CN101831440A - Method for preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system - Google Patents

Abstract

The invention belongs to the field of medical research, and particularly relates to a method for preparing pseudomonas aeruginosa outer membrane protein OprF by a prokaryotic expression system. The method uses the prokaryotic expression system to construct and express the OprF protein so as to establish research foundation for obtaining OprF specific monoclonal antibody by a hybridoma technology or obtaining multivalent specific antiserum by using immune animal and for rapidly screening and detecting pseudomonas aeruginosa by a gold immunochromatographic assay technology in the future.

Description

Method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system

(1) technical field

The invention belongs to medical research field, particularly a kind of method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system.

(2) background technology

Pseudomonas aeruginosa is a kind of conditioned pathogen, its infection that causes accounts for 10% of Grain-negative infection, often be secondary to the low patients of immunity of organisms such as tumour, extensive wound, burn and use immunosuppressor, infection type is various, can encroach on respiratory tract, digestive tube, urinary system, marrow and skin etc.

About the detection of Pseudomonas aeruginosa, the laboratory is many with traditional method for cultivation of bacteria at present.Along with the fast development of immunological method, how the specific reaction with antigen-antibody detects charrin disease fast and effectively, has been studied personnel's extensive concern.

Pseudomonas aeruginosa contains two kinds of main antigenicity epicyte compositions: lipopolysaccharides and outer membrane protein.OprF and antibody thereof can be used as immunoprophylaxis and rapid detection tool, are because it has the following advantages: 1. be exposed to the thalline surface, have higher immunogenicity; 2. have higher conservative property in heredity, its vaccine can have cross-immunity preferably by the serotype Pseudomonas aeruginosa different with 17 kinds.

In more than 20 kinds of Pseudomonas aeruginosa outer membrane proteins, OprF is stronger a kind of of immunogenicity.There are some researches prove that the OprF carboxyl terminal is exposed to the thalline surface, antigenic determinant is more, and immunogenicity is stronger.

(3) summary of the invention

The present invention provides a specific specificity height, the fast method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system of detection speed in order to remedy the deficiencies in the prior art.

The present invention is achieved through the following technical solutions:

A kind of method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system mainly comprises the steps:

(1) from Pseudomonas aeruginosa, extracts genomic dna,, and be cloned among the prokaryotic expression carrier pET28b, make up recombinant expression vector pET28b-OprF by PRC (polymerase chain reaction) amplification OprF carboxyl terminal;

(2) recombinant plasmid through enzyme cut with sequencing after, Transformed E .coli BL21, IPTG (isopropyl-) abduction delivering carries out SDS-PAGE (polyacrylamide gel electrophoresis) and detects;

(3) the OprF albumen that behind Ni-NTA affinity chromatography column purification, obtains unit and express.

The primer that described amplification OprF carboxyl terminal adopts is upstream primer 5 '-TCG AAGCTTGCTCCGGCTCCGGAAC CGGTTGCCG AC-3 ' (HindIII) and downstream primer 5 '-AC CTCGAGTTCAA CGCGACGGTT GA AGCGCG-3 ' (XholI).

The present invention utilizes prokaryotic expression system construction and expresses OprF albumen, for adopting hybridoma technology to obtain OprF monoclonal antibody specific or immune animal acquisition multivalence specific antisera from now on, reach by the colloidal gold immunochromatographimethod technology research basis is established in the rapid screening detection of Pseudomonas aeruginosa.

(4) description of drawings

The present invention is further illustrated below in conjunction with accompanying drawing.

Fig. 1 is the synoptic diagram of pET28b-OprF carrier of the present invention;

Fig. 2 is the sequencing result of OprF in the pET28b-OprF carrier.

(5) embodiment

Embodiment:

Extract test kit with bacterial genomes and extract pseudomonas aeruginosa gene group DNA, with this end in view the gene PCR amplification template according to the Pseudomonas aeruginosa OprF gene nucleotide series (NC_002516) of GenBank announcement, designs primer: upstream primer 5 '-TCG AAGCTTGCTCCGGCTCCGGAAC CGGTTGCCG AC-3 ' (HindIII) and downstream primer 5 '-AC CTCGAGTTCAA CGCGACGGTT GA AGCGCG-3 ' (XholI).The goal gene OprF clip size of amplification is about 470bp, about 140 the amino acid whose peptide sections (190-342aa OprF) of encoding.The OprF fragment is connected with cloning vector pMD19simple-T spends the night, and transformed into escherichia coli DH5 α competent cell is to contain the LB agar plate screening of ammonia benzyl/X-Gal/IPTG, with blue hickie method screening positive clone.

Extract plasmid DNA in the bacterial strain that contains the pMD19simple-T-OprF recombinant plasmid that checking is correct, and carry out HindIII and XholI double digestion, 1.5% agarose gel electrophoresis reclaims the purpose fragment, be connected with pET28b plasmid and spend the night with same treatment, transform DH5 α competent cell, coating contains the LB flat board of 25 μ g/mL kantlex, cuts with PCR and enzyme and identifies positive colony, will transform the BL21 competent cell behind the positive colony amplification extraction plasmid.

The positive colony Transformed E .coli BL21 that checks order correct, 1mMIPTG is abduction delivering OprF albumen under 37 ℃ of conditions, verifies with SDS-PAGE electrophoresis and western-blot.

Claims (2)

1. the method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system is characterized in that: mainly comprise the steps:

(1) extract genomic dna from Pseudomonas aeruginosa, with this end in view gene is by PRC amplification OprF carboxyl terminal, and is cloned among the prokaryotic expression carrier pET28b, makes up recombinant expression vector pET28b-OprF;

(2) recombinant plasmid through enzyme cut with sequencing after, Transformed E .coli BL21, the IPTG abduction delivering carries out SDS-PAGE and detects;

(3) the OprF albumen that behind Ni-NTA affinity chromatography column purification, obtains unit and express.

2. the method with preparing pseudomonas aeruginosa outer membrane protein OprF by prokaryotic expression system according to claim 1 is characterized in that: the primer that described amplification OprF carboxyl terminal adopts is upstream primer 5 '-TCG AAGCTTGCTCCGGCTCCGGAAC CGGTTGCCG AC-3 ' (HindIII) and downstream primer 5 '-AC CTCGAGTTCAA CGCGACGGTT GA AGCGCG-3 ' (XholI).

Images