CN102241774A - Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application - Google Patents
Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application Download PDFInfo
- Publication number
- CN102241774A CN102241774A CN2011101401829A CN201110140182A CN102241774A CN 102241774 A CN102241774 A CN 102241774A CN 2011101401829 A CN2011101401829 A CN 2011101401829A CN 201110140182 A CN201110140182 A CN 201110140182A CN 102241774 A CN102241774 A CN 102241774A
- Authority
- CN
- China
- Prior art keywords
- ige
- seq
- cell
- fused protein
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention relates to the technical fields of gene engineering and protein engineering, and specifically provides DNA encoding recombinant fusion protein comprising Fc segment of IgE and anti-EGFR single chain variable fragment (scFv), a coded fusion protein, a production method of the fusion protein, a drug application of the fusion protein and a treatment method of the fusion protein. According to the invention, the fusion protein has good biological activity and stability both in vivo and in vitro, and is capable of blocking the targeted EGFR positive tumor cells, activating immune cells and specifically killing tumor cells, thereby the growth of tumor can be inhibited and the invention has good application prospect.
Description
Technical field
The present invention relates to genetically engineered and protein engineering field, specifically, relate to coding DNA, its coded fusion rotein, the production method of this fusion rotein, the pharmaceutical use of this fusion rotein and the methods of treatment of this fusion rotein that coding comprises single-chain antibody (scFv) recombination fusion protein of IgE-Fc section and anti-EGFR.
Background of invention
The human immunoglobulin is divided into IgG, IgA, IgM, IgD, IgE five classes.As the main effects molecule that humoral immunity of organism is replied, different immunoglobulin (Ig)s is being exercised different functions.Wherein IgG is the main antibody of humoral immune reaction, and its content in serum is the highest, reaches 6～16mg/ml, accounts for 75%～80% of serum I g total amount, molecular weight 150kDa.The Fc section of IgG can with the Fc receptors bind on surface such as neutrophil leucocyte, monocyte, scavenger cell, the activation effect cell kills and wounds target cell, bring into play anti-infective, neutralize a toxin and immune opsonization.IgE is the minimum a kind of immunoglobulin (Ig) of content in the normal human serum, and its content is 0.0001～0.009mg/ml, is about 0.05% of IgG concentration, and its molecular weight is about 190kDa.Everybody thinks that the function of IgE mainly is to participate in antiparasitic immunity and cause the allergy of I type with some environmental factor effect all the time.Colonize in the multiple pathogenic parasite of humans and animals body (as nematode, schistosomicide etc.) and be exactly and suppressed by this antibody and remove.When pathogen or irritated thing with after IgE combines, crosslinking reaction takes place in a plurality of IgE-Fc acceptor molecules of effect cell surface (Fc ε Rs) such as its Fc section and mastocyte, basophil, causes the activation of effect cells such as mastocyte, basophil and the release of biologically active substance
[1,2]IgE-Fc mainly contains two kinds of acceptors: Fc ε RI and Fc ε RII (CD23), wherein high-affinity receptor Fc ε RI mainly is distributed in mastocyte, basophil and monocyte surface, and low-affinity receptor Fc ε RII mainly is distributed in scavenger cell, eosinophilic granulocyte and NK cell surface
[3,4]The stimulatory effect cell discharges cytokine and chemokine after the receptors bind on IgE and these effector cell surfaces, causes the intensive immune response, and these cytokines comprise interleukin, histamine, chemokine, tumour necrosis factor etc.The zone that IgE and effector cell go up receptors bind is positioned at its Fc section (IgE-Fc), just the C ε 2 of its heavy chain, C ε 3, C ε 4 zones.If acceptor molecule is on scavenger cell, then corresponding cell or pathogen are killed in the mediated cell phagolysis, i.e. and the cell-mediated cytophagy of antibody dependence (antibody-dependent cellular phagocytosis, ADCP)
[6]In recent years some studies show that IgE brings into play important immunity monitoring and immuno-potentiation in the tumour generating process.The immunostimulant reaction that the present invention utilizes IgE to mediate is exactly to utilize IgE-Fc to come the coupling effector cell in fact, and tumour cell is carried out partial killing and wounding
[7,8]
Over nearly 20 years, monoclonal antibody is especially treated tumour as the pharmacological agent disease and has been obtained breakthrough, and there had 27 antibody to be entered by the FDA approval to be clinical, as IDEC-C2B8 Mabthera (Rituximab)
[8]With anti-VEGF monoclonal antibody rhuMAb-VEGF (Bevacizumab, Avastin)
[9]Simultaneously, there are nearly 500 antibody to be in the clinical preceding and clinical study stage at present.Classical anti-tumour antibody is no matter be that the mouse sourceization or chimeric or humanized or even total man's antibody is substantially all based on IgG type (mainly being IgG1).Its antitumor mechanism is: the molten cytological effect of (1) mediation complement, be cellulotoxic effect (the complement dependent cytotoxicity that complement relies on, CDC), IgG (IgG1 and IgG3) antibody-like is with after TSA combines, the activating complement classical pathway, final formation membrane attack complex (membrane attack complex, MAC), the dissolving tumour cell.(2) the cell-mediated cellulotoxic effect of antibody dependence, promptly NK cell, monocyte and neutrophilic granulocyte are by its surperficial Fc
γR combines with anti-tumour antibody (IgG), by cell-mediated cytotoxic effect (antibody-dependent cell-mediated cytotoxicity, ADCC) effect and killing tumor cells.(3) the immune opsonization of antibody, i.e. anti-tumour antibody and phagocytic cell surface Fc
γThe R combination strengthens cytophagous phagocytic function.In addition, anti-tumour antibody and tumour antigen bound energy complement activation combine with phagocytic cell surface C R1 by the C3b that is produced, and promote its phagolysis.(4) some receptor antibody of antibody sealing tumor cell surface can influence the biological behaviour of tumour cell by some acceptor of sealing tumor cell surface.(5) disturb the tumor cell adhesion effect, some antibody tumor cell surface adhesion molecule capable of blocking combines with the adhesion molecule part of vascular endothelial cell or other cell surfaces, thereby stops growth of tumour cell, adhesion and transfer.The body anti-tumour effect is very complicated, and specificity and non-specific antitumor mechanism are interlaced, and humoral immunization and cellular immune mechanism are coordinated mutually and replenished, and carry out immune surveillance function jointly
[10,11]Generally speaking, the IgG major part is by ADCC and CDC approach mediation apoptosis of tumor cells; And the mechanism of the IgE anti-tumor activity of this research is different therewith, and we utilize the cytokine therapy, and promptly the cytokine that discharges by IgE mediation effector cell is carried out local lethal effect at tumor cell surface.So their antitumor mechanism stresses difference, and IgE antibody is compared the main immunologic function that not only has IgG with traditional IgG, has more the irreplaceable advantage of some IgG, and this will inquire into one by one in the discussion part of article
[12]This research is based on this theory, selected IgE to make up more novel, immunne response fusion protein molecule more efficiently as the prototype of antibody reconstruction.So as a kind of prospective therapeutic strategy, the anti-tumor function of IgE and active checking are to be worth very much exploring.
(epidermal growth factor receptor EGFR) is the expression product of proto-oncogene c-erbB1 to EGF-R ELISA.EGFR is distributed widely in cell surfaces such as Mammals epithelial cell, inoblast, spongiocyte, keratinocyte, and the physiological processs such as growth, propagation and differentiation of EGFR signal path pair cell play an important role.Its autocrine approach is the important factor of tumor development, plays a significant role in processes such as tumor cell proliferation, migration, neonate tumour blood vessel and transfer
[13]Generally, the EGFR Tyrosylprotein kinase exists with monomeric form, structurally by extracellular region, stride 3 parts in film district, intracellular region and form, wherein extracellular region has that two halfcystines are abundant to be distinguished, intracellular region has typical A TP binding site and Tyrosylprotein kinase district.After specific part and EGFR receptors bind, cause that acceptor changes activated dimerization state into by the free state of inactivation, and then intrinsic Tyrosylprotein kinase in the activation born of the same parents, the tyrosine residues of its born of the same parents' inner segment is by autophosphorylation or cross phosphorylation, cause that the downstream comprises the activation of signal paths such as PI3K-Akt, MAPK-ERK, the propagation of modulate tumor cell, transfer, survival and new vessel generate
[14]Find all in multiple solid tumor such as mammary cancer, lung cancer, colorectal carcinoma, prostate cancer, kidney, bladder cancer, head and neck cancer, ovarian cancer, cerebral tumor that at present crossing of EGFR express.In recent years, the antitumor drug research and development of targeting EGFR family have become a hot fields, wherein at the monoclonal antibody of EGFR west appropriate former times (C225, Erbitux) and small molecules tyrosine kinase inhibitor Gefitinib (Gefitinib, Ireasa) successfully be applied to clinical
[15,16]
Single-chain antibody (single chain variable fragment, scFv) be a kind of small molecules genetic engineering antibody that the variable region of heavy chain VH of antibody and variable region of light chain VL are formed by connection peptides (Linker) reorganization, it has possessed the good antigen binding capacity of original antibody, and it is little to have molecular weight, penetration power is strong, characteristic such as short and immunogenicity of body-internal-circulation transformation period is low.On this basis, can be built into multiple antibody molecule with new function with other effector molecule, be the base components that makes up immunotoxin and bi-specific antibody.The research and development of single-chain antibody in recent years more and more come into one's own, and also have some such antibody to enter into clinical trial
[17]
The present invention need carry out the development of the antineoplaston medicine of novel efficient, low side effect at present, to satisfy people's demand.
Summary of the invention
The technical problem to be solved in the present invention is to provide a kind of new effective selection for the antitumor drug treatment.The major programme that the present invention solves this technical problem has provided a kind of new fused protein.
Fused protein of the present invention is to be made of the single-chain antibody EGFR scFv of anti-Human epidermal growth factor receptor and Fc section IgE-Fc from human normal immunoglobulin IgE, is linked to each other by connection peptides between EGFR scFv and the IgE-Fc.
This fused protein can be described as reorganization IgE-Fc-anti-EGFR single-chain antibody fusion rotein.Single-chain antibody can light chain preceding, but also heavy chain preceding.But EGFR scFv is preceding between EGFR scFv and the IgE-Fc, but also IgE-Fc.Preferably EGFR scFv is at preceding (N end).
Wherein, the aminoacid sequence of the Fc section of the human normal immunoglobulin IgE described in the above-mentioned fused protein is:
(1) as described in the SEQ ID NO.4 in the sequence table;
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.4, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.
Wherein, the aminoacid sequence of the single-chain antibody of the anti-Human epidermal growth factor receptor of people described in the above-mentioned fused protein is:
(1) as described in the SEQ ID NO.2 in the sequence table.
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.2, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.
Wherein, the connection peptides behaviour immunoglobulin hinge region described in the above-mentioned fused protein.
Wherein, the aminoacid sequence of the human normal immunoglobulin hinge area described in the above-mentioned fused protein is:
EPKSCDKTHTCPPCP。
If no special instructions, the aminoacid sequence of enumerating among the present invention from left to right all is to carbon teminal from the nitrogen end.
Wherein, there is the connection peptides that connects light chain and heavy chain the inside of the single-chain antibody EGFR scFv of the anti-Human epidermal growth factor receptor described in the above-mentioned fused protein, and the aminoacid sequence of its connection peptides is: GGGGSGGGGSGGGGS.
Wherein, the aminoacid sequence of above-mentioned fused protein is:
(1) shown in SEQ ID NO.12 in the sequence table;
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.12, pass through replacement and/or disappearance and/or add the same or analogous protein of one or several amino acid gained function.This fused protein can be expressed as IgE-Fc-EGFRscFv.
Further, above-mentioned fused protein is characterized in that, also is connected with signal peptide at the N end.
Wherein, the aminoacid sequence of above-mentioned fused protein is:
(1) shown in SEQ ID NO.8 in the sequence table;
Perhaps (2): in the proteic aminoacid sequence shown in the SEQ ID No.8 through replacement and/or disappearance and/or add one or several amino acid gained with SEQ ID No.? the same or analogous protein of the function of shown fused protein.
The present invention also provides the recombinant DNA of the above-mentioned fused protein of encoding.
Wherein, the nucleotides sequence of above-mentioned recombinant DNA is classified as:
(1) as SEQ ID NO.7 in the sequence table or SEQ ID NO.11 or be the degenerate sequence of SEQ ID NO.7 or SEQ ID NO.11;
Perhaps (2): in the nucleotide sequence that (1) limits through replacing, lack or add the derive nucleotide sequence of gained of one or several Nucleotide, and the same or analogous protein of nucleotide sequence coded function that limits with (1).
The present invention also provides the recombinant vectors that comprises above-mentioned recombinant DNA.
Wherein, above-mentioned recombinant vectors is plasmid vector or virus vector.
Simultaneously, the present invention also provides the recombinant chou that comprises above-mentioned recombinant vectors.Further, described recombinant chou is a host cell.Described host cell is eukaryotic host cell preferably.Host cell can be used for this fusion rotein of secreting, expressing.
In addition, the present invention also provides above-mentioned fused protein, above-mentioned recombinant vectors or the above-mentioned application of recombinant chou in the preparation antitumor drug.
The present invention goes back and then provides a kind of pharmaceutical composition.This pharmaceutical composition comprises that above-mentioned fused protein, recombinant vectors or above-mentioned recombinant chou are as activeconstituents and add pharmaceutically auxiliary material.Further, above-mentioned pharmaceutical composition also comprises any or several other antitumor drugs.
Main points of the present invention are to have designed and made up the fusion rotein of the single-chain antibody (scFv) of the Fc section of a kind of human normal immunoglobulin IgE and anti-Human epidermal growth factor receptor (EGFR), its objective is the targeted therapy function such immunostimulant molecule of coupling IgE-Fc simultaneously that utilizes EGFRscFv.Can either the target tumor cell-surface antigens antitumor mechanism of performance EGFRscFv, the immune response of simultaneous excitation IgE-Fc mediation has complementary functions.For EGFRscFv, as the antibody of EGFR, it was just playing the part of blocking-up EGF and EGFR bonded function originally, thus angiogenic growth and tumor cell proliferation that a series of signal path that suppresses to cause is thus caused.And utilize its institute ADCC that mediates, ADCP and multiple antitumor cell factor to suppress or the kill tumor cell for IgE-Fc, the two cooperatively interacts, to obtain better oncotherapy effect.Owing to added the Fc fragment of human normal immunoglobulin, the fusion rotein for preparing in the genetically engineered mode can exist with dimeric forms by segmental formation of Fc disulfide linkage.
The Fc section that comprises human normal immunoglobulin IgE that the present invention describes and single-chain antibody (scFv) fusion rotein of anti-Human epidermal growth factor receptor (EGFR) are constructed by the gene recombination technology of routine, concrete experimental procedure is put down in writing as " molecular cloning " third edition (Joseph Sambrook, Science Press) and similar laboratory manual.Wherein, IgE Fc, EGFRscFv and connection peptides are respectively:
1. the Fc section of human normal immunoglobulin IgE is expressed as IgE-Fc, and aminoacid sequence is as described in the SEQ ID NO.1 in the sequence table.
2. the single-chain antibody (scFv) of anti-Human epidermal growth factor receptor (EGFR) is expressed as EGFRscFv, and aminoacid sequence is as described in the SEQ ID NO.2 in the sequence table.
3.IgE-Fc and the used connection peptides between the EGFRscFv, be expressed as EPKSCDKTHTCPPCP, aminoacid sequence is as described in the SEQ ID NO.6 in the sequence table.
Above-mentioned optimization fusion rotein and coded DNA thereof can obtain by conventional gene recombination technology.Dna sequence dna such as the Fc section of required coding human normal immunoglobulin IgE can be from clinical asthmatic patient peripheral blood lymphocyte clone gained, the single-chain antibody (scFv) of anti-Human epidermal growth factor receptor (EGFR) can screen gained from phage antibody library, the dna sequence dna of above-mentioned optimization fusion rotein of will encoding then is cloned into respectively in the carrier after with PCR or directly synthetic the acquisition, and used carrier can be molecular biology plasmid, virus or a dna fragmentation commonly used.Dna sequence dna front end at the above-mentioned optimization fusion rotein of coding adds the protein excretion signal peptide sequence, secretes from cell to guarantee recombinant protein.Comprise the promotor, protein translation initial sum termination signal and polyadenylic acid (PolyA) sequence that are used to drive genetic expression in the carrier sequence.Contain antibiotics resistance gene in the carrier, be beneficial to carrier duplicating and expressing in host cell such as bacterium and eukaryotic cell.In addition, also comprise the eukaryotic cell selected gene in the carrier, be used for the selection of stable transfection host cell strain.
After the plasmid construction of finishing the dna sequence dna that contains the above-mentioned optimization fusion rotein of encoding, promptly available this recombinant vectors transfection or transformed host cell are expressed corresponding fusion proteins matter.Can be used in and express these Expression of Fusion Protein systems and have multiplely, can be eukaryotic cell, also can be prokaryotic cell prokaryocyte, and they include, but is not limited to mammalian cell, bacterium, yeast, insect cell etc.Comprise in the aminoacid sequence of fusion rotein can glycosylated amino acid because the present invention optimizes, so mammalian cell is to express this proteic vote.The mammalian cell that can be used for extensive marking protein has multiple, for example Chinese hamster ovary celI, 293 cells, NS0 cell, COS cell, bhk cell etc., therefore other many cells also can be used for proteic expression, all are included in the row of the cell that the present invention can use.The recombinant plasmid that contains the above-mentioned optimization antigen-4 fusion protein gene of encoding can enter host cell through transfection, and the method for transfectional cell has multiple, comprising (but being not limited to) electroporation, liposome transfection method and calcium phosphate transfection method etc.
A kind of preferable protein expression is in the host cell of stable transfection recombinant vectors to be carried out gene amplification, to improve the expression amount of corresponding recombination fusion protein.For example, do not have the host cell of neomycin resistance with the recombinant vectors stable transfection that contains Xin Meisu (Neomycin) resistant gene after, the concentration that can increase Xin Meisu in cell culture fluid is with the number of copies of recombinant vectors in host cell that increase; After for example lacking the host cell of DHFR with the recombinant vectors stable transfection that contains Tetrahydrofolate dehydrogenase (DHFR) gene again, the concentration that can increase methotrexate (MTX) in cell culture fluid is with the number of copies of amplification recombinant vectors in host cell.
Other expression systems beyond the mammalian cell, for example bacterium, yeast, insect cell etc. also can be used to express optimization fusion rotein of the present invention, the row of the host cell that their also involved the present invention can use.The protein output of these expression systems is more higher than the mammalian cell, but the sugar chain structure and the mammalian cell of expressed potein deficiency glycosylation or formation are different.
After optimizing expressing fusion protein, available enzyme linked immunosorbent adsorption test (ELISA) or additive method are measured the fusion rotein concentration in the cell culture fluid.Contain immunoglobulin Fc because these optimize fusion rotein, therefore can come the expressed optimization fusion rotein of purifying with the albumin A affinity chromatography.In addition, unite use, can be further purified optimization fusion rotein of the present invention with other method for purifying proteins such as ion exchange chromatography etc.
After from the recombinant chou nutrient solution, obtaining corresponding optimization fusion rotein, it is active to detect its combination to EGFR with cell ELISA and flow cytometry, experimental result shows, optimization fusion rotein of the present invention can be in conjunction with EGFR positive cells such as A431 cell, therefore the constructed optimization fusion rotein of the present invention can be blocked the combination of IgE-Fc-EGFRscFv, be a kind of targeting EGFR, come killing tumor cell by chemotactic and activate immunity effector cell, thus the performance antitumor action.
After the application of purified method obtains highly purified optimization fusion rotein, can utilize the interior animal model of cell in vitro model and body to detect its retarding effect to tumour cell.In experiment in vitro, EGFR expression male tumour cell such as A549 lung carcinoma cell, MDA-MB-435 mammary cancer, Raji lymphoma cell etc. can detect with methods such as MTT optimizes the growth-inhibiting effect of fusion rotein to these cells.In the experiment, above-mentioned EGFR male tumour cell can be used for making up mouse tumor model in vivo, and methods such as tumor model can be subcutaneous by the abdomen dorsal part, abdominal cavity, tail vein make up, to be used to observe the antitumor or anti-metastasis experiment of fusion rotein.
The present invention also provides and has delivered and express these with virus vector and optimize proteic method.These virus vector include but not limited to adenovirus carrier (adenoviral vectors), gland relevant viral vector (adeno-associated viral vectors), retrovirus vector (retroviral vectors), herpes simplex virus vector (herpes simplex virus-based vectors), lentiviral vectors (lentiviral vectors).
The present invention also provides the pharmaceutical composition that contains fusion rotein of the present invention and pharmaceutical carrier.This pharmaceutical composition can be prepared into various forms of pharmaceutical preparations according to the pharmaceutics routine techniques, even more preferably injection, most preferably freeze drying injection.
Pharmaceutical composition of the present invention, wherein also comprise any or several other have a synergistic antitumor drug, described composition can be treated tumour together with other methods of treatment, and described other methods of treatment comprises chemotherapy, radiotherapy, biotherapy.
The present invention is target spot with EGFR, made up EGFRscFv, and then associating IgE-Fc made up the bi-specific antibody of the such fusion rotein class of IgE-Fc-EGFRscFv, its objective is the targeted therapy function such immunostimulant molecule of coupling IgE-Fc simultaneously that utilizes EGFRscFv.Can either the target tumor cell-surface antigens antitumor mechanism of performance EGFRscFv, the immune response of simultaneous excitation IgE-Fc mediation has complementary functions.For EGFRscFv, as the antibody of EGFR, it was just playing the part of blocking-up EGF and EGFR bonded function originally, thus angiogenic growth and tumor cell proliferation that a series of signal path that suppresses to cause is thus caused.And utilize its institute ADCC that mediates, ADCP and multiple antitumor cell factor to suppress or the kill tumor cell for IgE-Fc.Wish that the two can cooperatively interact, to obtain better oncotherapy effect.
Not only utilized the targeting of antibody in the present invention, utilized the synergy behind antibody and the antibody coupling simultaneously as traditional antitumor drug.The bispecific fusion protein antibody that the present invention makes up had both utilized the EGFR monoclonal antibody to block coupling between EGFR and the EGF, and then suppressed a series of vasculogenesis that signal path caused that cause thus, tumor proliferation.Simultaneously, utilized the special anti-tumor activity of IgE yet, the effector cell is gathered around the tumor cell tissue, effectively utilized the ADCC and the such function of ADCP of effector cell's performance, suppressed growth of tumor, the two its function of various enforcements is not disturbed mutually.And experimental results show that after these 2 antibody are joined together to form fusion rotein antibody by Linker therefore their function separately is not affected.Bispecific fusion protein antibody of the present invention all has good biological activity and stability in vivo and in vitro, can block the targeting EGFR positive tumor cell, immune cell activated, and the specific killing tumour cell, thus suppress growth of tumor.The IgE-Fc sequence of IgE-Fc-EGFRscFv fusion rotein is total man's source sequence, and immunogenicity is low, and the molecular weight of whole fusion rotein is lower than other antibody class medicines, has good application prospects.
Description of drawings
The IgE-Fc agarose gel electrophoresis that Fig. 1 RT-PCR amplifies
M is Marker, and the 1st, 2,3,4 roads are PCR product sample, all the expection band all occurred at the 1000bp place, and the result is consistent with expection.
The design diagram of Fig. 2 IgE-Fc-EGFRscFv fusion rotein
Fig. 3 EGFRscFv double digestion is identified
Behind Xbal and the BamHI double digestion, electrophoresis showed first road has only a band, does not expect that band occurs, and 2 bands appear in the 2nd, 3,4,5 roads, and wherein the band of the about 900bp of size is the expection band, and the result is consistent with expection.
The double digestion of Fig. 4 IgE-Fc-EGFRScFv fusion rotein carrier is identified
Wherein 1 road is the fusion rotein plasmid; 2 roads downcut the band of the about 1000bp of size, and double enzyme site is Xbal and BamHI; 3 roads downcut the band of the about 900bp of size, and double enzyme site is BamHI and NheI.
Fig. 5 fusion rotein transient transfection efficient and the Western blot check analysis of expression back
A: change over to by same system and to observe its transfection efficiency figure behind pcDNA3.1 (+)-GFP carrier.B: first road is the Chinese hamster ovary celI sample after the transfection, and second road is the supernatant sample behind the transfection CHO cell, and the 3rd road is the Chinese hamster ovary celI sample of untransfected, and the 4th road is the supernatant sample of untransfected CHO.
The screening and the check analysis of its stable strain behind Fig. 6 fusion rotein carrier transfection CHO cell
6 supernatants of collecting when being cloned in different time points are made the detected result of ELISA.
Fig. 7 Flow cytometry cell surface receptor: EGFR and Fc ε RI
The expression of results of Chinese hamster ovary celI, 293 cells and U937 monocyte EGFR is negative, and the detected result of A431 is positive; Chinese hamster ovary celI, the result is negative when 293 cells and A431 cell detection acceptor Fc ε RI, and the monocytic detected result of U937 is positive.
Fig. 8 utilizes flow cytometer to detect the IgE-Fc of fusion rotein and the activity of EGFR scFv
A, C, D figure are negative findings in the detected result, and B schemes positive result, and IgE-Fc and EGFR scFv show function separately.
Fig. 9 IgE-Fc-EGFRscFv fusion rotein anti-tumor function is analyzed
Added up every group of A431 necrocytosis index among the figure, the analysis that takes statistics, its result has statistical significance.
Embodiment
Following example is to structure, the experiment of optimization fusion rotein involved in the present invention and should be used as detailed description.But content of the present invention and purposes are not limited in the category of example.
The clone of embodiment 1:IgE-Fc gene
Gather the fresh blood 15ml of asthma patient, in gnotobasis, isolate peripheral blood lymphocyte, extract total RNA with the Trizol method.Design has comprised that the primer of initiator codon and terminator codon is single stage method RT-PCR.
Upstream primer: 5 '-CGGGATCCCCCACCGTGAAGATCTTACAGTCGT-3 ' (SEQ ID NO.13);
Downstream primer: 5 '-GCTCTAGATCATTTACCGGGATTTACAGACACCG-3 ' (SEQ IDNO.14).
The RT-PCR product that obtains is identified the about 1000bp of its size by the DNA electrophoresis, meets (see figure 1) with 970bp as expected.Check order after again the RT-PCR product being loaded into the T-Easy carrier, compare the sequence unanimity with the sequence of reporting in the NCBI Genebank database.
The clone of embodiment 2:EGFRscFv
Heavy chain VH that the avidity that filters out from phage antibody library is higher and light chain VL, connect structure anti-EGFR single-chain antibody (scFv) with Linker, and in the N of EGFRscFv end interpolation secreting signal peptide IgK sequence, and gene order is redesigned and optimize by the Mammals codon, design and synthesize oligonucleotide fragment, be spliced into length EGF RscFv by overlapping PCR method, be written in the PUC57 carrier.
After obtaining synthetic EGFRscFv sequence, the PUC57-EGFRscFv transformed into escherichia coli is carried out plasmid amplification, target sequence is done double digestion reaction enzyme from the PUC57 carrier according to the restriction enzyme site (XbaI and BamHI) of design to scale off, visible the 2nd, 3,4,5 swimming lanes of DNA electrophoresis have all cut out two bands, its medium and small band is about 900bp, conform to expected results, the 1st swimming lane not enzyme cuts out the expection band.To utilize ligation that this fragment cloning is advanced in pcDNA3.1 (+) carrier after the small segment recovery, sequence verification is consistent with design result.
The design and the vector construction of embodiment 3:IgE-Fc-EGFRscFv fusion rotein
Design Mode figure such as the Fig. 2 of fusion rotein among the present invention.NheI, BamHI, the clone restriction enzyme site of XbaI for designing.In order to guarantee that this fusion rotein can be secreted into the extracellular, we have selected Ig kappa leader sequence (being IgK) as secretory signal sequence, often be selected as the secretion sequence of protein carrier for expression of eukaryon because of advantages such as its stability and high efficiency, this sequence is totally 21 amino acid (21aa, METDTLLLWVLLLWVPGSTGD), corresponding DNA sequences is:
5’-ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGAC-3’。
Connect EGFRscFv heavy chain (Heavy chain, VH, 354bp) and light chain (Light chain, VL, Linker 327bp) adopts (GGGGS) 3, and its corresponding codes nucleotides sequence is classified (SEQ ID NO.9): GGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCG as.This Linker that studies show that in the past has stronger tension force and flexibility, and stability is very strong, often is selected as the link member of scFv.
The hinge area of having selected IgG1 is the Hinge district, 15aa:EPKSCDKTHTCPPCP (SEQ ID NO.5), and coding nucleotide sequence is 45 bases:
GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCA (SEQ ID NO.6) is used as connecting the middle joining region (connection peptides) of EGFRscFv and IgE-Fc, can both be folded to form correct separately conformation to guarantee the two.Wherein IgE-Fc length is 970bp, and EGFRscFv length is 824bp, and finally this IgE-Fc-EGFRscFv fusion rotein total length is 1794bp, the fusion rotein of 597 amino acid (the SEQ ID NO.10) that encode.
The objective of the invention is to make up the carrier for expression of eukaryon of IgE-Fc-EGFRscFv fusion rotein, obtaining targetedly respectively under the segmental prerequisite of IgE-Fc fragment and EGFRscFv, adopting the substep method of attachment that it is cloned among the carrier for expression of eukaryon pcDNA3.1 (+).Do the double digestion checking behind the vector construction respectively, the big or small expection band that is about 1000bp and 850bp occurred at second swimming lane and the 3rd swimming lane respectively; Estimate to be respectively IgE-Fc fragment and EGFRscFv fragment band under the double digestion.Get the order-checking of 10 μ l plasmids, sequencer address is consistent with implementation sequence.
Embodiment 4: the checking of gene transient transfection and expressing fusion protein
The IgE-Fc-EGFRscFv fusion rotein carrier that has built is passed through the Lipo2000 transfection CHO cell.In order to detect proteic expression, at first the fusion rotein carrier is done transient transfection, and establish 4 groups, they are respectively: IgE-Fc-EGFRscFv fusion rotein group (2 μ g Plasmid+6 μ g LIP), pcDNA3.1 (+) organizes (2 μ g Plasmid+6 μ gLIP), GFP-pcDNA3.1 (+) organizes (2 μ g Plasmid+6 μ g LIP), the untransfected group, the Chinese hamster ovary celI sample of fusion rotein carrier of having collected transfection respectively after 48 hours, cell conditioned medium after the transfection, the cell sample of untransfected and the cell conditioned medium of untransfected, be Western bolt and verify whether this fusion rotein is expressed and secreted in supernatant, the result observes the expression of target protein in first road and second road, molecular weight is about 62kDa (under the reductive condition, be single chain protein), the 3rd road and the 4th road do not detect target protein.Simultaneously, for whether the transfection efficiency of observing this system can meet the demands, we change the Chinese hamster ovary celI (see figure 5) of pcDNA3.1 (+)-GFP over to fluorescence microscope after 48 hours in transfection.
After obtaining the recombinant plasmid of high purity coding IgE-Fc-EGFRscFv, utilize Lipofectamine 2000 plasmid transfection test kits (Invitrogen company) with recombinant plasmid transfection CHO cell (ATCC), in serum free medium, cultivate and collect the Chinese hamster ovary celI supernatant liquor after three days, can detect IgE-Fc-EGFRscFv Expression of Fusion Protein (see figure 5) with immunoblotting.This method can be used for obtaining apace a spot of IgE-Fc-EGFRscFv fusion rotein, and its concentration can detect with the ELISA standard measure, and used one anti-ly can be anti human IgE-Fc antibody.
Embodiment 5:IgE-Fc-EGFRscFv fusion rotein stably express in Chinese hamster ovary celI
Under the prerequisite that this fusion rotein of checking can be expressed in Chinese hamster ovary celI, Chinese hamster ovary celI after the transfection is stablized the screening of strain with G418, select monoclonal cell,, and protect and plant by classification enlarged culturing among 24 orifice plates, 6 orifice plates, T25-Flask and the T75-Flask.Detect and Expression of Fusion Protein amount in the supernatant is changed behind the substratum after 0,12,24,36,48,60 hour in screening with the ELISA method, filter out with this and wherein efficiently express most strain.The result shows that expression amount (was seen Fig. 6 greatly) when being cloned in substratum No. 4 changed back 48 hours.
Fusion rotein is expressed justacrine in nutrient solution among the present invention in Chinese hamster ovary celI, and utilizes the method purifying gained of SP affinity chromatography.The cell culture fluid that comprises the IgE-Fc-EGFRscFv fusion rotein can adopt the method for SP affinity chromatography to carry out purifying.With albumin A-Sepharose chromatography column with PBS damping fluid balance after, the Chinese hamster ovary celI nutrient solution supernatant liquor sample introduction that ultra-fine filter was concentrated, monitor with A280, with PBS damping fluid flushing to unconjugated albumen all by wash-out, use the citric acid elution of bound albumen of 100mM then, the Tris-HCl with 1M neutralizes at once.Owing to added the Fc fragment, fusion rotein can exist with dimeric forms by disulfide linkage.Fusion rotein behind the purifying can be used ELISA method detectable level.The elutriant that comprises fusion rotein can freeze-drying behind desalting and purifying, can place-20 ℃ of prolonged preservation after the freeze-drying.
The activity of embodiment 6:IgE-Fc-EGFRscFv fusion rotein detects
In order to verify whether fusion rotein has kept IgE-Fc and EGFRscFv immunologic competence separately, we at first detect whether high expression level EGFR and U937 monocyte high expression level Fc ε RI whether of cell strain A431 respectively by flow cytometry, have selected Chinese hamster ovary celI and 293 cells in contrast.The result shows: Chinese hamster ovary celI and 293 cells are not all expressed EGFR and Fc ε RI, detected result is all negative, and A431 cell EGFR expression rate is about 95.7% (see figure 7), and the expression rate of U937 monocyte Fc ε RI is about 77.1%, all positive (see figure 7) of detected result.
Next, further detect and verify the immunologic competence of IgE-Fc-EGFRscFv fusion rotein.The detection strategy as follows: the IgE-Fc-EGFRscFv of embodiment 5 preparation is anti-ly hatched with A431 as one, develops the color by FITC-anti-IgE then.The result shows, the EGFR scFv that antibody by FITC-anti-IgE can detect this fusion rotein can combine with the A431 cell, its combination rate is about 68.3%, its fluidic cell result illustrates that directly IgE-Fc and EGFR scFv are expressed on the same molecule, and have activity separately, these two parts can either form the correct folding (see figure 8) of mutually noninterfere function again alone.
Embodiment 7: the research of fusion rotein anti-tumor activity
Adopt tumour cell and monocyte mixed culture method to come the anti-tumor activity of this fusion rotein of Preliminary detection.After behind the fusion rotein that adds embodiment 5 preparations 72 hours, PBS flush away monocyte, carry out propidium iodide (PI) dyeing, the cell quantity of the situation that observation of cell nuclear is colored under fluorescent microscope to determine to be killed and wounded, the result shows that the fusion rotein that we make up can play comparatively significantly immunologic cytotoxicity effect, and this system can design according to expectation be finished killing and wounding of tumour cell.And take pictures under fluorescent microscope, adjusting focal length has 20 total cells approximately to each visual field, take pictures 50 continuously.Count out the absolute death toll of about 1000 A431 cells in every group of experiment, do statistical study, the result shows that fusion rotein treatment group and control group have the notable difference (see figure 9).
Because antibody has specific selective action, can concentrate effector substance at tumor focus place or tumor cell surface, and kill and wound target cell.Over more than 10 year, the antibody of existing kinds of tumors related antigen is used for the targeted therapy of tumour both at home and abroad, these antibody substantially all are basis transformation with IgG, or it is chimeric as Rituximab, or the people source as Trastuzumab, even have total man's antibody to enter clinical trial such as HuMax-CD4
[18]The relevant IgE of utilization has research to the lethal effect of tumour cell report to some extent just in 1991
[19], Sehon and he's partner one reinstates IgE and resists breast cancer cell and breed on one's body mouse, demonstrates the anti-tumor activity of IgE, but his this research IgE and other antibody coupling are not in the same place, bring into play anti-tumor function jointly.
IgE can combine with Fc receptor seq (Fc ε Rs) on its effector cell under the condition of extremely low concentration, stimulates body to produce the intensive immune response, and speed is rapid, has improved therapeutic efficiency and cost.So it only needs very low dosage, this is the difference very big with IgG, and in fact when antibody is used as drug use if desired the words of very big dosage will be considered to the limitation that this is this antibody usually because it might produce too serious HAMA reaction.Second, the classical pathway that IgE not only can activate most IgG comes the kill tumor cell, and it can also excite picture antigen presenting cell (antigen-presenting cells, APC) etc. the effector cell of broad variety discharges a large amount of cytokines more, and mediation ADCC and ADCP act on tumour cell.
The IgE-Fc-EGFRscFv fusion rotein carrier that the present invention will build is done the improvement on the 26S Proteasome Structure and Function, utilize the mediation ADCC function that IgG not only can the activation effect cell, simultaneously again can the activating complement approach, by the apoptosis-induced kill tumor cell of Complement-dependent cytotoxicity (CDC) approach.If as we that think deeply previously can be on an antibody molecule simultaneously the anti-tumor activity of coupling IgG and IgE be optimal, should be all better with the antitumous effect of any antibody than single.The Fc section of IgG comprises two portion C γ 2 and C γ 3, it can pass through activating macrophage, NK cell, dendritic cell, activating complement effect in the time of mediation ADCC reaction, and IgE-Fc comprises C ε 2, C ε 3, C ε 4 these 3 parts, and it can activate mastocyte, eosinophilic granulocyte, basophilic granulocyte, monocyte, scavenger cell, NK cell.Wherein the major function of C ε 4 and C γ 3 all is in the low-affinity receptor combination, and therefore mediation ADCC reaction be with the structure of this fusion rotein high efficiency more, also can only need C ε 2 and the C ε 3 of reservation IgE-Fc when transforming the fusion rotein structure.So according to the actual development of this research, we have designed following these schemes and have further strengthened the function of this fusion rotein, and have finished the content of part, obtain the better healing effect with expectation.
In the present invention, we have not only utilized the targeting of antibody as traditional antitumor drug, have utilized the synergy behind antibody and the antibody coupling simultaneously.The IgE-Fc-EGFRscFv fusion rotein of Gou Jianing is a bi-specific antibody (BsAb) like this, also is bifunctional antibody (BfAb).BsAb can gather effector cell's (T cell, NK cell, scavenger cell) and target cell (tumour cell) respectively by two antigen binding sites, makes the two close to each other and raised, thereby makes in two cell take place to interact and induce the target cell dissolving.This specific character of BsAb can make the effector cell obtain the dissolving power that antibody relies on.The bispecific fusion protein antibody that the present invention makes up had both utilized the EGFR monoclonal antibody to block coupling between EGFR and the EGF, and then suppressed a series of vasculogenesis that signal path caused that cause thus, tumor proliferation.Simultaneously, we have also utilized the special anti-tumor activity of IgE, and the effector cell is gathered around the tumor cell tissue, have effectively utilized the ADCC and the such function of ADCP of effector cell's performance, suppress growth of tumor, the two its function of various enforcements is not disturbed mutually.And we also verified after these 2 antibody are joined together to form fusion rotein antibody by Linker, therefore their function separately is not affected.The development trend of past 30 years antibody drugs is again to people source type antibody even human antibody from mouse source type antibody to mosaic type antibody, everybody is actively seeking the lower medicine of immunogenicity, avoid the generation of HAMA reaction, the IgE-Fc sequence of IgE-Fc-EGFRscFv fusion rotein is total man's sequence, immunogenicity is low, and the molecular weight of whole fusion rotein is lower than other antibody class medicines.
Reference
1.Sly?RM(1999)Changing?prevalence?of?allergic?rhinitis?and?asthma.Ann?Allergy?Asthma?Immunol82：233-48
2.Karagiannis?SN，Bracher?MG，Beavil?RL，Beavil?AJ，Hunt?J，McCloskey?N，Thompson?RG，East?N，Burke?F，Sutton?BJ，Dombrowicz?D，Balkwill?FR，and?Gould?HJ(2008)Role?of?IgE?receptors?in?IgEantibody-dependent?cytotoxicity?and?phagocytosis?of?ovarian?tumor?cells?by?human?monocytic?cells.Cancer?Immunol?Immunother?57：247-63
3.Namazi?MR(2007)Extension?of?the“Hygiene?Hypothesis’to?the?negative?associationbetween?acne?and?atopy，hematological?malignancies，and?malignant?melanoma.Medical?Hypotheses?69：960-961
4.Christie?G，Barton?A，Bolognese?B，Buckle?DR，Cook?RM，Hansbury?MJ，Harper?GP，Marshall?LA，McCord?ME，Moulder?K，Murdock?PR，Seal?SM，Spackman?VM，Weston?BJ，Mayer?RJ(1997)IgE?secretion?is?attenuated?by?an?inhibitor?of?proteolytic?processing?ofCD23(Fc?epsilonRII).Eur?J?Immunol?27：3228-3235
5.Zhang?M，Murphy?RF，Agrawal?DK(2007)Decoding?IgE?Fc?receptors.Immunol?Res?37：1-16.
6.Karagiannis?SN，Bracher?MG，Beavil?RL，Beavil?AJ，Hunt?J，McCloskey?N，Thompson?RG，East?N，Burke?F，Sutton?BJ，Dombrowicz?D，Balkwill?FR，Gould?HJ(2008)Role?of?IgEreceptors?in?IgE?antibody-dependent?cytotoxicity?and?phagocytosis?of?ovarian?tumor?cells?by?human?monocytic?cells.Cancer?Immunol?Immunother?57：247-263
7.Milner?JD，Brenchley?JM，Laurence?A，Freeman?AF，Hill?BJ，Elias?KM，Kanno?Y，Spalding?C，Elloumi?HZ，Paulson?ML，Davis?J，Hsu?A，Asher?AI，O’Shea?J，Holland?SM，Paul?WE，Douek?DC(2008)Impaired?T(H)17cell?differentiation?in?subjects?with?autosomal?dominant?hyper-IgE?syndrome.Nature?452：7
8.Davis?ta，Grillo?lopez?a?j，White?c?A(2000)Rituximab?anti-CD20monoclonal?antibody?therapy?innon-Hodgkins’lymphoma?saftyand?ef-ficacy?of?retreatment.J?Clinic?On-col.18(17)：3135-3143.
9.Mason，JO，Albert，MA，Vail，R.(2006)Intravitreal?bevacizumab(Avastin)for?refractory?pseudophakic?cystoid?macular?edema.Retina?26：356-357.
10.Lu?W，Zhao?Z，Zhao?Y，Yu?S，Zhao?Y，Fan?B，Kacskovics?I，Hammarstrom?L，Li?N(2007)Over-expression?of?the?bovine?FcRn?in?the?mammary?gland?results?in?increased?IgG?levelsin?both?milk?and?serum?of?transgenic?mice.Immunology?19：311-318
11.Uhrberg，M，Valiante，N，Shum，B，Shilling，G，Lienert-Weidenbach，K，Corliss，B，Tyan，D，Lanier，L，Parham，P(1997)Human?diversity?in?killer?cell?inhibitory?receptor?genes.Immunity，7：753.Kaisho?T，Schwenk?F，Rajewsky?K(1997)The?roles?of?gamma?l?heavy?chain?membraneexpression?and?cytoplasmic?tail?in?IgG1?responses.Science?276：412-415
12.Scaltriti?M，Baselga?J(2006)The?epidermal?growth?factor?receptor?pathway：a?model?for?targeted?therapy.Clin?Cancer?Res?12：5268-5272
13. Wang Cheng emerging (2000) is the oncotherapy foreign medical science physiological and pathological and the clinical fascicle of target spot with EGFR and mutant thereof, 20:1372140.
14.Sharma?SV，Bell?DW，Settleman?J(2007)Epidermal?growth?factor?receptor?mutations?in?lung?cancer.Nat?Rev?Cancer?7：169-181
15.McKillop?D，Partridge?EA，Kemp?JV，Spence?MP，Kendrew?J，Barnett?S，Wood?PG，Giles?PB，Patterson?AB，Bichat?F，Guilbaud?N，Stephens?TC(2005)Tumor?penetration?of?gefitinib(Iressa)，an?epidermal?growth?factor?receptor?tyrosine?kina.Mol?Cancer?Ther?4：641-649.
16.Yokota?T，Milenic?DE，Whitlow?M(1992)Rapid?tumor?penetration?of?a?single-chain?Fv?and?comparison?with?other?immunoglobulin?forms.Cancer?Research?52：3402-3408.
17.Aubrey?N，Muzard?J，Juste?M(2006).Recombinant?antibodies：towards?a?new?generation?of?antivenoms.J?Soc?Biol，200：345-354.
18.Koh?W-P，Yuan?J-M，Wang?R，Seow?A，Lee?H-P，Yu?MC(2008)Chronic?rhinosinusitis?and?risk?of?lung?cancer?in?the?Singapore?Chinese?Health?Study.Int?J?Cancer?123：1398-1402
19.Nagy?E，Berczi?I，and?Sehon?AH(1991)Growth?inhibition?of?murine?mammary?carcinoma?by?monoclonal?IgE?antibodies?specific?for?the?mammary?tumor?virus.Cancer?Immunol?Immunother?34：63-69
Claims (18)
1. fused protein is characterized in that: be made of the single-chain antibody EGFR scFv of anti-Human epidermal growth factor receptor and Fc section IgE-Fc from human normal immunoglobulin IgE, linked to each other by connection peptides between EGFR scFv and the IgE-Fc.
2. fused protein as claimed in claim 1 is characterized in that: the aminoacid sequence of the Fc section of described human normal immunoglobulin IgE is:
(1) as described in the SEQ ID NO.4 in the sequence table;
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.4, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.
3. fused protein as claimed in claim 1 is characterized in that: the aminoacid sequence of the single-chain antibody of the anti-Human epidermal growth factor receptor of described people is:
(1) as described in the SEQ ID NO.2 in the sequence table.
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.2, pass through replacement and/or disappearance and/or add the same or analogous polypeptide of one or several amino acid gained function.
4. fused protein as claimed in claim 1 is characterized in that: described connection peptides behaviour immunoglobulin hinge region.
5. fused protein as claimed in claim 4 is characterized in that: the aminoacid sequence of described human normal immunoglobulin hinge area is: EPKSCDKTHTCPPCP.
6. fused protein as claimed in claim 1 is characterized in that: there is the connection peptides that connects light chain and heavy chain the inside of the single-chain antibody EGFR scFv of described anti-Human epidermal growth factor receptor, and its aminoacid sequence is: GGGGSGGGGSGGGGS.
7. fused protein as claimed in claim 1 is characterized in that: its aminoacid sequence is:
(1) shown in SEQ ID NO.12 in the sequence table;
Perhaps (2): in the aminoacid sequence shown in the SEQ ID No.12, pass through replacement and/or disappearance and/or add the same or analogous protein of one or several amino acid gained function.
8. as each described fused protein of claim 1～7, it is characterized in that: also be connected with signal peptide at the N end.
9. fused protein as claimed in claim 8 is characterized in that: its aminoacid sequence is:
(1) shown in SEQ ID NO.8 in the sequence table;
Perhaps (2): in the proteic aminoacid sequence shown in the SEQ ID No.8 through replacement and/or disappearance and/or add one or several amino acid gained with SEQ ID No.? the same or analogous protein of the function of shown fused protein.
10. as each described fused protein of claim 1～9, it is characterized in that: the Fc fragment by human normal immunoglobulin forms the dimer protein form.
11. the recombinant DNA of each fused protein of coding claim 1～10.
12. recombinant DNA according to claim 11 is characterized in that: its nucleotides sequence is classified as:
(1) as SEQ ID NO.7 in the sequence table or SEQ ID NO.11 or be the degenerate sequence of SEQ ID NO.7 or SEQ ID NO.11;
Perhaps (2): in the nucleotide sequence that (1) limits through replacing, lack or add the derive nucleotide sequence of gained of one or several Nucleotide, and the same or analogous protein of nucleotide sequence coded function that limits with (1).
13. comprise the recombinant vectors of claim 11 or 12 described recombinant DNAs.
14. recombinant vectors according to claim 13 is characterized in that, described recombinant vectors is plasmid vector or virus vector.
15. comprise the recombinant chou of the described recombinant vectors of claim 14.
16. each described fused protein of claim 1～10, claim 13 or 14 described recombinant vectorss or the described recombinant chou of claim 15 application in the preparation antitumor drug.
17. a pharmaceutical composition comprises each described fused protein of claim 1～10, claim 13 or 14 described recombinant vectorss or the described recombinant chou of claim 15 and auxiliary material pharmaceutically.
18. pharmaceutical composition as claimed in claim 11 is characterized in that, also comprises at least a other antitumor drug.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110140182.9A CN102241774B (en) | 2010-05-27 | 2011-05-27 | Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201010184945.5 | 2010-05-27 | ||
| CN201010184945 | 2010-05-27 | ||
| CN201110140182.9A CN102241774B (en) | 2010-05-27 | 2011-05-27 | Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102241774A true CN102241774A (en) | 2011-11-16 |
| CN102241774B CN102241774B (en) | 2014-05-14 |
Family
ID=44960037
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110140182.9A Expired - Fee Related CN102241774B (en) | 2010-05-27 | 2011-05-27 | Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102241774B (en) |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103113470A (en) * | 2013-02-27 | 2013-05-22 | 四川大学 | Genetically engineered lymphocyte targeting Human EGFR (Epidermal Growth Factor Receptor), preparation method and application of genetically engineered lymphocyte |
| WO2015104003A1 (en) * | 2014-01-10 | 2015-07-16 | Hung Alfur Fu-Hsin | Transgenic animals capable of producing humanized ige at much higher levels than mouse ige |
| CN106117362A (en) * | 2016-08-17 | 2016-11-16 | 林志国 | A kind of EGFR single-chain antibody and application thereof |
| CN107405410A (en) * | 2015-01-15 | 2017-11-28 | 昂奎斯特有限公司 | The method that increase anticancer delivers to target |
| CN107683289A (en) * | 2015-01-26 | 2018-02-09 | 芝加哥大学 | The bonding agents of IL13RA α 2 and its purposes in treatment of cancer |
| WO2018032574A1 (en) * | 2016-08-17 | 2018-02-22 | 林志国 | Single-chain antibody and application thereof |
| CN108794641A (en) * | 2018-07-04 | 2018-11-13 | 上海科医联创生物科技有限公司 | A kind of multi-functional fusion protein and its application for EGFRvIII |
| CN109879964A (en) * | 2017-12-06 | 2019-06-14 | 瑞菲特(北京)生物科技有限公司 | Anti-EGFR single-chain antibody, anti-PD1 single-chain antibody and fusion protein |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1300295A (en) * | 1998-05-13 | 2001-06-20 | 拜欧特康生化技术开发和咨询有限公司 | Hybrid protein for inhibiting the deatanulation of mastocytes and the use thereof |
| CN101058609A (en) * | 2006-05-26 | 2007-10-24 | 神州细胞工程有限公司 | Human antibody and expression thereof |
| CN101538331A (en) * | 2009-05-06 | 2009-09-23 | 中国医学科学院医药生物技术研究所 | Single chain antibody-lidamycin fusion protein ER (Fv-LDP) targeting EGFR |
| US20100081796A1 (en) * | 2008-09-26 | 2010-04-01 | Ulrich Brinkmann | Bispecific anti-egfr/anti-igf-1r antibodies |
-
2011
- 2011-05-27 CN CN201110140182.9A patent/CN102241774B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1300295A (en) * | 1998-05-13 | 2001-06-20 | 拜欧特康生化技术开发和咨询有限公司 | Hybrid protein for inhibiting the deatanulation of mastocytes and the use thereof |
| CN101058609A (en) * | 2006-05-26 | 2007-10-24 | 神州细胞工程有限公司 | Human antibody and expression thereof |
| US20100081796A1 (en) * | 2008-09-26 | 2010-04-01 | Ulrich Brinkmann | Bispecific anti-egfr/anti-igf-1r antibodies |
| CN101538331A (en) * | 2009-05-06 | 2009-09-23 | 中国医学科学院医药生物技术研究所 | Single chain antibody-lidamycin fusion protein ER (Fv-LDP) targeting EGFR |
Non-Patent Citations (3)
| Title |
|---|
| INGKE BRAREN ET AL.: "Generation of Human Monoclonal Allergen-Specific IgE and IgG Antibodies from Synthetic Antibody Libraries", 《CLINICAL CHEMISTRY》 * |
| PANAGIOTIS KARAGIANNIS ET AL.: "Characterisation of an engineered trastuzumab IgE antibody and eVector cell mechanisms targeting HER2/neu-positive tumour cells", 《CANCER IMMUNOL IMMUNOTHER》 * |
| 赵晓蓉等: "表皮生长因子受体特异性单链抗体的筛选及初步鉴定", 《广东药学院学报》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103113470A (en) * | 2013-02-27 | 2013-05-22 | 四川大学 | Genetically engineered lymphocyte targeting Human EGFR (Epidermal Growth Factor Receptor), preparation method and application of genetically engineered lymphocyte |
| CN103113470B (en) * | 2013-02-27 | 2015-04-22 | 四川大学 | Genetically engineered lymphocyte targeting Human EGFR (Epidermal Growth Factor Receptor), preparation method and application of genetically engineered lymphocyte |
| WO2015104003A1 (en) * | 2014-01-10 | 2015-07-16 | Hung Alfur Fu-Hsin | Transgenic animals capable of producing humanized ige at much higher levels than mouse ige |
| CN107405410A (en) * | 2015-01-15 | 2017-11-28 | 昂奎斯特有限公司 | The method that increase anticancer delivers to target |
| CN107683289A (en) * | 2015-01-26 | 2018-02-09 | 芝加哥大学 | The bonding agents of IL13RA α 2 and its purposes in treatment of cancer |
| CN107683289B (en) * | 2015-01-26 | 2021-08-06 | 芝加哥大学 | IL13R alpha 2 binding agents and their use in cancer treatment |
| CN106117362A (en) * | 2016-08-17 | 2016-11-16 | 林志国 | A kind of EGFR single-chain antibody and application thereof |
| WO2018032574A1 (en) * | 2016-08-17 | 2018-02-22 | 林志国 | Single-chain antibody and application thereof |
| CN109879964A (en) * | 2017-12-06 | 2019-06-14 | 瑞菲特(北京)生物科技有限公司 | Anti-EGFR single-chain antibody, anti-PD1 single-chain antibody and fusion protein |
| CN109879964B (en) * | 2017-12-06 | 2022-08-05 | 北京科立思维生物科技有限公司 | anti-EGFR single-chain antibody, anti-PD 1 single-chain antibody and fusion protein |
| CN108794641A (en) * | 2018-07-04 | 2018-11-13 | 上海科医联创生物科技有限公司 | A kind of multi-functional fusion protein and its application for EGFRvIII |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102241774B (en) | 2014-05-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102241774B (en) | Recombinant IgE-Fc-anti EGFR single chain variable fragment fusion protein, its preparation method and its application | |
| CN109906232B (en) | Multispecific antibody molecules comprising lambda light chain and kappa light chain | |
| CN106632681B (en) | Anti- EGFR and AntiCD3 McAb bispecific antibody and its application | |
| ES2365606T3 (en) | ANTIBODIES AGAINST GM-CSF CHEMICALS. | |
| CN111527109A (en) | Fusion protein dimer with antibody Fc region as framework and application thereof | |
| CN106977602A (en) | A kind of anti-PD1 monoclonal antibodies, its medical composition and its use | |
| CN106967172A (en) | The anti-bifunctional antibodies of PD 1 of anti-CTLA 4, its medical composition and its use | |
| CN113301919A (en) | Bispecific antibodies that activate immune cells | |
| CN108250303A (en) | Single domain antibody fusion protein and its application | |
| JP2022521937A (en) | Antibody molecules that bind to NKp30 and their use | |
| CN110964111A (en) | anti-PD-L1 monoclonal antibody, antigen binding fragment thereof and application thereof | |
| CN106459190A (en) | Chimeric protein composed of ngf antagonist domain and a tnfa antagonist domain | |
| CN115943165A (en) | Fc-CD80 fusion proteins and conjugates thereof and their uses | |
| WO2020108463A1 (en) | Humanized anti-human ox40 monoclonal antibody, preparation method therefor and use thereof | |
| CN105916883B (en) | Bifunctional fusion proteins and its preparation method and application | |
| CN104231086B (en) | Bifunctional fusion protein, preparation method and application thereof | |
| TW201904999A (en) | Anti-GITR antibody, antigen-binding fragment thereof and medical use thereof | |
| WO2023000675A1 (en) | Bispecific antibody targeting pd-l1 and 4-1bb | |
| ES2911442T3 (en) | Monovalent inhibitor of huTNFR1 interaction | |
| CN104558181A (en) | Humanized single-chain variable fragments of targeted B lymphoma cells | |
| CN101914161B (en) | Fusion protein HGF alpha-Fc for restraining tumor growth and application thereof | |
| US20230192797A1 (en) | Human il-15 mutant and uses thereof | |
| US20230192898A1 (en) | Covalent multi-specific antibody | |
| WO2023138551A1 (en) | Anti-cd3 and anti-cd20 bispecific antibody and use thereof | |
| US20240052037A1 (en) | Anti-pd-l1/anti-cd47 natural antibody structure-like heterodimeric form bispecific antibody and preparation thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140514 Termination date: 20170527 |