CN104313037A - Preparation method of recombinant antigen for detecting swine fever virus - Google Patents
Preparation method of recombinant antigen for detecting swine fever virus Download PDFInfo
- Publication number
- CN104313037A CN104313037A CN201410494375.8A CN201410494375A CN104313037A CN 104313037 A CN104313037 A CN 104313037A CN 201410494375 A CN201410494375 A CN 201410494375A CN 104313037 A CN104313037 A CN 104313037A
- Authority
- CN
- China
- Prior art keywords
- csfv
- recombinant
- preparation
- pestivirus suis
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a preparation method of a recombinant antigen for detecting a swine fever virus. The preparation method of the recombinant antigen for detecting the swine fever virus comprises the following steps: synthesizing gene, constructing a recombinant expression vector, expressing an E2 recombinant protein containing the swine fever virus, converting a recombinant expression plasmid to Escherichia coli in order to carry out inducible expression, and collecting thalli after induction; and purifying and renaturating the recombinant protein containing swine fever virus. The E2 full fragment of main antigen epitopes of the swine fever virus is recombined and expressed, so all antigen determinant sites of the E2 are reserved, thereby the false negative phenomenon, that is detection leakage, is effectively avoided; and the preparation method of the recombinant antigen for detecting the swine fever virus has the advantages of short production period, high output and low cost.
Description
Technical field
The invention belongs to biotechnology and diagnosis research field, particularly a kind of preparation method of the recombinant antigen for detecting Pestivirus suis.
Background technology
Swine fever is the hot transmissible disease that a kind of infectivity is very strong, lethality rate is high caused by Pestivirus suis (classical swine fever virus, CSFV).Can cause the various clinical symptoms such as hot systemic sepsis, Sow abortion, fetal anomaly, thus carry out serious harm to industrial belt of raising pigs, animal doctor office of the world is classified as one of category-A 16 kinds of Notifiable diseases.Even to this day, swine fever remains the first transmissible disease of China's pig industry.Along with the progress of diagnostic techniques and epidemic prevention, the generation of swine fever is in the trend reduced in the world, the hazardness of the Pestivirus suis that the duration of service of swine Fever Vaccine and result of use also affect, therefore checks the effect of vaccine and determines that time that vaccine uses will become and effectively control one of effective measure that Pestivirus suis spreads.
The exploitation of in-vitro diagnosis core material is then the prerequisite developing corresponding diagnostic reagent, only develop and there is high reactivity, high performance antigen-antibody, external diagnosis reagent product just can become a reality, therefore, develop can be imminent in order to the raw material producing diagnostic reagent for Pestivirus suis antigen, to some degree, the exploitation of raw material also will become the problem reducing swine fever virus infection and primarily solve.
At present mostly there is at antibody against swine fever virus diagnostic products the Partial Fragment of choosing Pestivirus suis E2 in raw materials for production company or recombinates etc. to the fragment chosen, and accuracy rate is not high, especially more with the cloudy phenomenon of vacation.
Summary of the invention
The present invention is directed to above-mentioned shortcoming, provide a kind of preparation method that can be used for the recombinant antigen detecting Pestivirus suis, object is carried out recombinant expressed for Pestivirus suis E2 entirety, to the core material of this antigen as detection antibody against swine fever virus, avoids false-negative detection leakage phenomenon.
For achieving the above object, the present invention takes following technical proposals to realize:
The invention provides a kind of preparation method of the recombinant antigen for detecting Pestivirus suis, comprising the steps:
Step a, gene chemical synthesis, design primer carries out PCR reaction, obtains the raq gene sequence of Pestivirus suis as shown in SEQ ID No:1;
Step b, build recombinant expression vector, the gene order in step a checks order successfully, after this gene order restriction enzyme is carried out double digestion, is inserted into and cuts in the plasmid expression vector of process with identical two enzymes;
Step c, closes the expression having Pestivirus suis E2 recombinant protein, is converted in intestinal bacteria, carries out abduction delivering by the recombinant expression plasmid in step b, after induction, collects thalline;
Steps d, closes the purifying and the renaturation that there are Pestivirus suis E2 recombinant protein, and the bacterial cell disruption collected by step c extracts recombinant protein, then carries out purifying and renaturation, obtains recombinant protein aminoacid sequence as shown in SEQ ID No:28.
Further, in step a, design primer is as follows:
CSFV-1u：
ATGCAGCTAGCCTGCAAGGAAGATTACAGGTACGCAATATCATCAACCAATGAGATA
CSFV-1d：
ATTCTTTCCAGGTGGTGGTGAGACCTCCGGCCCCGAGTAGCCCTATCTCATTGGTTGA
CSFV-2u：
CCACCTGGAAAGAATACAACCACGATTTGCAACTGAATGACGGGACCGTTAAGGCCATT
CSFV-2d：
TGACCACATTAAGTGCTGTGACTTTAAAGGAACCTGCCACGCAAATGGCCTTAACGGT
CSFV-3u：
CACTTAATGTGGTCAGTAGGAGGTATTTGGCATCATTGCATAAGGAGGCTTCACTCACT
CSFV-3d：
GAGGCTTCACTCACTTCCGTGACATTTGAGCTCCTGTTCGACGGGACCAACCCATCAAC
CSFV-4u：
CAAATGGGCACAGCCCGAACCCGAAGTCATCTCCCATTTCCTCAGTTGATGGGTTGGTC
CSFV-4d：
CAAGGTTGTGTTGTACTTTCCCTTGACAACAGGACTCGTATCAAATGGGCACAGCC
CSFV-5u：
TACAACACAACCTTGTTGAACGGTAGTGCTTACTATCTTGTCTGTCCAATAGGGTGGAC
CSFV-5d：
TTCTCAGAGTTGTTGGGCTCACTGCTGTGCACTCTATAACACCCGTCCACCCTATTGGA
CSFV-6u：
CAACAACTCTGAGAACAGAAGTGGTAAAGACCTTCAGGAGGGACAAGCCCTTTCCGCAC
CSFV-6d：
AATAAATCTTCATTTTCCACTGTTGTGGTCACACAATCCATTCTGTGCGGAAAGGGCTT
CSFV-7u：
AATGAAGATTTATTCTACTGTAAGTTGGGGGGCAACTGGACATGTGTGAAAGGTGAACC
CSFV-7d：
CACACCATCTGCATTGTTTTACTAGCCCCCCCGTGTAGACCACTGGTTCACCTTTCACA
CSFV-8u：
AATGCAGATGGTGTGGCTTTGACTTCAATGAGCCTGACGGACTCCCACACTACCCCATA
CSFV-8d：
TCCACTATTCTGTAACCTGTCTCATTTGCCAAAATGCACTTACCTATGGGGTAGTGTGG
CSFV-9u：
TTACAGAATAGTGGATTCAACAGACTGTAACAGAGATGGTGTCGTAATCAGCACAGAGG
CSFV-9d：
ATGCACCTTGACAGTTGTGTTACCGATCAAGCACTCATGACTCCCCTCTGTGCTGATTA
CSFV-10u：
ACTGTCAAGGTGCATGCATCAGATGAAAGACTGGGCCCCATGCCATGCAGACCTAAAG
CSFV-10d：
TGTACAGGAAGTTTTCCTTACAGGTCCTGCACTAGAGACGATCTCTTTAGGTCTGCATG
CSFV-11u：
AAAACTTCCTGTACATTCAACTACGCAAAAACTTTGAAGAACAAGTACTATGAGCCCAG
CSFV-11d：
ACTGATACTCGCCCTTAAGCATATATTGCTGGAAGTAGCTGTCCCTGGGCTCATAGTAC
CSFV-12u：
AAGGGCGAGTATCAGTACTGGTTTGACCTGGACGTGACTGACCGCCACTCAGATTACTT
CSFV-12d：
TTCCTCCTAACAGTGCTACCACCACCAAGACAACAAATTCTGCGAAGTAATCTGAGTGG
CSFV-13u：
CACTGTTAGGAGGAAGATATGTCCTGTGGCTAATAGTGACCTACATAGTTTTAACAGA
CSFV-13d：ACCAGCGGCGAGTTGTTCTGTTAAAACTA，
By primer
CSFV-1u, CSFV-1d, CSFV-2u, CSFV-2d, CSFV-3u, CSFV-3d, CSFV-4u, CSFV-4d mix, and carry out PCR reaction, products therefrom called after CSFV-1;
By primer
CSFV-5u, CSFV-5d, CSFV-6u, CSFV-6d, CSFV-7u, CSFV-7d, CSFV-8u, CSFV-8d mix, and carry out PCR reaction, products therefrom called after CSFV-2;
By primer
CSFV-9u, CSFV-9d, CSFV-10u, CSFV-10d, CSFV-11u, CSFV-11d, CSFV-12u, CSFV-12d, CSFV-13u, CSFV-13d mix, and carry out PCR reaction, products therefrom called after CSFV-3; Then above-mentioned three product C SFV-1, CSFV-2, CSFV-3 mixing is carried out PCR reaction as template, obtain the raq gene sequence of Pestivirus suis as shown in SEQ ID No:1.
Further, in step c, recombinant expression plasmid is converted in e. coli bl21, the substratum closing sulphuric acid kanamycin is utilized to screen, after picking mono-clonal bacterium colony, the sulphuric acid kanamycin substratum 37 degree of same concentrations is had to be cultured to desired concn with conjunction, carry out abduction delivering with IPTG, after induction, low-temperature centrifugation collects thalline.
Further, the concentration of described sulphuric acid kanamycin is 100ug/ml.
Further, inductive condition is 37 degree, rotating speed 250rpm, 5h, and the IPTG concentration of induction is 0.1mM.
Further, in steps d, thalline adopts ultrasonication, and broken condition is 200w, ultrasonic 6s, and interval 3s is once ultrasonic, totally 180 times.
Further, in steps d, the purification process of recombinant protein is ion exchange chromatography, the one in gel permeation chromatography and affinity chromatography.
Preferably, in steps d, the purification process of recombinant protein is affinity chromatography.
The present invention also provides the application of a kind of aforesaid recombinant protein in preparation Pestivirus suis detection reagent
In addition, the present invention also provides a kind of test kit detecting Pestivirus suis, it is characterized in that, comprises aforesaid recombinant protein in described test kit.
Beneficial effect of the present invention: compared with prior art, the E2 full sheet section of preparation method to Pestivirus suis Main Antigenic place of the recombinant antigen for detecting Pestivirus suis provided by the invention is carried out recombinant expressed, so just remain the epitope sites of whole E2, and then effectively avoid false negative and detection leakage phenomenon.
Further, the features such as expression system of the present invention is escherichia expression system, and it is short that it has the cycle, and expense is low, and expression amount is large, preparation method of the present invention is had with short production cycle, output is high, the advantage that cost is low.
Further, the relatively mild cultivation of Selection radio of the present invention and inductive condition, inducing temperature when it is expressed is at 25 degree, induction rotating speed is 250rpm, the IPTG concentration of induction is 0.1mM, recombinant protein can be made to have had and express more slowly, there is the sufficient time to carry out the formation of space conformation, better keep the avtive spot of recombinant protein.
Further, the present invention can adopt ultrasonic mode disrupt bacteria.When broken thalline, broken condition is decided to be 200w, ultrasonic 6s, interval 3s is once ultrasonic, totally 180 times, and mild condition, avoids violent fragmentation.
Further, the preferred affinity chromatography of the present invention, because add 6XHis label in recombinant protein of the present invention, single step purification can reach higher purity.
Accompanying drawing explanation
Fig. 1 is the abduction delivering schematic diagram of recombinant plasmid in intestinal bacteria in the embodiment of the present invention.
Fig. 2 is the purifying schematic diagram of recombinant protein in the embodiment of the present invention.
Embodiment
Below in conjunction with drawings and Examples, the present invention is described in further detail.
The synthesis of embodiment 1 E 2 gene of Classical Swine Fever
Design primer is as follows:
CSFV-1u：
ATGCAGCTAGCCTGCAAGGAAGATTACAGGTACGCAATATCATCAACCAATGAGATA
CSFV-1d：
ATTCTTTCCAGGTGGTGGTGAGACCTCCGGCCCCGAGTAGCCCTATCTCATTGGTTGA
CSFV-2u：
CCACCTGGAAAGAATACAACCACGATTTGCAACTGAATGACGGGACCGTTAAGGCCATT
CSFV-2d：
TGACCACATTAAGTGCTGTGACTTTAAAGGAACCTGCCACGCAAATGGCCTTAACGGT
CSFV-3u：
CACTTAATGTGGTCAGTAGGAGGTATTTGGCATCATTGCATAAGGAGGCTTCACTCACT
CSFV-3d：
GAGGCTTCACTCACTTCCGTGACATTTGAGCTCCTGTTCGACGGGACCAACCCATCAAC
CSFV-4u：
CAAATGGGCACAGCCCGAACCCGAAGTCATCTCCCATTTCCTCAGTTGATGGGTTGGTC
CSFV-4d：
CAAGGTTGTGTTGTACTTTCCCTTGACAACAGGACTCGTATCAAATGGGCACAGCC
CSFV-5u：
TACAACACAACCTTGTTGAACGGTAGTGCTTACTATCTTGTCTGTCCAATAGGGTGGAC
CSFV-5d：
TTCTCAGAGTTGTTGGGCTCACTGCTGTGCACTCTATAACACCCGTCCACCCTATTGGA
CSFV-6u：
CAACAACTCTGAGAACAGAAGTGGTAAAGACCTTCAGGAGGGACAAGCCCTTTCCGCAC
CSFV-6d：
AATAAATCTTCATTTTCCACTGTTGTGGTCACACAATCCATTCTGTGCGGAAAGGGCTT
CSFV-7u：
AATGAAGATTTATTCTACTGTAAGTTGGGGGGCAACTGGACATGTGTGAAAGGTGAACC
CSFV-7d：
CACACCATCTGCATTGTTTTACTAGCCCCCCCGTGTAGACCACTGGTTCACCTTTCACA
CSFV-8u：
AATGCAGATGGTGTGGCTTTGACTTCAATGAGCCTGACGGACTCCCACACTACCCCATA
CSFV-8d：
TCCACTATTCTGTAACCTGTCTCATTTGCCAAAATGCACTTACCTATGGGGTAGTGTGG
CSFV-9u：
TTACAGAATAGTGGATTCAACAGACTGTAACAGAGATGGTGTCGTAATCAGCACAGAGG
CSFV-9d：
ATGCACCTTGACAGTTGTGTTACCGATCAAGCACTCATGACTCCCCTCTGTGCTGATTA
CSFV-10u：
ACTGTCAAGGTGCATGCATCAGATGAAAGACTGGGCCCCATGCCATGCAGACCTAAAG
CSFV-10d：
TGTACAGGAAGTTTTCCTTACAGGTCCTGCACTAGAGACGATCTCTTTAGGTCTGCATG
CSFV-11u：
AAAACTTCCTGTACATTCAACTACGCAAAAACTTTGAAGAACAAGTACTATGAGCCCAG
CSFV-11d：
ACTGATACTCGCCCTTAAGCATATATTGCTGGAAGTAGCTGTCCCTGGGCTCATAGTAC
CSFV-12u：
AAGGGCGAGTATCAGTACTGGTTTGACCTGGACGTGACTGACCGCCACTCAGATTACTT
CSFV-12d：
TTCCTCCTAACAGTGCTACCACCACCAAGACAACAAATTCTGCGAAGTAATCTGAGTGG
CSFV-13u：
CACTGTTAGGAGGAAGATATGTCCTGTGGCTAATAGTGACCTACATAGTTTTAACAGA
CSFV-13d：ACCAGCGGCGAGTTGTTCTGTTAAAACTA
Experimental technique is as follows
By primer
CSFV-1u, CSFV-1d, CSFV-2u, CSFV-2d, CSFV-3u, CSFV-3d, CSFV-4u, CSFV-4d mix, and carry out PCR reaction, products therefrom called after CSFV-1; By primer
CSFV-5u, CSFV-5d, CSFV-6u, CSFV-6d, CSFV-7u, CSFV-7d, CSFV-8u, CSFV-8d mix, and carry out PCR reaction, products therefrom called after CSFV-2; By primer
CSFV-9u, CSFV-9d, CSFV-10u, CSFV-10d, CSFV-11u, CSFV-11d, CSFV-12u, CSFV-12d, CS FV-13u, CSFV-13d mix, and carry out PCR reaction, products therefrom called after CSFV-3; Then above-mentioned three products and CSFV-1, CSFV-2, CSFV-3 mixing are carried out as template the raq gene sequence that namely PCR reaction obtains Pestivirus suis.
Above-mentioned four PCR (polysaccharase of the present invention is TOYOBO Products, article No.: 02510D1) reaction conditions is as follows: 94 degree, 2 minutes X, 1 circulation, (98 degree, 15 seconds, 55 degree, 30 seconds, 68 degree, 15 seconds) an X30 circulation, 72 degree, 7 minutes X, 1 circulation.
Embodiment 2 builds recombinant expression vector,
After order-checking proves that sequence is correct, after PCR primer NdeI in embodiment 1 and XhoI restriction enzyme (various molecular biology enzyme of the present invention is all purchased from NEB company) are carried out double digestion, be inserted into and cut in pET30a (Novagen product, the article No. 69909-3) carrier of process with identical two enzymes.
Embodiment 3 closes the expression having Pestivirus suis E2 recombinant protein
Pestivirus suis recombinant expression plasmid is converted in e. coli bl21, coat and close 100ug/ml sulphuric acid kanamycin (Shanghai Sheng Gong biotechnology Services Co., Ltd, article No.: KB0286) LB flat board on, 37 degree of incubated overnight, picking mono-clonal bacterium colony, there is the 300mlLB substratum 37 degree of the sulphuric acid kanamycin of same concentrations to be cultured to OD600 with conjunction and reach about 0.6, by IPTG (the raw work that final concentration is 0.1mM, article No.: IB0168) carry out abduction delivering, inductive condition is: 37 degree, rotating speed 250rpm, 5h.After induction, centrifugal for nutrient solution 4 degree of 5000rpm 20min is collected thalline.
Fig. 1 is the abduction delivering schematic diagram of recombinant plasmid in intestinal bacteria in the embodiment of the present invention.Wherein the right is not induced for pET30a-CSFV-E2, and after the left side is pET30a-CSFV-E2 induction, as shown in Figure 1, the bacterial strain with recombinant expression vector produces a large amount of target protein, i.e. recombinant C SFV-E2 albumen after induction.
Embodiment 4 closes the purifying and the renaturation that there are Pestivirus suis E2 recombinant protein
Thalline is resuspended with 50ml inclusion body extract (20mM Tris-HCl, 0.5MUrea pH 7.5,0.5M NaCl, 2%Triton X-100), then ultrasonication, condition is ultrasonic 3s, interval 6s, totally 180 times, 12000rpm, 4 degree of collected by centrifugation inclusion body precipitations.
With loading buffer B inding Buffer (50mM Tris, 8M Urea, 0.5M Nacl, 20mM imidazoles pH8.0) the broken inclusion body of 50ml, upper column purification, with elution buffer Elution Buffer (50mM Tris, 8M Urea, 0.5MNacl, 300mM imidazoles pH8.0) wash-out target protein.Fig. 2 is the purifying schematic diagram of recombinant protein in the embodiment of the present invention, and wherein 1 is loading after restructuring E2 bacterial cell disruption, and 2 for penetrating (in conjunction with Ni post component), and 3 is elution samples (after purifying E2 recombinant protein).
By dialysis buffer liquid (1mM Sleep-promoting factor B GSSH, 2mM reduced glutathion GSH, 2mMEDTA, 20mM Tris, the pH8.5) dialysis of the recombinant protein after purifying, change a dialyzate every 48h.
Taking out the protein liquid after dialysis, through concentrating according to ethanol-20000, saving backup in-20 degree.
Although the present invention with preferred embodiment openly as above; but it is not for limiting the present invention; any those skilled in the art without departing from the spirit and scope of the present invention; the Method and Technology content of above-mentioned announcement can be utilized to make possible variation and amendment to technical solution of the present invention; therefore; every content not departing from technical solution of the present invention, any simple modification done above embodiment according to technical spirit of the present invention, equivalent variations and modification all belong to the protection domain of technical solution of the present invention.
Claims (10)
1. for detecting a preparation method for the recombinant antigen of Pestivirus suis, it is characterized in that, comprising the steps:
Step a, gene chemical synthesis, design primer carries out PCR reaction, obtains the raq gene sequence of Pestivirus suis as shown in SEQ ID No:1;
Step b, build recombinant expression vector, the gene order in step a checks order successfully, after this gene order restriction enzyme is carried out double digestion, is inserted into and cuts in the plasmid expression vector of process with identical two enzymes;
Step c, closes the expression having Pestivirus suis E2 recombinant protein, is converted in intestinal bacteria, carries out abduction delivering by the recombinant expression plasmid in step b, after induction, collects thalline;
Steps d, closes the purifying and the renaturation that there are Pestivirus suis E2 recombinant protein, and the bacterial cell disruption collected by step c extracts recombinant protein, then carries out purifying and renaturation, obtains recombinant protein aminoacid sequence as shown in SEQ ID No:28.
2. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 1, is characterized in that,
In step a, design primer is as follows:
CSFV-1u：ATGCAGCTAGCCTGCAAGGAAGATTACAGGTACGCAATATCATCAACCAATGAGATA
CSFV-1d：ATTCTTTCCAGGTGGTGGTGAGACCTCCGGCCCCGAGTAGCCCTATCTCATTGGTTGA
CSFV-2u：CCACCTGGAAAGAATACAACCACGATTTGCAACTGAATGACGGGACCGTTAAGGCCATT
CSFV-2d：TGACCACATTAAGTGCTGTGACTTTAAAGGAACCTGCCACGCAAATGGCCTTAACGGT
CSFV-3u：CACTTAATGTGGTCAGTAGGAGGTATTTGGCATCATTGCATAAGGAGGCTTCACTCACT
CSFV-3d：GAGGCTTCACTCACTTCCGTGACATTTGAGCTCCTGTTCGACGGGACCAACCCATCAAC
CSFV-4u：CAAATGGGCACAGCCCGAACCCGAAGTCATCTCCCATTTCCTCAGTTGATGGGTTGGTC
CSFV-4d：CAAGGTTGTGTTGTACTTTCCCTTGACAACAGGACTCGTATCAAATGGGCACAGCC
CSFV-5u：TACAACACAACCTTGTTGAACGGTAGTGCTTACTATCTTGTCTGTCCAATAGGGTGGAC
CSFV-5d：TTCTCAGAGTTGTTGGGCTCACTGCTGTGCACTCTATAACACCCGTCCACCCTATTGGA
CSFV-6u：CAACAACTCTGAGAACAGAAGTGGTAAAGACCTTCAGGAGGGACAAGCCCTTTCCGCAC
CSFV-6d：AATAAATCTTCATTTTCCACTGTTGTGGTCACACAATCCATTCTGTGCGGAAAGGGCTT
CSFV-7u：AATGAAGATTTATTCTACTGTAAGTTGGGGGGCAACTGGACATGTGTGAAAGGTGAACC
CSFV-7d：CACACCATCTGCATTGTTTTACTAGCCCCCCCGTGTAGACCACTGGTTCACCTTTCACA
CSFV-8u：AATGCAGATGGTGTGGCTTTGACTTCAATGAGCCTGACGGACTCCCACACTACCCCATA
CSFV-8d：TCCACTATTCTGTAACCTGTCTCATTTGCCAAAATGCACTTACCTATGGGGTAGTGTGG
CSFV-9u：TTACAGAATAGTGGATTCAACAGACTGTAACAGAGATGGTGTCGTAATCAGCACAGAGG
CSFV-9d：ATGCACCTTGACAGTTGTGTTACCGATCAAGCACTCATGACTCCCCTCTGTGCTGATTA
CSFV-10u：ACTGTCAAGGTGCATGCATCAGATGAAAGACTGGGCCCCATGCCATGCAGACCTAAAG
CSFV-10d：TGTACAGGAAGTTTTCCTTACAGGTCCTGCACTAGAGACGATCTCTTTAGGTCTGCATG
CSFV-11u：AAAACTTCCTGTACATTCAACTACGCAAAAACTTTGAAGAACAAGTACTATGAGCCCAG
CSFV-11d：ACTGATACTCGCCCTTAAGCATATATTGCTGGAAGTAGCTGTCCCTGGGCTCATAGTAC
CSFV-12u：AAGGGCGAGTATCAGTACTGGTTTGACCTGGACGTGACTGACCGCCACTCAGATTACTT
CSFV-12d：TTCCTCCTAACAGTGCTACCACCACCAAGACAACAAATTCTGCGAAGTAATCTGAGTGG
CSFV-13u：CACTGTTAGGAGGAAGATATGTCCTGTGGCTAATAGTGACCTACATAGTTTTAACAGA
CSFV-13d：ACCAGCGGCGAGTTGTTCTGTTAAAACTA，
By primer CSFV-1u, CSFV-1, d, CSFV-2u, CSFV-2d, CSFV-3u, CSFV-3d, CSFV-4u, CSFV-4d mix, and carry out PCR reaction, products therefrom called after CSFV-1;
By primer CSFV-5u, CSFV-5d, CSFV-6u, CSFV-6d, CSFV-7u, CSFV-7d, CSFV-8u, CSFV-8d mix, and carry out PCR reaction, products therefrom called after CSFV-2;
By primer
CSFV-9u, CSFV-9d, CSFV-10u, CSFV-10d, CSFV-11u, CSFV-11d, CSFV-12u, CSFV-12d, CSFV-13u, CSFV-13d mix, and carry out PCR reaction, products therefrom called after CSFV-3; Then by above-mentioned three products
CSFV-1, CSFV-2, CSFV-3 mixing carries out PCR reaction as template, obtains the raq gene sequence of Pestivirus suis as shown in SEQ ID No:1.
3. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 1, it is characterized in that, in step c, recombinant expression plasmid is converted in e. coli bl21, the substratum closing sulphuric acid kanamycin is utilized to screen, after picking mono-clonal bacterium colony, there is the sulphuric acid kanamycin substratum 37 degree of same concentrations to be cultured to desired concn with conjunction, carry out abduction delivering with IPTG, after induction, low-temperature centrifugation collects thalline.
4. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 4, is characterized in that, the concentration of described sulphuric acid kanamycin is 100ug/ml.
5. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 4, is characterized in that, inductive condition is 37 degree, rotating speed 250rpm, 5h, and the IPTG concentration of induction is 0.1mM.
6. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 1, is characterized in that, in steps d, thalline adopts ultrasonication, and broken condition is 200w, ultrasonic 6s, and interval 3s is once ultrasonic, totally 180 times.
7. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 1, is characterized in that, in steps d, the purification process of recombinant protein is ion exchange chromatography, the one in gel permeation chromatography and affinity chromatography.
8. the preparation method of the recombinant antigen for detecting Pestivirus suis according to claim 1, is characterized in that, in steps d, the purification process of recombinant protein is affinity chromatography.
9. the application of recombinant protein as claimed in claim 1 in preparation Pestivirus suis detection reagent.
10. detect a test kit for Pestivirus suis, it is characterized in that, in described test kit, comprise recombinant protein according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410494375.8A CN104313037A (en) | 2014-09-24 | 2014-09-24 | Preparation method of recombinant antigen for detecting swine fever virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410494375.8A CN104313037A (en) | 2014-09-24 | 2014-09-24 | Preparation method of recombinant antigen for detecting swine fever virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104313037A true CN104313037A (en) | 2015-01-28 |
Family
ID=52368350
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410494375.8A Pending CN104313037A (en) | 2014-09-24 | 2014-09-24 | Preparation method of recombinant antigen for detecting swine fever virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104313037A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110790827A (en) * | 2018-12-26 | 2020-02-14 | 杭州亿米诺生物科技有限公司 | I-type bovine herpes virus recombinant protein and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103588864A (en) * | 2013-11-28 | 2014-02-19 | 华南农业大学 | Classic swine fever virus (CSFV) C strain E2 truncated protein and its preparation method and use |
-
2014
- 2014-09-24 CN CN201410494375.8A patent/CN104313037A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103588864A (en) * | 2013-11-28 | 2014-02-19 | 华南农业大学 | Classic swine fever virus (CSFV) C strain E2 truncated protein and its preparation method and use |
Non-Patent Citations (4)
| Title |
|---|
| MAN,C.等: "Accession Number:AY430287.1", 《GENBANK》 * |
| 刘萍等: "猪瘟病毒E2蛋白主要抗原区编码基因的原核表达及抗原性研究", 《中国畜牧兽医》 * |
| 宁红梅等: "猪瘟病毒囊膜糖蛋白E2研究进展", 《江苏农业科学》 * |
| 朱艳平等: "猪瘟病毒E2蛋白的原核表达及鉴定", 《动物医学进展》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110790827A (en) * | 2018-12-26 | 2020-02-14 | 杭州亿米诺生物科技有限公司 | I-type bovine herpes virus recombinant protein and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107022538A (en) | The deacetylase and its encoding gene of a kind of high-glucosamine-yield | |
| CN112111006B (en) | Antibody for resisting bovine sarcoidosis virus, detection test paper and kit | |
| CN104166000A (en) | A method of indentifying brucella natural infection or immunifaction for livestock | |
| CN106543272A (en) | Multifunctional label fusion protein and its expression and application | |
| CN105294843A (en) | Immunogenic polypeptide for enterovirus 71 type VP1 antigen as well as preparation method and application of immunogenic polypeptide | |
| CN102465134B (en) | Method for preparing recombinant anthropogenic Cu/Zn superoxide dismutase | |
| CN108059684A (en) | A kind of bovine viral diarrhoea recombinant protein, its preparation method and application | |
| CN116333957A (en) | Recombinant bacillus for displaying streptococcus suis prophage lyase, construction method and application thereof | |
| CN104086657A (en) | Artificial antigen and kit for joint detection of Rta protein antibody of epstein-barr (EB) virus and early antigen ethyl acrylate (EA) antibody of EB virus | |
| CN107286250A (en) | A kind of brucella fusion protein, its preparation method and application | |
| CN114152748A (en) | Double-antibody sandwich ELISA diagnostic kit for detecting African swine fever virus and method thereof | |
| CN103834668B (en) | A kind of restructuring mycoplasma pneumoniae albumen and application thereof | |
| CN104313037A (en) | Preparation method of recombinant antigen for detecting swine fever virus | |
| CN107576791A (en) | One boar lawsonia intracellularis ELISA detection kit | |
| CN104678097A (en) | Mycobacterium tuberculosis combined antigen for diagnosing pulmonary tuberculosis | |
| CN104862331A (en) | Method for soluble expression of rhodococcus equi disease-causing gene VapA protein | |
| CN107664694A (en) | A kind of ELISA kit based on E2 Protein Detection pig atypia pestivirus antibody | |
| CN104888208B (en) | The application of Rhodococcus equi Disease-causing gene VapA recombinant proteins | |
| CN101979406B (en) | Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof | |
| CN101831440A (en) | Method for preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system | |
| CN101519450B (en) | Fusion protein and use of fusion protein in detection of histoplasma capsulatum | |
| CN109652409A (en) | A method of extracting aureus plasmid | |
| CN109593121A (en) | A kind of I type bovine herpes virus recombinant protein and its preparation method and application | |
| CN103555742A (en) | Preparation method of human active granzyme A recombinant protein | |
| CN115850523B (en) | Herpes simplex virus I-type specific fusion protein antigen, preparation method thereof and detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150128 |