, and 2 is the feed of 10% beef bone meal, and 3 is the feed of 5% beef bone meal, and 4 is the feed of new 2.5% beef bone meal, and 5 is the feed of 1% beef bone meal, and 6 is the feed of 0.5% beef bone meal, and 7 is negative control;
Fig. 3 is the solubility curve that embodiment 5 fluorescence RT-PCR method detects the specific test each sample of beef bone meal component; Wherein, 1 be beef bone meal 1,2 be beef bone meal 2,3 is mutton bone meal, and 4 is chicken, and 5 is pork, and 6 is milk powder 1, and 7 is milk powder 2, and 8 is fresh milk, and 9 is duck;
Fig. 4 is the solubility curve that in embodiment 6, fluorescence PCR method detects the application test each sample of beef bone meal component; Wherein, 1 be domestic beef bone meal 1,2 be domestic beef bone meal 2,3 is fresh milk, and 4 be commercially available dried milk powder 1,5 be commercially available dried milk powder 2,6 is whey powder, and 7 is negative control.
Embodiment
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments only unrestricted use range of the present invention for illustration of research process of the present invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, as the people such as Sambrook " molecular cloning: laboratory manual " (Cold Spring Harbor Laboratory Press of showing, 1989) condition described in, or according to the condition that manufacturer advises.
The selection of embodiment 1 cattle tissue component target sequence and the Design and synthesis of primer
For differentiating cow's milk derived component and the calf-derived Cyclospora forbidding adding, need to find a kind of tissue specific marker as detection mark, this mark should have following characteristic:
(1) this mark can detect in bone, muscle, blood, internal organ;
(2) this mark can not detect in milk;
(3) this mark has certain stability, namely after bone, muscle and internal organ being processed into the course of processing of meat meal tankage, still can detect;
(4) have in kind conservative, and between kind, have specific feature.
For screening suitable target sequence as detection mark, the mRNA fragment (ox troponin, ox bone calsequestrin, bovine osteopontin, ox silaoprotein, ox bone Fibronectin, ox calcium binding protein, ox calmodulin) that the present invention have selected the specific protein of expressing in 7 kinds of muscle or bone carries out design of primers and synthesis.According to the mRNA fragment of 7 species-specific proteins of including in Genbank, compare with DNAMAN software, consider the interference for avoiding genomic dna, the upstream and downstream primer designed lays respectively at 2 adjacent exons, software Primer Premier 5 is used to carry out design of primers, and assay is carried out to primer, design the universal primer of every species-specific proteins.All primers are synthesized by Takara (Dalian is precious biological) company, and PAGE purifying, TE Buffer (PH7.5-8) dissolves, and packing ,-20 DEG C save backup.
Table 2.7 kind detects the primer sequence of target protein
Note: cytosine(Cyt) (C), guanine (G), VITAMIN B4 (A), thymus pyrimidine (T)
Select the One Step of TaKaRa company
rT-PCR kit, by repetition test, proves, in 7 kinds of selected marks, to only have ox bone Fibronectin can meet above-mentioned 4 requirements, therefore selects ox bone Fibronectin mRNA fragment as detection target compound.Fig. 1 is the amplification solubility curve of ox bone Fibronectin, and as shown in Figure 1, the dissolving peak of the RT-PCR amplification of ox bone Fibronectin is at 83 DEG C.
The extraction of embodiment 2 sample total serum IgE
Use TIANGEN company RNA to extract test kit and extract total serum IgE, concrete operations are as follows:
(1) sample thief 25mg, adds 1ml lysate RZ, mixing of fully vibrating.
(2) sample is placed 5 minutes in room temperature.Centrifugal 5 minutes of 4 DEG C of 12000rpm, get supernatant, proceed to one new in the centrifuge tube of RNase.
(3) add 200 μ l chloroforms, build pipe lid, thermal agitation 15 seconds, room temperature places 3 minutes.
Centrifugal 10 minutes of (4) 4 DEG C of 12000rpm, sample is divided into three layers: yellow organic phase, middle layer and colourless aqueous phase, RNA is mainly in aqueous phase, and the volume of aqueous phase is about 50% of lysate RZ reagent used.Aqueous phase is transferred in new pipe.
(5) 1.5 times of volume dehydrated alcohols are slowly added, mixing.To obtain solution proceeds in adsorption column CR3 together with precipitation, and centrifugal 30 seconds of 4 DEG C of 12000rpm, discard the waste liquid in collection tube.
(6) in adsorption column CR3, add 500 μ l protein liquid removal RD, centrifugal 30 seconds of 4 DEG C of 12000rpm, abandon waste liquid.
(7) in adsorption column CR3, add 600 μ l rinsing liquid RW, room temperature leaves standstill 2 minutes, centrifugal 30 seconds of 4 DEG C of 12000rpm, its waste liquid.
(8) last action step is repeated.
(9) adsorption column is put into 2ml collection tube, centrifugal 2 minutes of 4 DEG C of 12000rpm, remove residual liquid.
(10) adsorption column CR3 is placed room temperature 2 minutes, fully to dry.
(11) proceeded to by adsorption column CR3 in a new centrifuge tube, add 50 μ l RNase-free ddH2O, room temperature places 2 minutes, centrifugal 2 minutes of 4 DEG C of 12000rpm.
The foundation of embodiment 3 real-time fluorescent RT-PCR method for detecting
Select the One Step of TaKaRa company
rT-PCR kit carries out RT-PCR amplification, by repetition test, is optimized reaction system and reaction conditions, to reach best experiment effect.
Finally determine that reaction system is as follows:
SYBR Real Time RT-PCR reaction conditions arranges as follows:
Stage 1 reverse transcription
Stage 2 PCR
Stage 3 solubility curve
Embodiment 4 differentiates the sensitivity test of the method for beef bone meal component in feed
1. method
In pure plant mixed feed, add the beef bone meal that mass ratio is 20%, 10%, 5%, 2.5%, 1%, 0.5% respectively, stir.Wherein pure plant mixed feed is provided by Beijing friendship Heng Xin animal Science and Technology Ltd., New Zealand's imported beef bone meal that beef bone meal provides for Beijing Fu Shijian International Trading Company Ltd.
Adopt of the present invention for differentiating that the test kit of beef bone meal component detects detection sample and carries out real-time fluorescent PCR amplification.
2. result
Detected result is shown in Fig. 2, and as shown in Figure 2, the method can detect the mixed feed containing 0.5% beef bone meal.Prove that the method has higher susceptibility thus.
Embodiment 5 differentiates the specific test of the method for beef bone meal component in feed
1. method:
Detection sample selected by the present embodiment is beef bone meal 2 parts, different brands milk powder 2 parts, fresh milk 1 part, 1 part, mutton bone meal powder, 1 part, chicken, duck 1 part, pork 1 part.
Adopt of the present invention for differentiating that the test kit of beef bone meal component detects detection sample.
2. result
Detected result is shown in Fig. 3, and as shown in Figure 3, method of the present invention can only detect beef bone meal component, and to cow's milk, chicken, duck, pig composition all without detecting signal.Due to cow genome group and sheep genomic sequence homology higher, applying detection method of the present invention and mutton bone meal detected, also can see little dissolving peak closing on Tm position.Due to the forage component that mutton bone meal is also import prohibition, therefore detected result does not affect the practical application of method, and the specificity of the method also can meet the needs of practical application.
Embodiment 6 differentiates the application verification of the method for beef bone meal component in feed
1. method
Sample selected by this enforcement is respectively 2 parts of domestic beef bone meal, the commercially available dried milk powder of 2 parts of different brands, 1 portion of fresh milk, 1 portion of whey powder.
The test kit of discriminating beef bone meal component of the present invention is adopted to detect detection sample.
2. result
Detected result is shown in Fig. 4, and as shown in Figure 4, only have beef bone meal to occur in target temperature regime dissolving peak, other sample does not all occur in target temperature regime dissolving peak.Result shows, test kit of the present invention can effectively be differentiated beef bone meal.
Obviously, the above embodiment of the present invention is only for example of the present invention is clearly described, and is not the restriction to embodiments of the present invention.For those of ordinary skill in the field, can also make other changes in different forms on the basis of the above description.Here cannot give exhaustive to all embodiments.Every belong to technical scheme of the present invention the apparent change of extending out or variation be still in the row of protection scope of the present invention.
Claims (4)
1. one group for differentiating the oligonucleotide of beef bone meal component in feed, and it is characterized in that, its nucleotide sequence is by shown in SEQ ID No.3 and SEQ ID No.4.
2. oligonucleotide as claimed in claim 1 is for the preparation of the application differentiated in the test kit of beef bone meal component in feed.
3., for differentiating a test kit for beef bone meal component in feed, it is characterized in that, composed of the following components:
1) RT-PCR reaction solution, it comprises: upstream primer, downstream primer, reversed transcriptive enzyme, Taq polysaccharase and RT-PCR buffer;
Wherein, upstream primer and downstream primer are the nucleotide sequence shown in SEQ ID No.3 and SEQ ID No.4 respectively;
2)RNase Free dH
2O；
3) negative control;
4) positive control.
4. differentiate a method for beef bone meal component in feed, it is characterized in that, comprise the following steps:
1) get testing sample, extract total serum IgE;
2) carry out real-time fluorescence RT-PCR amplification, and draw amplification curve and solubility curve, the primer wherein used is the upstream and downstream primer shown in sequence table SEQ ID No.3 and SEQ ID No.4;
3) result judges:
Negative result: sample does not occur dissolving peak at 83 DEG C of places, then judge in sample not containing beef bone meal component.
Positive test symbol: sample occurs dissolving peak at 83 DEG C of places, then judge in sample containing beef bone meal component.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410592622.8A CN104313161B (en) | 2014-10-29 | 2014-10-29 | Nucleotide sequence and method for verifying milk components and beef bone powder components in feed |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410592622.8A CN104313161B (en) | 2014-10-29 | 2014-10-29 | Nucleotide sequence and method for verifying milk components and beef bone powder components in feed |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104313161A true CN104313161A (en) | 2015-01-28 |
| CN104313161B CN104313161B (en) | 2017-01-11 |
Family
ID=52368470
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410592622.8A Active CN104313161B (en) | 2014-10-29 | 2014-10-29 | Nucleotide sequence and method for verifying milk components and beef bone powder components in feed |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104313161B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104962618A (en) * | 2015-06-08 | 2015-10-07 | 南京农业大学 | Labeling primers and methods for conducting beef and mutton identification with HPM method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003087345A2 (en) * | 2002-04-04 | 2003-10-23 | Isis Innovation Limited | Stimulation of nerve cell regeneration |
-
2014
- 2014-10-29 CN CN201410592622.8A patent/CN104313161B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003087345A2 (en) * | 2002-04-04 | 2003-10-23 | Isis Innovation Limited | Stimulation of nerve cell regeneration |
Non-Patent Citations (2)
| Title |
|---|
| KOUROS MOTAMED: "SPARC (osteonectin/BM-40)", 《THE INTERNATIONAL JOURNAL OF BIOCHEMISTRY & CELL BIOLOGY》 * |
| 黄士新等: "荧光PCR 法定量检测动物源性饲料中的牛、羊成分", 《上海畜牧兽医通讯》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104962618A (en) * | 2015-06-08 | 2015-10-07 | 南京农业大学 | Labeling primers and methods for conducting beef and mutton identification with HPM method |
| CN104962618B (en) * | 2015-06-08 | 2018-12-21 | 南京农业大学 | It is a kind of to carry out the labeled primer and method that ox/mutton identifies using HRM method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104313161B (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101318311B1 (en) | A method for identifying a pork content in a food | |
| Prusakova et al. | A simple and sensitive two-tube multiplex PCR assay for simultaneous detection of ten meat species | |
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN104946788B (en) | A kind of PCR primer and kit for differentiating 8 kinds of animal derived materials | |
| M. V et al. | Molecular detection of meat animal species targeting MT 12S rRNA gene | |
| Mane et al. | Detection of adulteration of meat and meat products with buffalo meat employing polymerase chain reaction assay | |
| Arslan et al. | Identification of meats using random amplified polymorphic DNA (RAPD) technique | |
| CN105648046B (en) | Method for identifying sheep, goat, mink, nutria and duck meat at one time | |
| CN111334585B (en) | Primer and kit for simultaneously detecting 8 animal components, detection method and application | |
| CN103290103A (en) | Illegal cooling oil identification method and application thereof | |
| CN102643912B (en) | Amplification primer for detecting mink derived ingredients | |
| CN101845508B (en) | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA | |
| CN105063229A (en) | Specific primers and probe by fluorogenic quantitative PCR (Polymerase Chain Reaction) for detecting sheep-derived ingredients in meat products and kit thereof | |
| CN103122373B (en) | Real-time fluorescence PCR (polymerase chain reaction) reagent kit and real-time fluorescence PCR detection method for specific detection of salmonidae fishes | |
| Woźny et al. | Differential gene expression in rainbow trout (Oncorhynchus mykiss) liver and ovary after exposure to zearalenone | |
| CN104962650B (en) | A kind of synchronous PCR method and kit for differentiating animal derived materials | |
| CN104313161A (en) | Nucleotide sequence and method for verifying milk components and beef bone powder components in feed | |
| Mane et al. | Detection of pork in admixed meat and meat products by species-specific PCR technique | |
| JP3896272B2 (en) | Judgment method of natural leather products | |
| CN104611454B (en) | The primer sets of the blue fox of a kind of detection simultaneously, racoon dog and dog Species composition and application thereof | |
| CN105969839B (en) | Taqman-LNA (low-noise amplifier) multiple fluorescence quantitative PCR (polymerase chain reaction) method for simultaneously detecting bovine and porcine derived components in meat and meat products, primer probe and kit | |
| CN101519682B (en) | Method for detecting cat source components in food and fodder and kit | |
| CN104313022A (en) | Nucleotide sequence and method for identifying goat milk component and mutton bone meal component in feed | |
| CN102382891B (en) | PCR primer pair for identifying or assisting in identifying tissue and/or organ of cat and application thereof | |
| JP2003164287A (en) | Primer sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |