CN104311670B

CN104311670B - Fused polypeptide for IL-17 and TNF[alpha], and application thereof

Info

Publication number: CN104311670B
Application number: CN201410162984.3A
Authority: CN
Inventors: 李德山; 任桂萍; 阚方明; 韩晓辉
Original assignee: HARBIN BOAO BIO-MEDICAL TECHNOLOGY DEVELOPMENT Co
Current assignee: Jiangsu Kangyuan Ruiao Biomedical Technology Co., Ltd.
Priority date: 2014-04-23
Filing date: 2014-04-23
Publication date: 2017-05-17
Anticipated expiration: 2034-04-23
Also published as: CN104311670A

Abstract

The invention discloses a fused polypeptide for IL-17 and TNF[alpha], and an application thereof. The invention provides a fused polypeptide, specifically an IL-17scfv/sTNFR1 fused polypeptide. The fused polypeptide is composed of an A segment and a B segment, wherein the A segment is (a) protein composed of amino acid sequences shown as a sequence 1 in a sequence table or (b) protein that is derived from the sequence 1 by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequences shown as the sequence 1 and has the same functions; and the B segment is (c) protein composed of amino acid sequences shown as a sequence 3 in the sequence table or (d) protein that is derived from the sequence 3 by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequences shown as the sequence 3 and has the same functions. The fused protein provided by the invention can effectively alleviate clinical symptoms of rheumatoid arthritis (RA) and has significant application values for treating the rheumatoid arthritis (RA).

Description

For the fused polypeptide and its application of IL-17 and TNF α

Technical field

The present invention relates to a kind of with the genetic engineering for resisting Interleukin-17 and tumor necrosis factor α activity simultaneously Novel bispecific Mutiple Targets fused polypeptide, more particularly to blocks many targets of bispecific of the inflammatory reaction of autoimmune disease Point fused polypeptide.

Background technology

IL-17 is a kind of powerful Pro-inflammatory mediator, is also the fine setting factor of inflammatory reaction（Fine-tuning cytokine）.IL-17 can stimulate horn cell, fibroblast, epithelial cell and endotheliocyte release IL-6, IL-8, prostatitis Parathyrine E2（PGE2）, metalloproteases -1 (MMP-1), granulocyte colony-stimulating factor（G-CSF）With monocyte chemo chemotactic The cytokines such as albumen (MCP) -1.It is now recognized that IL-17 promotes rheumatoid arthritis（RA）Middle osteoclasia mechanism is potentially included： The generation of induction TNF α and IL-1, makes joint obtain destruction enhancing；Increase core stimulating factor receptor and core stimulating factor receptor Quantity, destroy OPG and both balance and increase osteoclasia；IL-17 also directly acts on osteoclast, stimulates The differentiation of osteoclast and activation.

IL-17 has the effect of powerful recruitment neutrophilic granulocyte.When IL-17 is co-cultured with fibroblast, into fiber Cell can persistently promote CD34⁺The propagation of hematopoietic stem cell and to neutrophil differentiation；IL-6, IL-17, MIP-2's is anti- Body plays the role of to suppress neutrophilic granulocyte to assemble in air flue.Illustrate that IL-17 is to start the early stage of T cell dependency inflammatory reaction Son, also plays an important role in contact hematopoietic cells cytokine network and immune system.

TNF α is a kind of main cytokine produced by the macrophage for activating, be a kind of important biological activity because Son, TNF α except with addition to stronger anti-tumor activity, also with extensive biologic activity, it can activating macrophage and Polymorphonuclear cell, the generation of inducing various cytokines and synergism, participate in immunomodulating, promotion organization histocmpatibility Expression, the anti-infection ability of enhancing body, participate in osseous tissue absorption and reinvent.However, the generation of excessive TNF α and releasing Put, the immunologic balance of body can be destroyed, cause serious inflammatory reaction, and can cause to generate heat, suffer a shock, multiple organ dysfunction syndrome It is even dead.

Mainly by being combined performance biologic activity with the specific receptor TNFR on cell membrane, TNFR has TNF α TNFRI and two kinds of TNFRII, can be in combination with TNF α and TNF β, but the biological function for being mediated is not quite similar.In body Interior, some TNF membrane receptor extracellular region is disintegrated down from cell membrane, is dissociated in blood, becomes soluble TNF acceptor sTNFR.STNFR does not mediate the conduction of signal, but remains to be combined with TNF α, neutralizes the activity of TNF α, in vivo, vitro inhibition The cytotoxicity and autoimmune response of TNF α induction, is the natural agonist of TNF α.

IL-1 and TNF α are the important inflammatory mediators in RA generally acknowledged at present sick, and IL-17 can remarkably promote inflammatory cell point Secrete IL-1 and TNF α.IL-17 is shared with IL-1, TNF α can strengthen activator protein 21 in osteoblast-like cells（AP21）Family into Member, early growth response gene（Egr-1）, NF- κ B expression, and can raise TNF α stimulation gene 26（TSG26）、IL-6、 The expression of IL-8.IL-17 and effective synergism of other inflammatory cytokine, are allowed to be located at the center of inflammatory network, So as to promote the development of RA inflammation.The fused polypeptide of the neutralization activity of anti-interleukin-17 and tumor necrosis factor α can with it is white There is the combination of specificity in interleukin -17 and tumor necrosis factor-alpha, block its biologic activity, effectively slow down inflammatory reaction Development, prevents the deterioration of the state of an illness.It is not reported both at home and abroad for the fused polypeptide of interleukin-17 and tumor necrosis factor α.

The bispecific Mutiple Targets fusion that anti-interleukin-17 single-chain antibody is constituted with Soluble tumor necrosis factor receptor I Polypeptide, can and interleukin-17 and TNF α there is the combination of specificity, block its biologic activity.Fusion protein can be effective The development for slowing down inflammatory reaction, prevent the deterioration of the state of an illness.At present with TNF α, IL-17 etc. using the single cell factor as target Biostatic agent have been reported that both at home and abroad, while resist two kinds of cytokines biological preparation be not reported both at home and abroad.

The content of the invention

The invention provides a kind of novel bispecific Mutiple Targets polypeptide drug with IL-17 and TNF α as target（IL- 17scfv/sTNFRI fused polypeptide）, with the ability for blocking the inflammatory reaction caused by two kinds of cytokines simultaneously.

The invention provides a kind of fused polypeptide, is made up of A fragments and B fragments；The A fragments are as follows（a）Or（b）：（a）The protein that aminoacid sequence shown in sequence in sequence table 1 is constituted；（b）By the aminoacid sequence of sequence 1 through one Or several amino acid residues replacement and/or disappearance and/or add and with identical function by derived from sequence 1 protein； The B fragments are as follows（c）Or（d）：（c）The protein that aminoacid sequence shown in sequence in sequence table 3 is constituted；（d）Will The aminoacid sequence of sequence 3 through one or several amino acid residues replacement and/or disappearance and/or add and with identical work( The protein by derived from sequence 3 of energy.

The IL-17scfv/sTNFRI fused polypeptide that the present invention is provided is by the hinge region of antibody that anti-human IL-17 is single-stranded The bispecific Mutiple Targets fused polypeptide that antibody is connected to form with Soluble tumor necrosis factor receptor I.

The preparation method of the fusion protein comprises the steps：（1）Will be double shown in the sequence 2 and sequence 4 of sequence table After the connection of ssdna molecule over-lap PCR, the multiple clone site of pET-27b (+) carrier is inserted, obtain recombiant plasmid；（2）By step （1）The recombiant plasmid for obtaining imports e. coli bl21（DE3）, obtain recombinant bacterium；（3）By step（2）The recombinant bacterium training for obtaining Support to OD_600nm=0.5, using IPTG inducing culture 4h, thalline is collected by centrifugation；（4）Take step（3）The thalline for obtaining, ultrasound is broken It is broken, inclusion body is collected, then inclusion body degeneration is dissolved, it is added dropwise over 50 milliliters of renaturation solutions（Solvent is water, carbamide containing 2M, 0.1M NaH₂PO₄With 0.01M Tris-HCl, pH=8.0）In, 4 DEG C of stationary incubation 12h, then in the PBS of pH7.4 Dialysis, obtains final product.

The present invention also protects a kind of DNA composition, by the DNA molecular first and the coding B fragments for encoding the A fragments DNA molecular second is constituted.The DNA molecular first can be as follows（1）Or（2）Or（3）DNA molecular：（1）The institute of sequence 2 in sequence table The DNA molecular for showing；（2）Under strict conditions with（1）The DNA sequence of restriction hybridizes and encodes the DNA molecular of the A fragments；（3） With（1）The DNA sequence of restriction has more than 90% homology and encodes the DNA molecular of the A fragments.The DNA molecular second be as Under（4）Or（5）Or（6）DNA molecular：（4）DNA molecular in sequence table shown in sequence 4；（5）Under strict conditions with（4）Limit Fixed DNA sequence hybridizes and encodes the DNA molecular of the B fragments；（6）With（4）The DNA sequence of restriction is homologous with more than 90% Property and encode the DNA molecular of the B fragments.Above-mentioned stringent condition can be in 6 × SSC, in the solution of 0.5% SDS, at 65 DEG C Hybridization, then respectively washes film once with 2 × SSC, 0.1% SDS and 1 × SSC, 0.1% SDS.

The present invention also protects a kind of plasmid composition, by the recombiant plasmid first containing the DNA molecular first and containing described The recombiant plasmid second composition of DNA molecular second.

The present invention also protects a kind of for treatment and/or the medicine of preventing autoimmune disease, and its active component is for described IL-17scfv/sTNFRI fused polypeptide.The autoimmune disease is rheumatoid arthritis.The curative effect of the medicine is presented as It is related to block the inflammatory reaction of rheumatoid arthritis.

The present invention also protects the fusion protein answering in the medicine for the treatment of and/or preventing autoimmune disease is prepared With.The autoimmune disease is rheumatoid arthritis.The curative effect of the medicine is presented as and is related to block rheumatoid arthritis Inflammatory reaction.

The invention discloses a kind of bispecific Mutiple Targets polypeptide drug for treating rheumatoid arthritis, by anti-human white Jie Element -17（Interleukin-17）Single-chain antibody scFv and human soluble tumor necrosis factor receptor I (soluble tumor Necrosis factor receptor I) fusion form.The fused polypeptide that the present invention is provided can effectively suppress collagen protein With the expression of various proinflammatories, effectively alleviate the clinical symptoms of rheumatoid arthritis, can be changed by directly application or optimization Make and make up single target spot antibody drug of current Clinical practice or the deficiency of fusion protein, or replace existing antibody drug or fusion egg In vain, become Mutiple Targets fusion protein medicine of new generation to improve the therapeutic effect to rheumatoid arthritis, for rheumatoid arthrosis Scorching treatment is worth with major application.

Description of the drawings

Fig. 1 is the structure composition schematic diagram of IL-17scfv/sTNFRI fused polypeptide.

Fig. 2 is Dot-blot result of the IL-17scfv/sTNFRI fused polypeptide in combination with antigen.

Fig. 3 is the MTT results that IL-17scfv/sTNFRI fused polypeptide blocks hTNF α biologic activity.

Fig. 4 is that IL-17scfv/sTNFRI fused polypeptide blocks the biologic activity Real time that hIL-17 produces IL-6 PCR results.

Fig. 5 is that IL-17scfv/sTNFRI fused polypeptide blocks the biologic activity Real time that hIL-17 produces IL-8 PCR results.

Fig. 6 is the impact that IL-17scfv/sTNFRI fused polypeptide is fallen ill to mice RA.

Fig. 7 is the impact that IL-17scfv/sTNFRI fused polypeptide is produced to CII antibody in RA mice serums.

Fig. 8 is impact of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine IL-1 expressions.

Fig. 9 is impact of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine IL-2 expressions.

Figure 10 is shadow of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine IL-6 expressions Ring.

Figure 11 is shadow of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine IL-10 expressions Ring.

Figure 12 is shadow of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine IL-17 expressions Ring.

Figure 13 is impact of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine TNF α expressions.

Figure 14 is the RA mice foot photos tested the 49th day.

Specific embodiment

Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, if no special instructions, is conventional method.Test material used in following embodiments, if no special instructions, is certainly What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetitions and tests, and as a result makes even Average.PET-27b (+) carrier：Novagen, CB0471776.E. coli bl21（DE3）：TaKaRa companies, 9126.According to that It is western general（sTNFRI-Fc）：Upper marine Xin Guojian Pharmaceuticaies joint-stock company（Shanghai, 12.5mg/）

Embodiment 1, the description of the structure of IL-17scfv/sTNFRI fused polypeptide

It is many that the fused polypeptide for hIL-17 and hTNF α that the present invention is provided is named as IL-17scfv/sTNFRI fusions Peptide, is made up of A fragments and B fragments.A fragments are from upstream to downstream successively by the weight chain variable district of anti-human IL-17 antibody（VH）, even Connect peptide（GS linker）, anti-human IL-17 antibody light chain variable district（VL）, antibody hinge region positioned between CH1 and CH2 (hinge region) is constituted.As shown in the sequence 1 of sequence table, its encoding gene is as shown in the sequence 2 of sequence table for A fragments.B pieces Section is made up of Soluble tumor necrosis factor receptor I.B fragments as shown in the sequence 3 of sequence table, its encoding gene such as sequence table Shown in sequence 4.The structure composition of IL-17scfv/sTNFRI fused polypeptide is shown in Fig. 1.

The preparation of embodiment 2, IL-17scfv/sTNFRI fused polypeptide

1st, after by the double chain DNA molecule over-lap PCR connection shown in the sequence 2 and sequence 4 of sequence table, pET-27b (+) is inserted The multiple clone site of carrier, obtains recombiant plasmid.

2nd, the recombiant plasmid for obtaining step 1 imports e. coli bl21（DE3）, obtain recombinant bacterium.

3rd, the recombinant bacterium that step 2 is obtained is seeded to into the LB fluid mediums containing 50 μ g/mL kanamycin, 37 DEG C, 120r/min shaken cultivation is to OD_600nm=0.5, add IPTG and make its concentration for 0.5mmol/L, 37 DEG C, 120r/min vibration trainings Foster 4h, is collected by centrifugation thalline.

4th, the thalline that step 3 is obtained, ultrasonication are taken（20KHz, 10 circulations are carried out, work 10 seconds and stop 1 in each circulation Second）, centrifugation（12000r/min, 5min）Collect precipitation（That is inclusion body）, use cleaning mixture（2M urea liquids）Add after washing and become Property liquid（Solvent is water, carbamide containing 8M, 0.1M NaH₂PO₄With 0.01M Tris-HCl, pH=8.0）In, inclusion body degeneration dissolving, Obtain the denaturing soln that protein concentration is 2.5mg/mL.

5th, the denaturing soln that 2 milliliters of steps 4 are obtained is added dropwise over into 50 milliliters of renaturation solutions（Solvent is water, carbamide containing 2M, 0.1M NaH₂PO₄With 0.01M Tris-HCl, pH=8.0）In, 4 DEG C of stationary incubation 12h, then in the PBS of pH7.4 Middle dialysis, obtains the solution containing fused polypeptide, abbreviation IL-17scfv/sTNFRI fused polypeptide solution.

IL-17scfv/sTNFRI fused polypeptide solution prepared by this step is used for embodiment 3 and embodiment 4, uses physiology Saline adjusts the concentration of fused polypeptide（The concentration of fused polypeptide is with the densitometer of protein）.

The detection of embodiment 3, the Biology identification of IL-17scfv/sTNFRI fused polypeptide and blocking activity

First, ability of the IL-17scfv/sTNFRI fused polypeptide in combination with antigen

Ripe antigen protein hTNF α are directly put on NC films（Negative control is BSA）, confining liquid（Containing 5% defatted milk Powder）Closing 2h, then with 37 DEG C of the IL-17scfv/sTNFRI fused polypeptide incubation 1h of confining liquid dilution, PBST washes film 3 times, often Secondary 10min；Again with the ripe antigen protein h IL-17 of confining liquid dilution（Purchased from OriGene Technologies companies, LY400795）, 37 DEG C of incubation 1h, PBST washes film 3 times, each 10min；Then the anti-human IL-17 monoclonal antibodies of Mus are sequentially added（It is purchased from EBioscience companies, 14-7178）It is anti-with sheep anti mouse two（Purchased from LifeSpan BioSciences companies, LS-C60712- 2000）.Finally, ECL chemiluminescences exposure.Dot-blot results are shown in Fig. 2, as a result show IL-17scfv/sTNFRI fused polypeptide With the ability in combination with hIL-17 and hTNF α.

2nd, IL-17scfv/sTNFRI fused polypeptide blocking hTNF α biologic activity detection

Take the logarithm the L929 cells of trophophase, cell density is adjusted about with RPMI1640 culture fluid after the digestion of 2.5g/L pancreatin For 1.5 × 10⁵/ mL is simultaneously inoculated in 96 porocyte culture plates, per the μ L of hole 100.37 DEG C are placed in, 5% CO₂24 are cultivated in incubator h；2nd day in advance by different dilution IL-17scfv/sTNFRI fused polypeptide (concentration is 100 μ g/mL, 25 μ g/mL, 6.25 μ g/mL, 1.5625 μ g/mL) 2h is incubated in 4 DEG C with the μ g/mL TNF αs of equal-volume 100, suction out in culture after cell attachment Clearly, the mixture of 100 μ L IL-17scfv/sTNFRI fused polypeptide and TNF α is added, and sets IL-17scfv/sTNFRI fusions Polypeptide group (only adds L929 cells and IL-17scfv/sTNFRI fused polypeptide)；TNF α group (only adds L929 cells and TNF α, not Add IL-17scfv/sTNFRI fused polypeptide).4 multiple holes are set per group；Final concentration of 1 mg/mL D actinomycin D is added per hole D；37℃、5% CO₂12 ~ 14h of culture；10 μ L/ hole MTT (5 mg/mL) are added, continues to cultivate 4h；Supernatant is abandoned, is added per hole DMSO 100μL；The mensuration absorbance A value under 490 nm wavelength.

Fig. 3 is that IL-17scfv/sTNFRI fused polypeptide suppresses MTT result of the TNF α to the lethal effect of L929 cells, knot Fruit shows that IL-17scfv/sTNFRI fused polypeptide can effectively suppress lethal effect of the TNF α to L929 cells, and into dosage according to Lai Xing.

3rd, IL-17scfv/sTNFRI fused polypeptide blocks the detection of hIL-17 biologic activity

In 10% calf serum（Purchased from GIBCO companies）, the U/mL of streptomycin 100, the U/mL of penicillin 100（It is purchased from TaKaRa companies）, 5% CO₂, 37 DEG C, Hela cells are cultivated under the conditions of saturated humidity.When Hela cell confluent monolayers, respectively Different stimulus object are added in Hela Tissue Culture Flasks.One bottle adds restructuring human il-17 maturation protein to 50 μ g/L, one bottle Restructuring human il-17 maturation protein and IL-17scfv/sTNFRI is added to be 50 μ g/L, one bottle of addition IL- to final concentration simultaneously The μ g/L of 17scfv/sTNFRI to 50, one bottle is not added with any stimulus object as negative control.5% CO₂, 37 DEG C, saturated humidity bar 20 h are cultivated under part.Cell after stimulating is collected, using Trizol（Purchased from Invitrogen companies）Method extracts cell total rna, Reverse transcription is into cDNA.The relative expression quantity of each group IL-6, IL-8 cytokine is detected using Real time PCR method.

Fig. 4, Fig. 5 result shows that IL-17scfv/sTNFRI fused polypeptide can neutralize the Hela cell of hIL-17 inductions Produce cytokine IL-6（Fig. 4）And IL-8（Fig. 5）Ability.The result demonstrates IL-17scfv/sTNFRI can be hindered well The biologic activity of disconnected hIL-17.

Detection primer sequence is as follows：

β-actin：

Forward primer：5’GCCAAAAGGGTCATCATCTC 3’

Downstream primer： 5’ GGCCATCCACAGTCTTCT 3’

IL-6：

Forward primer：5’TTCGGTCCAGTTGCCTTCTCCCT 3’

Downstream primer：5’GCTCTGGCTTGTTCCTCACTACT 3’

IL-8：

Forward primer：5’ACATACTCCAAACCTTTCCACC 3’

Downstream primer：5’AAAACTTCTCCACAACCCTCTG 3’

The application of embodiment 4, IL-17scfv/sTNFRI fused polypeptide

CII is the Collagen Type VI of chicken 2：Sigma companies, article No. is 9007-43-5.

Mice employed in the present embodiment is the SPF levels male Kunming mouse of 6-8 week old：Purchased from Beijing company of dimension tonneau China (animal quality certification number:SCXK (capital) 2012-0001).

CII is dissolved in into 0.1mol/L aqueous acetic acids（Stirring at 4 DEG C is allowed to fully dissolving）, CII concentration is obtained for 2g/ The CII solution of L, 4 DEG C place 12 hours after mix with Freund's complete adjuvant equal-volume, emulsifying, obtain CII Emulsions (in CII Emulsions CII concentration is 1g/L).

First, mice rheumatoid arthritis are set up（RA）Model is simultaneously grouped administration

It is continuous operation due to setting up model and packet administration, from model is set up meter experiment natural law is started.

1st, mouse RA model is set up

Test the 1st day, with CII Emulsion immune mouses by way of right metapedes intramuscular injection（Every mouse immune 0.1mL CII Emulsions, purpose is scorching to cause）；Test the 8th day, with CII Emulsion immune mouses by way of dorsal sc single-point is injected（Often Mouse immune 0.1mL CII Emulsions）；Test the 15-20 days, observe mice and the arthroncuss situation to mice scores, always It is model mice to be divided into the mice in the range of 8 ± 0.5.

To mice, each sufficient standards of grading is as follows：0 point：Without redness；1 point：Little toe joint swelling；2 points：Toe joint and foot Toe swelling；3 points：Sufficient pawl below ankle joint swells；4 points：Including the whole sufficient pawl swellings including ankle joint.By commenting for mice extremity Split-phase adds, as the total score of the mice（It is up to 16 points）.

2nd, from the beginning of experiment the 21st day, model mice is divided into into 5 groups（10 per group）, it is handled as follows respectively：

IL-17scfv/sTNFRI fused polypeptide groups：Single cell fusion polypeptide was given by way of lumbar injection per 2 days（Often Secondary every kilogram of mice gives 20nmol IL-17scfv/sTNFRI fused polypeptide, and every time the administered volume of every mice is 100 micro- Rise）；

IL-1 β scfv/sTNFRI fused polypeptide groups：Single cell fusion polypeptide was given by way of lumbar injection per 2 days （Every time every kilogram of mice gives 20nmol IL-1 β scfv/sTNFRI fused polypeptide, and every time the administered volume of every mice is 100 microlitres）；

IL-17 scfv groups：An IL-17 scfv single-chain antibody was given by way of lumbar injection per 2 days（It is every every time Kilogram mice gives 20nmol IL-17 scfv single-chain antibodies, and every time the administered volume of every mice is 100 microlitres）；

Embrel group：An Embrel was given by way of lumbar injection per 2 days（Every time every kilogram of mice gives 20nmol Embrels, every time the administered volume of every mice is 100 microlitres）；

CIA model group：A normal saline was given per 2 days（Every time the administered volume of every mice is 100 microlitres）；

Normal group is set simultaneously, is made up of the SPF levels male Kunming mouse of 10 6-8 week old, do not carry out any process.

2nd, the impact that IL-17scfv/sTNFRI fused polypeptide is fallen ill to mice RA

From the beginning of experiment the 21st day, the arthroncuss situation of mice is scored once per 4 days.As a result Fig. 6 is seen（Vertical coordinate generation How many days table total score, abscissa represents the of experiment；As a result it is the meansigma methodss of each group mice；* represents the P compared with CIA model group ＜ 0.01）.As a result as Fig. 6 shows, IL-17scfv/sTNFRI fused polypeptide is characterized with bright to the polyarthritis of mice Aobvious ground inhibitory action, effect is better than univalent antibody, IL-1 β scfv/sTNFRI and soluble recepter.

3rd, the impact that IL-17scfv/sTNFRI fused polypeptide is produced to CII antibody in RA mice serums

Test the 49th day, blood, CII antibody horizontals in detection mice serum are taken by eyeball.

The 1st, the CII solution of 2g/L be diluted to the CII solution of 5 μ g/mL with PBS buffer.

2nd, with the CII solution coated elisa plates of 5 μ g/mL, 100 μ L/hole, 4 DEG C overnight, are abandoned supernatant.

3rd, complete after step 2, confining liquid（1g skimmed milks are dissolved in into the PBS of 20ml pH7.4, matching while using） Closing ELISA Plate, 37 DEG C, 2h abandon supernatant.

4th, test serum sample PBS is diluted to after 50 times of volumes, addition completes the ELISA Plate of step 3, often The μ l of hole 100,37 DEG C of incubation 1h, with PBST buffer solutions 3 times.

5th, complete after step 4, add 100 μ l sheep anti mouses two to resist per hole（Purchased from LifeSpan BioSciences companies, LS-C60712-2000）, 37 DEG C are incubated 1h, use PBST buffer（PBS containing the pH7.4 that volume ratio is 0.05% Tween20 Buffer）Washing 3 times.

6th, complete after step 5, add 100 μ L TMB nitrite ions, 37 DEG C of incubation 5min that 50 μ L 2mol/ are added per hole per hole L sulphuric acid terminating reactions, read OD450nm values.

As a result see Fig. 7, be as a result the meansigma methodss of each group mice；* represents the P ＜ 0.01 compared with CIA model group.CIA models CII antibody horizontals in group mice serum are apparently higher than normal group.CII compared with CIA model group, in treatment group's mice serum Antibody horizontal is substantially reduced.CII antibody horizontals in IL-17scfv/sTNFRI fused polypeptide group mice serums are substantially less than IL-17scfv groups, IL-1 β scfv/sTNFRI groups and Embrel group mice.

4th, impact of the IL-17scfv/sTNFRI fused polypeptide to RA Mice Body based intracellular cvtokine expressions

Test the 49th day, take mouse spleen, extract total serum IgE and reverse transcription is cDNA, using cDNA as template, by Real time PCR（Using β-actin genes as internal reference）Detect the relative expression quantity of each cytokine.

Primer for identifying the relative expression quantity of IL-1 is as follows：

Forward primer：5′-CCATGGCACATTCTGTTCAAA-3′；

Downstream primer：5′-GCCCATCAGAGGCAAGGA-3′.

Primer for identifying the relative expression quantity of IL-2 is as follows：

Forward primer：5′-GCACCCACTTCAAGCTCCA-3′；

Downstream primer：5′-AAATTTGAAGGTGAGCATCCTG-3′.

Primer for identifying the relative expression quantity of IL-6 is as follows：

Forward primer：5′-ACAACCACGGCCTTCCCTACTT-3′；

Downstream primer：5′-CACGATTTCCCAGAGAACATGTG-3′.

Primer for identifying the relative expression quantity of IL-10 is as follows：

Forward primer：5′-TGCCTTCAGCCAGGTGAAGACTTTC-3′；

Downstream primer：5′-CTTGATTTCTGGGCCATGCTTCTCTG-3′.

Primer for identifying the relative expression quantity of IL-17 is as follows：

Forward primer： 5′-GGACTCTCCACCGCAATGA-3′；

Downstream primer：5′-GACCAGGATCTCTTGCTGGA-3′.

Primer for identifying the relative expression quantity of TNF-α is as follows：

Forward primer：5′-GGAAACCCAGAGGCATTGAC-3′；

Downstream primer：5′-TCAGGATCTGGCCCTTGAAC-3′.

Primer for identifying the relative expression quantity of β-actin reference genes is as follows：

Forward primer：5′-GAGACCTTCAACCCC-3′；

Downstream primer：5′-GTGGTGGTGAAGCTGTAGCC-3′.

As a result see Fig. 8-13, as a result show, compared with CIA model group, IL-17scfv/sTNFRI fused polypeptide groups, IL- IL-1 in 17scfv groups, IL-1 β scfv/sTNFRI fused polypeptide groups, Embrel group mouse spleen（Fig. 8）、IL-2（Figure 9）、IL-6（Figure 10）、IL-17（Figure 12）And TNF α（Figure 13）Expression significantly reduce, and IL-10（Figure 11）Expression Level is significantly raised, and the reduction of IL-17scfv/sTNFRI fused polypeptide groups or elevation amplitude are maximum, i.e. IL-17scfv/ The therapeutic effect of sTNFRI fused polypeptide reaches difference and shows better than IL-17scfv, IL-1 β scfv/sTNFRI and Embrel Write.As a result it is the meansigma methodss of each group mice；* represents the P ＜ 0.01 compared with CIA model group；# is represented and IL-17scfv groups, IL- 1 β scfv/sTNFRI groups compare P ＜ 0.05 with Embrel group.

5th, the monitoring of mice clinical symptoms

Without red and swollen phenomenon, action is nimbly and freely in each joint of normal group mice extremity during testing.Model group mice exists , there is skin of sole of foot hyperemia in 10d or so after first immunisation, and foot pad is raised；Ankle, toe joint swelling are substantially, sufficient after 12 ~ 16d Toe is in drum Chui shapes；The whole metapedes of 21d or so, becomes apparent from including the swelling including ankle joint, and skin is tight, rear skin of foot table Face is congested, it is impossible to bear a heavy burden, RA model modeling successes.IL-17scfv/sTNFRI fused polypeptide and each treatment group, typical arthritis Symptom mitigation, IL-17scfv/sTNFRI fused polypeptide is compared with IL-1 β scfv/sTNFRI fused polypeptide, IL-17scfv and Yi Naxi Mass treatment therapeutic effect is obvious.As a result Figure 14 is seen, the fused polypeptide has significant therapeutic effect to mice rheumatoid arthritis.

The ＞ Harbin Bo'ao Biopharmaceutical Technology Development Co., Ltd. of ＜ 110

Fused polypeptide and its applications of the ＞ of ＜ 120 for IL-17 and TNF α

The ＞ 4 of ＜ 160

The ＞ 1 of ＜ 210

The ＞ 280 of ＜ 211

The ＞ PRO of ＜ 212

The ＞ A fragment amino acid sequences of ＜ 213

The ＞ 1 of ＜ 400

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly

1 5 10 15

Ser Ser Val Lys Val Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr

20 25 30

Asp Tyr His Ile His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu

35 40 45

Glu Trp MET Gly Val Ile Asn Pro MET Tyr Gly Thr Thr Asp Tyr

50 55 60

Asn Gln Arg Phe Lys Gly Arg Val Thr Ile Thr Ala Asp Glu Ser

65 70 75

Thr Ser Thr Ala Tyr MET Glu Leu Ser Ser Leu Arg Ser Glu Asp

80 85 90

Thr Ala Val Tyr Tyr Cys Ala Arg Tyr Asp Tyr Phe Thr Gly Thr

95 100 105

Gly Val Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly

110 115 120

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp

125 130 135

Ile Val MET Thr Gln Thr Pro Leu Ser Leu Ser Val Thr Pro Gly

140 145 150

Gln Pro Ala Ser Ile Ser Cys Arg Ser Ser Arg Ser Leu Val His

155 160 165

Ser Arg Gly Asn Thr Tyr Leu His Trp Tyr Leu Gln Lys Pro Gly

170 175 180

Gln Ser Pro Gln Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ile

185 190 195

Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe

200 205 210

Thr Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr

215 220 225

Tyr Cys Ser Gln Ser Thr His Leu Pro Phe Thr Phe Gly Gln Gly

230 235 240

Thr Lys Leu Glu Ile Lys Arg Thr Glu Pro Lys Ser Ser Lys Tyr

245 250 255

Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly

260 265 270

Pro Ser Val Phe Leu Phe Pro Pro Lys Pro

275 280

The ＞ 2 of ＜ 210

The ＞ 840 of ＜ 211

The ＞ DNA of ＜ 212

The ＞ A fragment-encoding gene sequences of ＜ 213

The ＞ 2 of ＜ 400

1 caggtgcagc tggtgcagtc tggggctgag gtgaagaagc ctgggtcctc agtgaaggtt

60 tcctgcaagg catctggtta ctcattcact gactaccata ttcattgggt gcgacaggcc

120 cctggacaag ggcttgagtg gatgggagta attaatccta tgtatggtac tactgactac

180 aatcagaggt tcaagggcag agtcaccatt accgcggacg aatccacgag cacagcctac

240 atggagctga gcagcctgag atctgaggac acggccgtgt attactgtgc gagatatgat

300 tactttactg ggacgggtgt gtactggggc caaggaaccc tggtcaccgt ctcctcaggt

360 ggcggtggct ccggcggtgg tgggtcgggt ggcggcggat ctgatattgt gatgactcag

420 actccactct ccctgtccgt cacccctgga cagccggcct ccatctcctg cagatctagt

480 aggagccttg tacacagtcg tggaaacacc tatttacatt ggtacctgca gaagccaggc

540 caatctccac agctcctaat ttataaagtt tccaaccggt ttattggggt cccagacaga

600 ttcagcggca gtgggtcagg cacagatttc acactgaaaa tcagcagggt ggaggccgaa

660 gatgttgggg tttattactg ctctcaaagt acacatcttc cattcacgtt tggccaaggg

720 accaagctgg agatcaaacg aactgagccc aaatcttcca aatatggtcc cccatgccca

780 ccctgcccag cacctgagtt cctgggggga ccatcagtct tcctgttccc cccaaaaccc 840

The ＞ 3 of ＜ 210

The ＞ 160 of ＜ 211

The ＞ PRO of ＜ 212

The ＞ B fragment amino acid sequences of ＜ 213

The ＞ 3 of ＜ 400

Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys Tyr Ile His

1 5 10 15

Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys Gly Thr

20 25 30

Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp Cys

35 40 45

Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu

50 55 60

Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu MET Gly Gln

65 70 75

Val Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly

80 85 90

Cys Arg Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe

95 100 105

Gln Cys Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu

110 115 120

Ser Cys Gln Glu Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly

125 130 135

Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys Ser Asn Cys Lys

140 145 150

Lys Ser Leu Glu Cys Thr Lys Leu Cys Leu

155 160

The ＞ 4 of ＜ 210

The ＞ 480 of ＜ 211

The ＞ DNA of ＜ 212

The ＞ B fragment-encoding gene sequences of ＜ 213

The ＞ 4 of ＜ 400

1 agggagaaga gagatagtgt gtgtccccaa ggaaaatata tccaccctca aaataattcg

60 atttgctgta ccaagtgcca caaaggaacc tacttgtaca atgactgtcc aggcccgggg

120 caggatacgg actgcaggga gtgtgagagc ggctccttca ccgcttcaga aaaccacctc

180 agacactgcc tcagctgctc caaatgccga aaggaaatgg gtcaggtgga gatctcttct

240 tgcacagtgg accgggacac cgtgtgtggc tgcaggaaga accagtaccg gcattattgg

300 agtgaaaacc ttttccagtg cttcaattgc agcctctgcc tcaatgggac cgtgcacctc

360 tcctgccagg agaaacagaa caccgtgtgc acctgccatg caggtttctt tctaagagaa

420 aacgagtgtg tctcctgtag taactgtaag aaaagcctgg agtgcacgaa gttgtgccta

480

Claims

1. a kind of fused polypeptide, is made up of A fragments and B fragments；

The A fragments are following (a)：

A protein that the aminoacid sequence of () shown in sequence in sequence table 1 is constituted；

The B fragments are following (b)：

B protein that the aminoacid sequence of () shown in sequence in sequence table 3 is constituted.

2.DNA compositionss, by coding claim 1 in the A fragments DNA molecular first and coding claim 1 in institute State the DNA molecular second composition of B fragments.

3. DNA composition as claimed in claim 2, it is characterised in that：

The DNA molecular first is following (1) or the DNA molecular of (2) or (3)：

(1) DNA molecular in sequence table shown in sequence 2；

(2) the DNA sequence hybridization for limiting with (1) under strict conditions and the DNA molecular for encoding the A fragments；

(3) DNA sequence limited with (1) has more than 90% homology and encodes the DNA molecular of the A fragments；

The DNA molecular second is following (4) or the DNA molecular of (5) or (6)：

(4) DNA molecular in sequence table shown in sequence 4；

(5) the DNA sequence hybridization for limiting with (4) under strict conditions and the DNA molecular for encoding the B fragments；

(6) DNA sequence limited with (4) has more than 90% homology and encodes the DNA molecular of the B fragments.

4. plasmid composition, by the recombiant plasmid first of the DNA molecular first in containing Claims 2 or 3 and containing have the right will Seek the recombiant plasmid second composition of the DNA molecular second in 2 or 3.

5. it is a kind of for treatment and/or preventing autoimmune disease medicine, its active component be claim 1 described in fusion Polypeptide, it is characterised in that：By the hinge region of antibody by anti-human IL-17 single-chain antibodies and Soluble tumor necrosis factor receptor I The bispecific Mutiple Targets fused polypeptide being connected to form, i.e. IL-17scfv/sTNFRI, can in combination with human interleukin -17 and Huamn tumor necrosis factory alpha.

6. medicine as claimed in claim 5, it is characterised in that：The autoimmune disease is rheumatoid arthritis.

7. medicine as claimed in claim 6, it is characterised in that：The curative effect of the medicine is presented as and is related to block rheumatoid arthrosis Scorching inflammatory reaction.

8. application of the fused polypeptide as claimed in claim 1 in the medicine for the treatment of and/or preventing autoimmune disease is prepared, The autoimmune disease is rheumatoid arthritis.

9. application as claimed in claim 8, it is characterised in that：The curative effect of the medicine is presented as and is related to block rheumatoid arthrosis Scorching inflammatory reaction.