CN102241774B - Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application - Google Patents

Abstract

The invention relates to the technical fields of gene engineering and protein engineering, and specifically provides DNA encoding recombinant fusion protein comprising Fc segment of IgE and anti-EGFR single chain variable fragment (scFv), a coded fusion protein, a production method of the fusion protein, a drug application of the fusion protein and a treatment method of the fusion protein. According to the invention, the fusion protein has good biological activity and stability both in vivo and in vitro, and is capable of blocking the targeted EGFR positive tumor cells, activating immune cells and specifically killing tumor cells, thereby the growth of tumor can be inhibited and the invention has good application prospect.

Description

Restructuring IgE-Fc-anti-EGFR single-chain antibody fusion rotein and its production and use

Technical field

The present invention relates to genetically engineered and protein engineering field, specifically, relate to production method, the pharmaceutical use of this fusion rotein and the methods for the treatment of of this fusion rotein of encoded packets containing the coding DNA of single-chain antibody (scFv) recombination fusion protein of IgE-Fc section and anti-EGFR, its coded fusion rotein, this fusion rotein.

Background of invention

Human immunoglobulin is divided into IgG, IgA, IgM, IgD, IgE five classes.The main effects molecule of replying as humoral immunity of organism, different immunoglobulin (Ig)s is being exercised different functions.Wherein IgG is the main antibody of humoral immune reaction, and its content in serum is the highest, reaches 6～16mg/ml, accounts for 75%～80% of serum I g total amount, molecular weight 150kDa.The Fc section of IgG can with the Fc receptors bind on the surface such as neutrophil leucocyte, monocyte, scavenger cell, activation effect cell kills and wounds target cell, bring into play anti-infective, neutralize a toxin and immune opsonization.IgE is the minimum a kind of immunoglobulin (Ig) of content in normal human serum, and its content is 0.0001～0.009mg/ml, is about 0.05% of IgG concentration, and its molecular weight is about 190kDa.Everybody thinks that the function of IgE is mainly participate in antiparasitic immunity and cause the allergy of I type with some environmental factor effect all the time.Colonizing in the multiple pathogenic parasite of humans and animals body (as nematode, schistosomicide etc.) is exactly by this antibody suppression and removing.After pathogen or irritated thing are combined with IgE, there is crosslinking reaction in the multiple IgE-Fc acceptor molecules of effect cell surface (Fc ε Rs) such as its Fc section and mastocyte, basophil, causes the effector cell's such as mastocyte, basophil activation and the release of biologically active substance ^[1,2].IgE-Fc mainly contains two kinds of acceptors: Fc ε RI and Fc ε RII (CD23), wherein high-affinity receptor Fc ε RI is mainly distributed in mastocyte, basophil and onthe surface of monocytes, and low-affinity receptor Fc ε RII is mainly distributed in scavenger cell, eosinophilic granulocyte and NK cell surface ^[3,4].After the receptors bind on IgE and these effector cell surfaces, the stimulatory effect cell release cells factor and chemokine, cause strong immune response, and these cytokines comprise interleukin, histamine, chemokine, tumour necrosis factor etc.The region of the upper receptors bind of IgE and effector cell is positioned at its Fc section (IgE-Fc), the namely C ε 2 of its heavy chain, C ε 3, C ε 4 regions.If acceptor molecule is on scavenger cell, corresponding cell or pathogen are killed in mediated cell phagolysis, the cell-mediated cytophagy (antibody-dependent cellular phagocytosis, ADCP) that antibody relies on ^[6].Some researchs in recent years show that IgE brings into play important immunity monitoring and immuno-potentiation in tumour generating process.It is exactly to utilize IgE-Fc to carry out coupling effect cell in fact that the present invention utilizes the immunostimulant reaction that IgE mediates, and tumour cell is carried out to local killing and wounding ^[7,8].

Over nearly 20 years, monoclonal antibody is especially treated tumour as pharmacological agent disease and has been obtained breakthrough, has had 27 antibody to be entered by FDA approval clinical, as IDEC-C2B8 Mabthera (Rituximab) ^[8]with anti-VEGF mAb rhuMAb-VEGF (Bevacizumab, Avastin) ^[9].Meanwhile, there are nearly 500 antibody at present before clinical and the clinical study stage.Classical anti-tumour antibody is no matter be that mouse source or chimeric or humanized or even total man's antibody is substantially all take IgG type (being mainly IgG1) as basic.Its antitumor mechanism is: the molten cytological effect of (1) mediation complement, be cellulotoxic effect (the complement dependent cytotoxicity of Complement Dependent, CDC), after IgG (IgG1 and IgG3) antibody-like is combined with TSA, activating complement classical pathway, the final membrane attack complex (membrane attack complex, MAC) that forms, dissolves tumour cell.(2) the cell-mediated cellulotoxic effect that antibody relies on, NK cell, monocyte and neutrophilic granulocyte are by its surperficial Fc _γr and anti-tumour antibody (IgG) combination, by cell-mediated cytotoxic effect (antibody-dependent cell-mediated cytotoxicity, ADCC) effect and killing tumor cells.(3) the immune opsonization of antibody, i.e. anti-tumour antibody and phagocytic cell surface Fc _γr combination, strengthens cytophagous phagocytic function.In addition, anti-tumour antibody is combined with tumour antigen can complement activation, is combined with phagocytic cell surface C R1 by produced C3b, promotes its phagolysis.(4) some receptor antibody of antibody sealing tumor cell surface can affect by some acceptor of sealing tumor cell surface the biological behaviour of tumour cell.(5) disturb tumor cell adhesion effect, some antibody tumor cell surface adhesion molecule capable of blocking is combined with the adhesion molecule receptor of vascular endothelial cell or other cell surfaces, thereby stops growth of tumour cell, adhesion and transfer.Body anti-tumour effect is very complicated, and specificity and non-specific antitumor mechanism are interlaced, and humoral immunization and cellular immune mechanism are mutually coordinated and supplemented, and jointly carry out immune surveillance function ^[10,11].Generally speaking, IgG major part is by ADCC and CDC approach mediation apoptosis of tumor cells; And the mechanism of the IgE anti-tumor activity of this research is different therewith, we utilize cytokine therapy, by IgE mediate effector cell discharge cytokine carry out local lethal effect at tumor cell surface.So their antitumor mechanism stresses difference, and IgE antibody not only has the main immunologic function of IgG compared with traditional IgG, has more the irreplaceable advantage of some IgG, and this inquires into the discussion at article one by one ^[12].This research, take this theory as basis, has selected IgE to build more novel, more efficient immunne response fusion protein molecule as the prototype of antibody reconstruction.So as the prospective therapeutic strategy of one, the anti-tumor function of IgE and active checking are to be worth very much exploring.

EGF-R ELISA (epidermal growth factor receptor, EGFR) is the expression product of proto-oncogene c-erbB1.The physiological processs such as EGFR is distributed widely in the cell surfaces such as Mammals epithelial cell, inoblast, spongiocyte, keratinocyte, growth, propagation and the differentiation of EGFR signal path to cell play an important role.Its autocrine approach is the important factor of tumor development, in the processes such as tumor cell proliferation, migration, neonate tumour blood vessel and transfer, plays a significant role ^[13].Under normal circumstances, EGFR Tyrosylprotein kinase exists with monomeric form, structurally be made up of extracellular region, cross-film district, 3 parts of intracellular region, wherein extracellular region has two halfcystines and enriches district, and intracellular region has typical ATP-binding site and Tyrosylprotein kinase district.When after specific part and EGFR receptors bind, cause that acceptor is changed into the dimerization state of activation by the free state of inactivation, and then inherent Tyrosylprotein kinase in activation born of the same parents, the tyrosine residues of its born of the same parents' inner segment is by autophosphorylation or cross phosphorylation, cause that downstream comprises the activation of the signal path such as PI3K-Akt, MAPK-ERK, propagation, transfer, survival and the new vessel of modulate tumor cell generate ^[14].All find at multiple solid tumor that at present crossing of EGFR express in as mammary cancer, lung cancer, colorectal carcinoma, prostate cancer, kidney, bladder cancer, head and neck cancer, ovarian cancer, cerebral tumor.In recent years, the antitumor drug research and development of targeting EGFR family have become a hot fields, wherein for the western appropriate former times (C225 of monoclonal antibody of EGFR, Erbitux) and small molecule tyrosine kinase inhibitors Gefitinib (Gefitinib, Ireasa) be successfully applied to clinical ^[15,16].

Single-chain antibody (single chain variable fragment, scFv) be by connection peptides (Linker) a kind of small molecules genetic engineering antibody forming of recombinating by the variable region of heavy chain VH of antibody and variable region of light chain VL, it has possessed the antigen binding capacity that original antibody is good, and it is little to have molecular weight, penetration power is strong, the characteristic such as short and immunogenicity of body-internal-circulation transformation period is low.On this basis, can be built into the multiple antibody molecule with new function with other effector molecule, be the base components that builds immunotoxin and bi-specific antibody.The research and development of single-chain antibody in recent years more and more come into one's own, and also have some such antibody to enter into clinical trial ^[17].

The present invention need to carry out the development of the antineoplaston medicine of novel efficient, low side effect at present, to meet people's demand.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of new effective selection for antitumor drug treatment.The major programme that the present invention solves this technical problem has been to provide a kind of new fused protein.

Fused protein of the present invention is by the single-chain antibody EGFR scFv of anti-human EGF-R ELISA and forms from the Fc section IgE-Fc of human normal immunoglobulin IgE, between EGFR scFv and IgE-Fc, is connected by connection peptides.

This fused protein can be described as restructuring IgE-Fc-anti-EGFR single-chain antibody fusion rotein.Single-chain antibody can light chain front, also can heavy chain front.Can EGFR scFv between EGFR scFv and IgE-Fc front, also can IgE-Fc.Preferably EGFR scFv is at front (N end).

Wherein, the aminoacid sequence of the Fc section of the human normal immunoglobulin IgE described in above-mentioned fused protein is:

(1) as described in SEQ ID NO.4 in sequence table;

Or (2): in the aminoacid sequence shown in SEQ ID No.4, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.

Wherein, the aminoacid sequence of the single-chain antibody of the anti-human EGF-R ELISA of people described in above-mentioned fused protein is:

(1) as described in SEQ ID NO.2 in sequence table.

Or (2): in the aminoacid sequence shown in SEQ ID No.2, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.

Wherein, the connection peptides behaviour immunoglobulin hinge region described in above-mentioned fused protein.

Wherein, the aminoacid sequence of the human normal immunoglobulin hinge area described in above-mentioned fused protein is:

EPKSCDKTHTCPPCP。

If no special instructions, the aminoacid sequence of enumerating in the present invention is all from left to right from nitrogen end to carbon teminal.

Wherein, there is the connection peptides that connects light chain and heavy chain the inside of the single-chain antibody EGFR scFv of the anti-human EGF-R ELISA described in above-mentioned fused protein, and the aminoacid sequence of its connection peptides is: GGGGSGGGGSGGGGS.

Wherein, the aminoacid sequence of above-mentioned fused protein is:

(1) as shown in SEQ ID NO.12 in sequence table;

Or (2): in the aminoacid sequence shown in SEQ ID No.12, pass through replacement and/or disappearance and/or add the same or analogous protein of one or several amino acid gained function.This fused protein can be expressed as IgE-Fc-EGFRscFv.

Further, above-mentioned fused protein, is characterized in that, is also connected with signal peptide at N end.

Wherein, the aminoacid sequence of above-mentioned fused protein is:

(1) as shown in SEQ ID NO.8 in sequence table;

Or (2): in the aminoacid sequence of the albumen shown in SEQ ID No.8 through replacement and/or disappearance and/or add one or several amino acid gained with SEQ ID No.? the same or analogous protein of function of shown fused protein.

The present invention also provides the recombinant DNA of the above-mentioned fused protein of encoding.

Wherein, the nucleotides sequence of above-mentioned recombinant DNA is classified as:

(1) as the SEQ ID NO.7 in sequence table or SEQ ID NO.11 or be the degenerate sequence of SEQ ID NO.7 or SEQ ID NO.11;

Or (2): in the nucleotide sequence limiting in (1) through replacement, lack or add the nucleotide sequence of the derivative gained of one or several Nucleotide, and the same or analogous protein of nucleotide sequence coded function limiting with (1).

The present invention also provides the recombinant vectors that comprises above-mentioned recombinant DNA.

Wherein, above-mentioned recombinant vectors is plasmid vector or virus vector.

Meanwhile, the present invention also provides the recombinant chou that comprises above-mentioned recombinant vectors.Further, described recombinant chou is host cell.Preferably eukaryotic host cell of described host cell.Host cell can be for this fusion rotein of secreting, expressing.

In addition, the present invention also provides above-mentioned fused protein, above-mentioned recombinant vectors or above-mentioned recombinant chou in the application of preparing in antitumor drug.

The present invention goes back and then provides a kind of pharmaceutical composition.This pharmaceutical composition comprises that above-mentioned fused protein, recombinant vectors or above-mentioned recombinant chou also add auxiliary material pharmaceutically as activeconstituents.Further, above-mentioned pharmaceutical composition, also comprises any one or more other antitumor drug.

Main points of the present invention are to have designed and built the fusion rotein of the Fc section of a kind of human normal immunoglobulin IgE and the single-chain antibody (scFv) of anti-human EGF-R ELISA (EGFR), its objective is the targeted therapy function such immunostimulant molecule of coupling IgE-Fc simultaneously that utilizes EGFRscFv.Can either target tumor cell-surface antigens the antitumor mechanism of performance EGFRscFv, excite the immune response of IgE-Fc mediation simultaneously, have complementary functions.For EGFRscFv, as the antibody of EGFR, it was just playing the part of the function of blocking EGF and EGFR combination originally, thus angiogenic growth and tumor cell proliferation that a series of signal path that suppresses to cause thus causes.And utilize its institute ADCC that mediates, ADCP and multiple antitumor cell factor suppress or kill tumour cell for IgE-Fc, the two cooperatively interacts, to obtain better oncotherapy effect.Owing to having added the Fc fragment of human normal immunoglobulin, the fusion rotein of preparing in genetically engineered mode can exist with dimeric forms by forming disulfide linkage between Fc fragment.

The Fc section that comprises human normal immunoglobulin IgE that the present invention describes and single-chain antibody (scFv) fusion rotein of anti-human EGF-R ELISA (EGFR) are constructed by conventional gene recombination technology, specific experiment step as " molecular cloning " third edition (Joseph Sambrook, Science Press) and similarly laboratory manual record.Wherein, IgE Fc, EGFRscFv and connection peptides are respectively:

1. the Fc section of human normal immunoglobulin IgE, is expressed as IgE-Fc, and aminoacid sequence is as described in SEQ ID NO.1 in sequence table.

2. the single-chain antibody (scFv) of anti-human EGF-R ELISA (EGFR), is expressed as EGFRscFv, and aminoacid sequence is as described in SEQ ID NO.2 in sequence table.

Connection peptides used between 3.IgE-Fc and EGFRscFv, is expressed as EPKSCDKTHTCPPCP, and aminoacid sequence is as described in SEQ ID NO.6 in sequence table.

Above-mentioned optimization fusion albumen and the DNA of coding thereof can obtain by conventional gene recombination technology.Such as the DNA sequence dna of the Fc section of required encoding human Immunoglobulin IgE can be from clinical peripheral blood lymphocytes in asthmatic patients clone gained, the single-chain antibody (scFv) of anti-human EGF-R ELISA (EGFR) can screen gained from phage antibody library, then the DNA sequence dna of the above-mentioned optimization fusion albumen of coding is cloned into respectively in carrier with PCR or after directly synthesizing acquisition, used carrier can be plasmid, virus or the DNA fragmentation that molecular biology is conventional.DNA sequence dna front end at the above-mentioned optimization fusion albumen of coding adds protein excretion signal peptide sequence, to guarantee that recombinant protein secretes out from cell.Carrier sequence comprises promotor, protein translation initial sum termination signal and polyadenylic acid (PolyA) sequence for driving genetic expression.In carrier, contain antibiotics resistance gene, be beneficial to carrier at host cell as copying and expressing in bacterium and eukaryotic cell.In addition, in carrier, also comprise eukaryotic cell selected gene, for the selection of stable transfection host cell strain.

After completing the plasmid construction of the DNA sequence dna that contains the above-mentioned optimization fusion albumen of coding, available this recombinant vectors transfection or transformed host cell, express corresponding fused protein.Can be used in and express the expression system of these fusion roteins and have multiplely, can be eukaryotic cell, can be also prokaryotic cell prokaryocyte, and they include, but is not limited to mammalian cell, bacterium, yeast, insect cell etc.In aminoacid sequence due to optimization fusion albumen of the present invention, comprising can glycosylated amino acid, and therefore mammalian cell is the vote of expressing this albumen.The mammalian cell that can be used for extensive marking protein has multiple, such as Chinese hamster ovary celI, 293 cells, NS0 cell, COS cell, bhk cell etc., other many cells also can be for the expression of albumen, is therefore all included in the row of the cell that the present invention can use.The recombinant plasmid that contains the above-mentioned optimization fusion protein gene of encoding can enter host cell through transfection, and the method for transfectional cell has multiple, comprising (but being not limited to) electroporation, liposome transfection method and calcium phosphate transfection method etc.

Preferably protein expression is, in the host cell of stable transfection, recombinant vectors is carried out to a gene amplification, to improve the expression amount of corresponding recombination fusion protein.For example, after the host cell with the recombinant vectors stable transfection that contains Liu Suanyan NEOMYCIN SULPHATE (Neomycin) resistant gene without neomycin resistance, can in cell culture fluid, increase the concentration of Liu Suanyan NEOMYCIN SULPHATE with the number of copies of recombinant vectors in host cell that increase; For example lack after the host cell of DHFR with the recombinant vectors stable transfection that contains Tetrahydrofolate dehydrogenase (DHFR) gene again, can in cell culture fluid, increase the concentration of methotrexate (MTX) with the number of copies of recombinant vectors in host cell that increase.

Other expression systems beyond mammalian cell, such as bacterium, yeast, insect cell etc. also can be for expressing optimization fusion albumen of the present invention, the row of their host cells that also involved the present invention can use.The protein output of these expression systems is higher than mammalian cell, but sugar chain structure and the mammalian cell of expressed potein deficiency glycosylation or formation are different.

After optimization fusion protein expression, available enzyme linked immunosorbent adsorption test (ELISA) or additive method are measured the fusion rotein concentration in cell culture fluid.Because these optimization fusion albumen contain immunoglobulin Fc, therefore can carry out the expressed optimization fusion albumen of purifying with protein A-sepharose affinity chromatography.In addition, combine use with other method for purifying proteins as ion exchange chromatography etc., can be further purified optimization fusion albumen of the present invention.

From recombinant chou nutrient solution, obtain after corresponding optimization fusion albumen, can detect its combination activity to EGFR with cell ELISA and flow cytometry, experimental result shows, optimization fusion albumen of the present invention can be in conjunction with the cell of the EGFR positive as A431 cell, therefore the constructed optimization fusion albumen of the present invention can be blocked the combination of IgE-Fc-EGFRscFv, be a kind of targeting EGFR, carry out killing tumor cell by chemotactic and activate immunity effector cell, thus performance antitumor action.

Application of purified method obtains after highly purified optimization fusion albumen, can utilize animal model in In vitro cell model and body to detect its retarding effect to tumour cell.In experiment, EGFR expresses positive tumour cell can carry out the growth-inhibiting effect of inspection optimization fusion rotein to these cells by methods such as MTT as A549 lung carcinoma cell, MDA-MB-435 mammary cancer, Raji lymphoma cell etc. in vitro.In experiment, the tumour cell of the above-mentioned EGFR positive can be used for building mouse tumor model in vivo, and the methods such as tumor model can be subcutaneous by abdomen dorsal part, abdominal cavity, tail vein build, for observing the antitumor or anti-metastasis experiment of fusion rotein.

The present invention also provides the method that delivers and express these optimization albumen with virus vector.These virus vector include but not limited to adenovirus carrier (adenoviral vectors), gland relevant viral vector (adeno-associated viral vectors), retrovirus vector (retroviral vectors), herpes simplex virus vector (herpes simplex virus-based vectors), lentiviral vectors (lentiviral vectors).

The present invention also provides the pharmaceutical composition that contains fusion rotein of the present invention and pharmaceutical carrier.This pharmaceutical composition can be prepared into various forms of pharmaceutical preparations according to pharmaceutics routine techniques, even more preferably injection, most preferably freeze drying injection.

Pharmaceutical composition of the present invention, wherein also comprise any one or more other the synergistic antitumor drug that has, described composition can be treated tumour together with other methods for the treatment of, and described other methods for the treatment of comprises chemotherapy, radiotherapy, biotherapy.

The present invention is take EGFR as target spot, build EGFRscFv, and then associating IgE-Fc built the bi-specific antibody of the such fusion proteins of IgE-Fc-EGFRscFv, its objective is the targeted therapy function such immunostimulant molecule of coupling IgE-Fc simultaneously that utilizes EGFRscFv.Can either target tumor cell-surface antigens the antitumor mechanism of performance EGFRscFv, excite the immune response of IgE-Fc mediation simultaneously, have complementary functions.For EGFRscFv, as the antibody of EGFR, it was just playing the part of the function of blocking EGF and EGFR combination originally, thus angiogenic growth and tumor cell proliferation that a series of signal path that suppresses to cause thus causes.And utilize its institute ADCC that mediates, ADCP and multiple antitumor cell factor to suppress or kill tumour cell for IgE-Fc.Wish that the two can cooperatively interact, to obtain better oncotherapy effect.

Not only utilize the targeting of antibody as traditional antitumor drug in the present invention, utilized the synergy after antibody and antibody coupling simultaneously.The coupling that the bispecific fusion protein antibody that the present invention builds had both utilized EGFR MAbs blocking between EGFR and EGF, and then suppress the vasculogenesis that a series of signal paths that cause thus cause, tumor proliferation.Meanwhile, utilized the special anti-tumor activity of IgE yet, effector cell is gathered around tumor cell tissue, effectively utilized ADCC and the such function of ADCP of effector cell's performance, suppressed the growth of tumour, the two its function of various enforcements does not interfere with each other.And experimental results show that when these 2 antibody are joined together to form by Linker after fusion rotein antibody, therefore their function separately is not affected.Bispecific fusion protein antibody of the present invention all has good biological activity and stability in vivo and in vitro, can block targeting EGFR positive tumor cell, immune cell activated, specific killing tumour cell, thereby the growth of inhibition tumour.The IgE-Fc sequence of IgE-Fc-EGFRscFv fusion rotein is total man's source sequence, and immunogenicity is low, and the molecular weight of whole fusion rotein is lower than other antibody class medicines, has good application prospect.

Accompanying drawing explanation

The IgE-Fc agarose gel electrophoresis that Fig. 1 RT-PCR amplifies

M is Marker, and the the 1st, 2,3,4 roads are PCR product sample, have all occurred expection band at 1000bp place, and result is consistent with expection.

The design diagram of Fig. 2 IgE-Fc-EGFRscFv fusion rotein

Fig. 3 EGFRscFv double digestion is identified

After Xbal and BamHI double digestion, electrophoresis showed first only has a band, does not expect that band occurs, 2 bands appear in the the 2nd, 3,4,5 roads, and wherein the band of big or small about 900bp is expection band, and result is consistent with expection.

The double digestion of Fig. 4 IgE-Fc-EGFRScFv fusion rotein carrier is identified

Wherein 1 road is fusion rotein plasmid; 2 roads cut the band of big or small about 1000bp, and double enzyme site is Xbal and BamHI; 3 roads cut the band of big or small about 900bp, and double enzyme site is BamHI and NheI.

Western blot check analysis after Fig. 5 fusion rotein transient transfection efficiency and expression

A: observe its transfection efficiency figure after proceeding to pcDNA3.1 (+)-GFP carrier by same system.B: first is the Chinese hamster ovary celI sample after transfection, and second is the supernatant sample after transfection CHO cell, the Chinese hamster ovary celI sample that San road is untransfected, Si road is the supernatant sample of untransfected CHO.

Screening and the check analysis of its stable strain after Fig. 6 fusion rotein carrier transfection CHO cell

6 supernatants of collecting while being cloned in different time points are made the detected result of ELISA.

Fig. 7 Flow cytometry cell surface receptor: EGFR and Fc ε RI

The expression of results of Chinese hamster ovary celI, 293 cells and U937 monocyte EGFR is negative, and the detected result of A431 is positive; Chinese hamster ovary celI, when 293 cells and A431 cell detection acceptor Fc ε RI, result is negative, and the monocytic detected result of U937 is positive.

Fig. 8 utilizes flow cytometer to detect the IgE-Fc of fusion rotein and the activity of EGFR scFv

In in detected result, A, C, D figure are negative findings, and B schemes positive result, and IgE-Fc and EGFR scFv show function separately.

Fig. 9 IgE-Fc-EGFRscFv fusion rotein anti-tumor function is analyzed

In figure, add up every group of A431 necrocytosis index, the analysis that takes statistics, its result has statistical significance.

Embodiment

Following instance is explained in detail structure, the experiment and application of optimization fusion albumen involved in the present invention.But content of the present invention and purposes are not limited in the category of example.

The clone of embodiment 1:IgE-Fc gene

Gather the fresh blood 15ml of asthma patient, in gnotobasis, isolate peripheral blood lymphocyte, extract total RNA by Trizol method.Design has comprised that the primer of initiator codon and terminator codon is single stage method RT-PCR.

Upstream primer: 5 '-CGGGATCCCCCACCGTGAAGATCTTACAGTCGT-3 ' (SEQ ID NO.13);

Downstream primer: 5 '-GCTCTAGATCATTTACCGGGATTTACAGACACCG-3 ' (SEQ IDNO.14).

The RT-PCR product obtaining is identified its big or small about 1000bp by DNA electrophoresis, meets (seeing Fig. 1) with 970bp as expected.After again RT-PCR product being loaded into T-Easy carrier, check order, compare with the sequence of reporting in NCBI Genebank database, sequence is consistent.

The clone of embodiment 2:EGFRscFv

Higher heavy chain VH and the light chain VL of avidity going out from Phage Antibody Library, connect and build anti-EGFR single-chain antibody (scFv) with Linker, and add secreting signal peptide IgK sequence at the N of EGFRscFv end, and by Mammals codon, gene order redesigned and optimize, design and synthesize oligonucleotide fragment, be spliced into length EGF RscFv by overlapping PCR method, be written in PUC57 carrier.

Obtain after synthetic EGFRscFv sequence, PUC57-EGFRscFv is transformed to intestinal bacteria and carry out plasmid amplification, target sequence is done to double digestion reaction enzyme from PUC57 carrier according to the restriction enzyme site (XbaI and BamHI) of design to scale off, visible the 2nd, 3,4,5 swimming lanes of DNA electrophoresis have all cut out two bands, its medium and small band is about 900bp, conform to expected results, the 1st swimming lane not enzyme cuts out expection band.After being reclaimed, small segment utilize ligation that this fragment is cloned in pcDNA3.1 (+) carrier, and sequence verification is consistent with design result.

Design and the vector construction of embodiment 3:IgE-Fc-EGFRscFv fusion rotein

The Design Mode figure of the fusion rotein in the present invention is as Fig. 2.NheI, BamHI, XbaI are clone's restriction enzyme site of design.In order to guarantee that this fusion rotein can be secreted into extracellular, we have selected Ig kappa leader sequence (being IgK) as secretory signal sequence, because the advantages such as its stability and high efficiency are often selected as the secretion sequence of protein carrier for expression of eukaryon, this sequence is totally 21 amino acid (21aa, METDTLLLWVLLLWVPGSTGD), corresponding DNA sequence dna is:

5’-ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC-3’。

Connect EGFRscFv heavy chain (Heavy chain, VH, 354bp) and light chain (Light chain, VL, Linker 327bp) adopts (GGGGS) 3, and its corresponding coding nucleotide sequence is (SEQ ID NO.9): GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG.Research in the past shows that this Linker has stronger tension force and flexibility, and stability is very strong, is often selected as the link member of scFv.

The hinge area of having selected IgG1 is Hinge district, 15aa:EPKSCDKTHTCPPCP (SEQ ID NO.5), and coding nucleotide sequence is 45 bases:

GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCA (SEQ ID NO.6) is used as connecting the middle joining region (connection peptides) of EGFRscFv and IgE-Fc, to guarantee that the two can both be folded to form correct separately conformation.Wherein IgE-Fc length is 970bp, and EGFRscFv length is 824bp, and finally this IgE-Fc-EGFRscFv fusion rotein total length is 1794bp, the fusion rotein of 597 amino acid (the SEQ ID NO.10) that encode.

The object of the invention is to build the carrier for expression of eukaryon of IgE-Fc-EGFRscFv fusion rotein, obtaining targetedly respectively under the prerequisite of IgE-Fc fragment and EGFRscFv fragment, adopting substep method of attachment to be cloned in carrier for expression of eukaryon pcDNA3.1 (+).After vector construction, do respectively double digestion checking, occurred that at the second swimming lane and the 3rd swimming lane size is about the expection band of 1000bp and 850bp respectively; Estimate to be respectively IgE-Fc fragment and the EGFRscFv fragment band under double digestion.Get 10 μ l plasmid order-checkings, sequencer address is consistent with implementation sequence.

Embodiment 4: the checking of gene transient transfection and expressing fusion protein

The IgE-Fc-EGFRscFv fusion rotein carrier having built is passed through to Lipo2000 transfection CHO cell.In order to detect the expression of albumen, first fusion rotein carrier is done to transient transfection, and establish 4 groups, they are respectively: IgE-Fc-EGFRscFv fusion rotein group (2 μ g Plasmid+6 μ g LIP), pcDNA3.1 (+) group (2 μ g Plasmid+6 μ gLIP), GFP-pcDNA3.1 (+) group (2 μ g Plasmid+6 μ g LIP), untransfected group, the Chinese hamster ovary celI sample of fusion rotein carrier of having collected respectively transfection after 48 hours, cell conditioned medium after transfection, the cell sample of untransfected and the cell conditioned medium of untransfected, be Western bolt and verify whether this fusion rotein expresses and secrete in supernatant, result is all observed the expression of target protein at first and second, molecular weight is about 62kDa (under reductive condition, for single chain protein), He tetra-roads, San road do not detect target protein.Meanwhile, for whether the transfection efficiency of observing this system can meet the demands, we proceed to the Chinese hamster ovary celI (seeing Fig. 5) of pcDNA3.1 (+)-GFP with fluorescence microscope after 48 hours in transfection.

Obtain after the recombinant plasmid of high purity coding IgE-Fc-EGFRscFv, utilize Lipofectamine 2000 plasmid transfection test kits (Invitrogen company) by Transfected Recombinant Plasmid Chinese hamster ovary celI (ATCC), in serum free medium, cultivate after three days and collect Chinese hamster ovary celI supernatant liquor, can detect with immunoblotting the expression (seeing Fig. 5) of IgE-Fc-EGFRscFv fusion rotein.This method can be used for obtaining rapidly a small amount of IgE-Fc-EGFRscFv fusion rotein, and its concentration can detect with ELISA standard measure, and primary antibodie used can be anti human IgE-Fc antibody.

Embodiment 5:IgE-Fc-EGFRscFv fusion rotein stably express in Chinese hamster ovary celI

Under the prerequisite that can express in Chinese hamster ovary celI at this fusion rotein of checking, Chinese hamster ovary celI after transfection is stablized to the screening of strain with G418, select monoclonal cell, by classification enlarged culturing in 24 orifice plates, 6 orifice plates, T25-Flask and T75-Flask, and conservation.With the expression amount of fusion rotein in supernatant after after the detection of ELISA method and screening replacing substratum 0,12,24,36,48,60 hour, filter out wherein the highest efficient expression strain with this.Result shows that when being cloned in substratum for No. 4 changes latter 48 hours, expression amount (is shown in greatly Fig. 6).

In the present invention, fusion rotein is expressed and is secreted in nutrient solution in Chinese hamster ovary celI, and utilizes the method purifying gained of SP affinity chromatography.The cell culture fluid that comprises IgE-Fc-EGFRscFv fusion rotein can adopt the method for SP affinity chromatography to carry out purifying.By albumin A-Sepharose chromatography column with PBS damping fluid balance after, the Chinese hamster ovary celI nutrient solution supernatant liquor sample introduction that ultra-fine filter was concentrated, monitor with A280, with PBS damping fluid rinse to unconjugated albumen all by wash-out, then the citric acid elution of bound albumen of using 100mM, neutralizes with the Tris-HCl of 1M at once.Owing to having added Fc fragment, fusion rotein can exist with dimeric forms by disulfide linkage.Fusion rotein after purifying can be used ELISA method detectable level.The elutriant that comprises fusion rotein can freeze-drying after desalting and purifying, can be placed in-20 ℃ long-term and preserve after freeze-drying.

The activity of embodiment 6:IgE-Fc-EGFRscFv fusion rotein detects

In order to verify whether fusion rotein has kept IgE-Fc and EGFRscFv immunologic competence separately, first we detect respectively whether whether high expression level Fc ε RI of high expression level EGFR and U937 monocyte of cell strain A431 by flow cytometry, selected Chinese hamster ovary celI and 293 cells in contrast.Result shows: Chinese hamster ovary celI and 293 cells are not all expressed EGFR and Fc ε RI, detected result is all negative, and A431 cell EGFR expression rate is about 95.7% (seeing Fig. 7), and the expression rate of U937 monocyte Fc ε RI is about 77.1%, detected result is positive (being shown in Fig. 7) all.

Next, further detect and verify the immunologic competence of IgE-Fc-EGFRscFv fusion rotein.Detection strategy as follows: IgE-Fc-EGFRscFv prepared by embodiment 5 is hatched as primary antibodie and A431, then develops the color by FITC-anti-IgE.Result shows, by the antibody of FITC-anti-IgE can detect this fusion rotein EGFR scFv can with A431 Cell binding, its combination rate is about 68.3%, its fluidic cell result directly illustrates that IgE-Fc and EGFR scFv express on same molecule, and have separately activity, these two parts can either form alone correct folding non-interference function (seeing Fig. 8) again.

Embodiment 7: fusion rotein antitumor activity

Adopt tumour cell and monocyte mixed culture method to carry out the anti-tumor activity of this fusion rotein of Preliminary detection.After the fusion rotein that adds embodiment 5 to prepare after 72 hours, PBS washes away monocyte, carry out propidium iodide (PI) dyeing, the situation that observation of cell core is colored under fluorescent microscope is to determine the cell quantity being killed and wounded, result shows that the fusion rotein that we build can play comparatively significantly immunologic cytotoxicity effect, and this system can design according to expectation complete killing and wounding of tumour cell.And under fluorescent microscope, take pictures, adjusting focal length approximately has 20 total cells to each visual field, takes pictures continuously 50.Count out the absolute death toll of approximately 1000 A431 cells in every group of experiment, do statistical study, result shows that fusion rotein treatment group and control group have notable difference (seeing Fig. 9).

Because antibody has specific selective action, effector substance can be concentrated at tumor focus place or tumor cell surface, and kill and wound target cell.Over more than 10 year, the antibody of existing kinds of tumors related antigen is for the targeted therapy of tumour both at home and abroad, these antibody are substantially all take IgG as basis transformation, or chimeric as Rituximab, or people source as Trastuzumab, even have total man's antibody to enter clinical trial as HuMax-CD4 ^[18].About the research that utilizes IgE to have the lethal effect to tumour cell was just reported to some extent in 1991 ^[19], Sehon and he's partner one reinstates IgE and resists breast cancer cell and breed with it mouse, demonstrates the anti-tumor activity of IgE, but his this research is not together with IgE and other antibody coupling, jointly brings into play anti-tumor function.

IgE can be under the condition of extremely low concentration with its effector cell on Fc receptor seq (Fc ε Rs) combination, stimulate body to produce strong immune response, speed is rapid, has improved therapeutic efficiency and cost.So dosage that it only need to be very low, this is the difference very large with IgG, if and in fact in the time that antibody is used as drug use, need very large dosage conventionally will be considered to the limitation that this is this antibody because it likely produces too serious HAMA reaction.Second, the classical pathway that IgE not only can activate most IgG kills tumour cell, and it can also excite picture antigen presenting cell (antigen-presenting cells, etc. APC) effector cell of broad variety discharges a large amount of cytokines more, and mediation ADCC and ADCP act on tumour cell.

The IgE-Fc-EGFRscFv fusion rotein carrier having built is done the improvement on structure and function by the present invention, utilize the mediation ADCC function that IgG not only can activation effect cell, simultaneously again can activating complement approach, by the apoptosis-induced tumour cell that kills of Complement-dependent cytotoxicity (CDC) approach.If as we that think deeply above can be on an antibody molecule simultaneously the anti-tumor activity of coupling IgG and IgE be optimal, should be all better than the antitumous effect of alone any antibody.The Fc section of IgG comprises two part C γ 2 and C γ 3, it can pass through activating macrophage, NK cell, dendritic cell, activating complement effect when mediation ADCC reaction, and IgE-Fc comprises C ε 2, C ε 3, C ε 4 these 3 parts, it can activate mastocyte, eosinophilic granulocyte, basophilic granulocyte, monocyte, scavenger cell, NK cell.Wherein the major function of C ε 4 and C γ 3 is all in low-affinity receptor combination, and mediation ADCC reaction, is therefore by more high efficiency of the structure of this fusion rotein, also can only need to retain C ε 2 and the C ε 3 of IgE-Fc when transformation fusion rotein structure.So according to the actual development of this research, we have designed following these schemes and have further strengthened the function of this fusion rotein, and have completed the content of part, to expect to obtain better healing effect.

In the present invention, we have not only utilized the targeting of antibody as traditional antitumor drug, have utilized the synergy after antibody and antibody coupling simultaneously.The IgE-Fc-EGFRscFv fusion rotein building is like this bi-specific antibody (BsAb), is also bifunctional antibody (BfAb).BsAb can gather respectively effector cell's (T cell by two antigen binding sites, NK cell, scavenger cell) and target cell (tumour cell), make the two close to each other and raised, thereby make in two cell occur to interact and induction target cell is dissolved.This specific character of BsAb can make effector cell obtain the dissolving power that antibody relies on.The coupling that the bispecific fusion protein antibody that the present invention builds had both utilized EGFR MAbs blocking between EGFR and EGF, and then suppress the vasculogenesis that a series of signal paths that cause thus cause, tumor proliferation.Simultaneously, we have also utilized the special anti-tumor activity of IgE, and effector cell is gathered around tumor cell tissue, have effectively utilized ADCC and the such function of ADCP of effector cell's performance, suppress the growth of tumour, the two its function of various enforcements does not interfere with each other.And we also verified when these 2 antibody are joined together to form by Linker after fusion rotein antibody, therefore their function separately is not affected.The development trend of Past 30 Years antibody drug is again to even human antibody of people source type antibody from mouse source type antibody to mosaic type antibody, everybody is actively finding the lower medicine of immunogenicity, avoid the generation of HAMA reaction, the IgE-Fc sequence of IgE-Fc-EGFRscFv fusion rotein is total man's sequence, immunogenicity is low, and the molecular weight of whole fusion rotein is lower than other antibody class medicines.

Reference

1.Sly?RM(1999)Changing?prevalence?of?allergic?rhinitis?and?asthma.Ann?Allergy?Asthma?Immunol82：233-48

2.Karagiannis?SN，Bracher?MG，Beavil?RL，Beavil?AJ，Hunt?J，McCloskey?N，Thompson?RG，East?N，Burke?F，Sutton?BJ，Dombrowicz?D，Balkwill?FR，and?Gould?HJ(2008)Role?of?IgE?receptors?in?IgEantibody-dependent?cytotoxicity?and?phagocytosis?of?ovarian?tumor?cells?by?human?monocytic?cells.Cancer?Immunol?Immunother?57：247-63

3.Namazi?MR(2007)Extension?of?the“Hygiene?Hypothesis’to?the?negative?associationbetween?acne?and?atopy，hematological?malignancies，and?malignant?melanoma.Medical?Hypotheses?69：960-961

4.Christie?G，Barton?A，Bolognese?B，Buckle?DR，Cook?RM，Hansbury?MJ，Harper?GP，Marshall?LA，McCord?ME，Moulder?K，Murdock?PR，Seal?SM，Spackman?VM，Weston?BJ，Mayer?RJ(1997)IgE?secretion?is?attenuated?by?an?inhibitor?of?proteolytic?processing?ofCD23(Fc?epsilonRII).Eur?J?Immunol?27：3228-3235

5.Zhang?M，Murphy?RF，Agrawal?DK(2007)Decoding?IgE?Fc?receptors.Immunol?Res?37：1-16.

6.Karagiannis?SN，Bracher?MG，Beavil?RL，Beavil?AJ，Hunt?J，McCloskey?N，Thompson?RG，East?N，Burke?F，Sutton?BJ，Dombrowicz?D，Balkwill?FR，Gould?HJ(2008)Role?of?IgEreceptors?in?IgE?antibody-dependent?cytotoxicity?and?phagocytosis?of?ovarian?tumor?cells?by?human?monocytic?cells.Cancer?Immunol?Immunother?57：247-263

7.Milner?JD，Brenchley?JM，Laurence?A，Freeman?AF，Hill?BJ，Elias?KM，Kanno?Y，Spalding?C，Elloumi?HZ，Paulson?ML，Davis?J，Hsu?A，Asher?AI，O’Shea?J，Holland?SM，Paul?WE，Douek?DC(2008)Impaired?T(H)17cell?differentiation?in?subjects?with?autosomal?dominant?hyper-IgE?syndrome.Nature?452：7

8.Davis?ta，Grillo?lopez?a?j，White?c?A(2000)Rituximab?anti-CD20monoclonal?antibody?therapy?innon-Hodgkins’lymphoma?saftyand?ef-ficacy?of?retreatment.J?Clinic?On-col.18(17)：3135-3143.

9.Mason，JO，Albert，MA，Vail，R.(2006)Intravitreal?bevacizumab(Avastin)for?refractory?pseudophakic?cystoid?macular?edema.Retina?26：356-357.

10.Lu?W，Zhao?Z，Zhao?Y，Yu?S，Zhao?Y，Fan?B，Kacskovics?I，Hammarstrom?L，Li?N(2007)Over-expression?of?the?bovine?FcRn?in?the?mammary?gland?results?in?increased?IgG?levelsin?both?milk?and?serum?of?transgenic?mice.Immunology?19：311-318

11.Uhrberg，M，Valiante，N，Shum，B，Shilling，G，Lienert-Weidenbach，K，Corliss，B，Tyan，D，Lanier，L，Parham，P(1997)Human?diversity?in?killer?cell?inhibitory?receptor?genes.Immunity，7：753.Kaisho?T，Schwenk?F，Rajewsky?K(1997)The?roles?of?gamma?l?heavy?chain?membraneexpression?and?cytoplasmic?tail?in?IgG1?responses.Science?276：412-415

12.Scaltriti?M，Baselga?J(2006)The?epidermal?growth?factor?receptor?pathway：a?model?for?targeted?therapy.Clin?Cancer?Res?12：5268-5272

Oncotherapy foreign medical science physiological and pathological and the clinical fascicle of 13. Wang Cheng emerging (2000) take EGFR and mutant thereof as target spot, 20:1372140.

14.Sharma?SV，Bell?DW，Settleman?J(2007)Epidermal?growth?factor?receptor?mutations?in?lung?cancer.Nat?Rev?Cancer?7：169-181

15.McKillop?D，Partridge?EA，Kemp?JV，Spence?MP，Kendrew?J，Barnett?S，Wood?PG，Giles?PB，Patterson?AB，Bichat?F，Guilbaud?N，Stephens?TC(2005)Tumor?penetration?of?gefitinib(Iressa)，an?epidermal?growth?factor?receptor?tyrosine?kina.Mol?Cancer?Ther?4：641-649.

16.Yokota?T，Milenic?DE，Whitlow?M(1992)Rapid?tumor?penetration?of?a?single-chain?Fv?and?comparison?with?other?immunoglobulin?forms.Cancer?Research?52：3402-3408.

17.Aubrey?N，Muzard?J，Juste?M(2006).Recombinant?antibodies：towards?a?new?generation?of?antivenoms.J?Soc?Biol，200：345-354.

18.Koh?W-P，Yuan?J-M，Wang?R，Seow?A，Lee?H-P，Yu?MC(2008)Chronic?rhinosinusitis?and?risk?of?lung?cancer?in?the?Singapore?Chinese?Health?Study.Int?J?Cancer?123：1398-1402

19.Nagy?E，Berczi?I，and?Sehon?AH(1991)Growth?inhibition?of?murine?mammary?carcinoma?by?monoclonal?IgE?antibodies?specific?for?the?mammary?tumor?virus.Cancer?Immunol?Immunother?34：63-69

Claims (11)

1. a fused protein, is characterized in that: by the single-chain antibody EGFR scFv of anti-human EGF-R ELISA with form from the Fc section IgE-Fc of human normal immunoglobulin IgE, between EGFR scFv and IgE-Fc, be connected by connection peptides; Its aminoacid sequence is as shown in SEQ ID NO.12 in sequence table.

2. fused protein as claimed in claim 1, is characterized in that: be also connected with signal peptide at N end.

3. fused protein as claimed in claim 2, is characterized in that: its aminoacid sequence is as shown in SEQ ID NO.8 in sequence table.

4. fused protein as claimed in claim 1, is characterized in that: the Fc fragment by human normal immunoglobulin forms dimer protein form.

5. the recombinant DNA of coding claim 1～4 any one fused protein.

6. recombinant DNA according to claim 5, is characterized in that: its nucleotide sequence is as shown in the SEQ ID NO.7 in sequence table or SEQ ID NO.11 or be the degenerate sequence of SEQ ID NO.7 or SEQ ID NO.11.

7. comprise the recombinant vectors of recombinant DNA described in claim 5 or 6.

8. recombinant vectors according to claim 7, is characterized in that, described recombinant vectors is plasmid vector or virus vector.

9. comprise the host cell of recombinant vectors described in claim 7 or 8.

10. the fused protein described in claim 1～4 any one, recombinant vectors described in claim 7 or 8 or host cell claimed in claim 9 are in the application of preparing in antitumor drug.

11. 1 kinds of pharmaceutical compositions, comprise the fused protein described in claim 1～4 any one, recombinant vectors or host cell claimed in claim 9 and the auxiliary material pharmaceutically described in claim 7 or 8.

Images