CN104306988A - Uses of miR-431 in preparation of muscular disease treatment medicines - Google Patents

Abstract

The invention relates to a use of miR-431 in the preparation of muscular disease treatment medicines, concretely relates to functions of miR-431 in skeletal muscle stem cells and muscular disease treatment, especially relates to a use of miR-431 in muscle injuries and muscular dystrophy, and also relates to a use of miR-431 in the preparation of skeletal muscle stem cell activation, proliferation and differentiation promotion medicines, and an miR-431-containing medicinal composition for treating muscular diseases.

Description

The purposes of miR-431 in the medicine of preparation treatment muscle disease

Technical field

The present invention relates to medical domain, treat the purposes in muscle disease, particularly muscle injury and muscular dystrophy in particular to miR-431.

Background technology

Skeletal muscle plays very important effect in the vital movement of organism.It not only plays motion and supports function, and simultaneously it is an important metabolic organ.Material metabolism produce powers in skeletal muscle such as the sugar that health absorbs and lipid, this plays very important effect to the steady statue maintaining whole health.The symptom that the skeletal muscle that many diseases are attended by as patients such as tumor, HIV, chronic heart failures late reduces gradually.In addition, skeletal muscle or important endocrine organ, secrete some regulatory factors, as muscle mass (Myostatin), IL-6, IL-8, IL-15 and FGF21 etc.These regulatory factors also participate in other physiology and pathological process [1] except regulating the growth promoter of skeletal muscle self.

Satellite cell is the main stem cell of skeletal muscle, and satellite cell is the mononuclear cell [2] between muscle fiber sarolemma and basement membrane.Satellite cell expresses a series of molecular marked compound, as Pax7, M-cadherin, c-Met, MNF, NCAM and VCAM-1 etc.Different in the quantity of the different phase satellite cell of different plant species and growth.Newborn mice Satellite cell quantity account for whole flesh core about 30% grow up after, the ratio of satellite cell reduces to 4%, and after old age, the ratio of mouse satellite cell drops to about 2%.

A marked feature of skeletal muscle tissue can regenerate after injury, and satellite cell plays critical function in Skeletal muscle injury regenerative process.Satellite cell is in quiescent condition in normal state, when being subject to environmental stimuli as damage or motion, the satellite cell being in quiescent condition is activated, the satellite cell activated is through propagation, differentiation, merge and form the skeletal muscle fiber of new core in central authorities, have part cell to maintain the stability in skeletal muscle satellite cell storehouse by self renewal simultaneously.This process is hight coordinate unified [3,4].At nominal conditions, form and the function of skeletal muscle that are newly formed by injury regeneration of skeletal muscle and do not have the skeletal muscle damaged not have difference.A lot of myopathy the later stage worsen be because satellite cell self renewal be suppressed cause satellite cell exhaust or satellite cell activation, propagation be suppressed caused by.So research skeletal muscle satellite cell propagation, the mechanism of differentiation and self renewal is significant for treatment skeletal muscle disease.

MicroRNA (also writing miRNA or miR) has the non-coding microRNA (usual 18 to 25nt) of regulation activity as a class, growth and the disease of the various histoorgan of wide participation occur.The positive evidence that miRNA participates in skeletal development comes from the skeletal development generation of mice after skeletal muscle tissue conditionality knocks out Dicer gene extremely, comprising minimizings such as skeletal muscle, and muscle fiber paramophia.The albumen of Dicer gene code is necessary Cobra venom endonuclease in the ripe course of processing of miRNA, and this shows that miRNA plays a significant role in skeletal development process.Report now that many miRNA participate in the process [5-8] of Skeletal muscle injury regeneration.First be reported in injury repairing process occur express change be miR-181, significantly raise [9] at the final stage miR-181 expression of injury regeneration.MiR-351 is in the instantaneous increase of early expression amount of CTX injury regeneration, and miR-351 promotes the propagation [10] of satellite cell by T suppression cell cycle inhibitors E2F3.MiR-206 is after CTX damage, and expression significantly raises, and this prompting miR-206 plays function in Skeletal muscle injury regeneration, and this and Skeletal muscle injury regeneration function in miR-206 knock out mice are badly damaged consistent [11].The expression of miR-206 raises and can suppress polygenic expression perhaps, comprising Pax7, Notch3, IGFBP5 [11] and HMGB3 [12], and all these genes all Inhibited differentiation processes.In addition, in damage process, the expression of miR-1 raises the expression [13] also contributing to suppressing Pax7.Similarly, after CTX damage, miR-26a expression raises.After strike low miR-26a expression in tibialis anterior, the process of Skeletal muscle injury regeneration slows down [14].In identical model, miR-125b expression after CTX damage raises, and the target gene IMA-IGF2BP3-001 (IGF-2) in miR-125b downstream is expressed and increased [15].IGF-2 can regulate and control myogenic differentiation process and suppress rear injury regeneration process [15].In addition, regeneration period, the increase of miR-133 expression becomes brown fat cell [16] to prevent satellite cell.Increasing miRNA participates in the process of Skeletal muscle injury regeneration, and ectogenic miRNA intervenes the direction that injury regeneration process may be future therapeutic muscle disease.

Muscle mass (also referred to as growth and differentiation tactor-8, growth and differentiation factor-8, GDF8) is TGF-'beta ' family member [17].Myostatin gene knock-out mice whole body skeletal muscle enlarges markedly.Simultaneously, the animal of multiple kind (such as, two flesh cattle [18-19], dog [20], sheep [21] and people [22] etc.) because after myostatin gene natural mutation, all there is the phenotype similar with myostatin gene knock-out mice skeletal muscle in skeletal muscle.Therefore, muscle mass has just been considered to control the negative regulatory factor of muscle development since finding from 1997, and causes and pay close attention to widely.The effect of muscle mass after birth in skeletal development is mainly reflected in two aspects: the first, and muscle mass is to the regulation and control of normal bone flesh growth promoter after birth; The second, in various muscle injury, stimulation or myopathy situation, the impact that muscle mass is repaired Skeletal muscle injury.Although a lot of evidence shows, sarcoplast and satellite cell are the target cells that muscle mass acts in vivo, and other cell also may regulate and control by muscle mass.In adult mice after process LAN muscle mass, adult mice can be induced to occur cachexia (cachexia), and whole body skeletal muscle and fatty tissue significantly reduce.The degree that these animals skeletal muscles reduce and speed are difficult to only suppress satellite cell to make an explanation with muscle mass.Therefore, muscle mass also may directly act on myotube.There are some researches show now, muscle mass can suppress the albumen of the myotube broken up by C2C12 to synthesize.In addition, muscle mass makes fatty tissue quick depletion, and this prompting muscle mass has direct effect to fatty tissue.Under the disease event such as HIV, cachexia and chronic heart failure, skeletal muscle volume reduces in a large number, and the expression of muscle mass raises simultaneously.Show the Skeletal muscle injury repair process that muscle mass may participate in the morbidity of these myopathies or these diseases and causes.Therefore, intervene the expression of muscle mass or suppress it active, the decline of skeletal muscle volume and the forfeiture of function that can alleviate and be caused by these diseases may be had, as (sarcopenia), muscular dystrophy (dystrophy) etc. are levied in old skeletal muscle decay.

Muscle disease (muscular disorders) typically refers to skeletal muscle disease.Muscular dystrophy is one group of heredopathia being primary in muscular tissue.Clinical signs be the skeletal muscle atrophy that increases the weight of of Progressive symmetric erythrokeratodermia and unable, tendon reflex disappears, the false hypertrophy of muscle.Involve position according to patient muscle's atrophy and can be divided into polytype: Duchenne/Becker type muscular dystrophy (DMD/BMD), face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal muscular dystrophy, ocular myopathy type muscular dystrophy, eye muscle-pharynx flesh type muscular dystrophy.DMD type muscular dystrophy is a modal class progressive muscular dystrophy.Prevalence is 3.3/10 ten thousand, and accounting for birth boy baby's 20-30/10 ten thousand, is X-sex-linked recessive inheritance.Mainly boy's morbidity, women is the carrier of Disease-causing gene.Morbidity in usual about 5 years old.Amyotrophy is progressive muscle disease, poor prognosis, generally lethal with myocardial function exhaustion or dyspnea etc. when 20-30 year.At present for this disease, medical circle there is no effective therapy.Mdx mice is dystrophin (dystrophin) genetic flaw Mus, is that research skeletal muscle stem Cells activates, the most frequently used model of propagation, differentiation regulatory mechanism and Skeletal muscle injury-regeneration mechanism.

The sarcoplast of initial research report In vitro culture can make dystrophin recover again to express in Mdx mice, and this has evoked the very big enthusiasm [23] for the treatment of clinical muscular dystrophy.In fact, the autoplastic sarcoplast developed by satellite cell in clinical practice in myocardium reparation, simultaneously also some positive results all.But, have several large obstacle to slow down to the research based on satellite cells for treatment myotrophy disorders.Autoplastic satellite cell still can not express dystrophin, only has and use the satellite cell of heteroplastic transplantation to compensate the dystrophin of disappearance in DMD patient.Therefore, just there is following problem, is first the immunologic rejection of host, is secondly that survival after transplanting satellite cell, self renewal and migration are all poor.Be the theoretical basis of future therapeutic muscular dystrophy to the research of as above problem, there is good potential applicability in clinical practice.

Summary of the invention

In view of above technical problem, embodiment there is provided the purposes of miR-431 in the medicine of preparation treatment muscle disease according to more of the present disclosure.

In the disclosure, muscle disease refers to skeletal muscle disease, and it is selected from muscle injury and muscular dystrophy.In some embodiments, described muscle injury is acute muscle injury.In some embodiments, described muscular dystrophy is selected from: Duchenne/Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy.In the embodiment that some are concrete, muscular dystrophy is Duchenne/Becker type muscular dystrophy.

In the disclosure, the nucleotide sequence of described miR-431 is as shown in UGUCUUGCAGGCCGUCAUGCA (SEQ ID No.1, Genbank no.MIMAT0001418).

In some embodiments, described treatment is selected from following one or more: promote myoblastic differentiation, promote Skeletal muscle injury regeneration, improve pathology and physiological phenotype.

In some embodiments, the myoblastic differentiation of described promotion refers to the expression improving myogenin and/or myoglobulin heavy chain.

In some embodiments, the regeneration of described promotion Skeletal muscle injury refer to promote satellite cell activation, propagation and differentiation.

In some embodiments, described improve pathology and physiological phenotype refer to be selected from following one or more: reduce serum creatine kinase level, improve tired and improve muscle fiber tension force.

The purposes of miR-431 in the medicine of the activation of preparation promotion muscle stem cell, proliferation and growth is embodiment there is provided according to of the present disclosure other.

According to other embodiments of the present disclosure, provide a kind of pharmaceutical composition being used for the treatment of muscle disease, it comprises the miR-431 for the treatment of effective dose.Described muscle disease is selected from muscle injury and muscular dystrophy.In some embodiments, described muscle injury is acute muscle injury.In some embodiments, described muscular dystrophy is selected from: Duchenne/Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy.In the embodiment that some are concrete, muscular dystrophy is Duchenne/Becker type muscular dystrophy.

In some embodiments, described pharmaceutical composition is prepared to and is suitable for carrying out the form of microinjection or being suitable for the form of transfection.

In the embodiment that some are concrete, described pharmaceutical composition is used in vitro: miR-431 or the carrier that can express miR-431 are imported in vitro or transfection of mammalian is autologous or variant cell, after vitro cell expansion, and defeated time mammalian body.In the embodiment that other are concrete, described pharmaceutical composition uses in body: miR-431 or the carrier can expressing miR-431 directly import in mammalian body.This carrier can be virus type or non-viral, or even naked DNA or RNA.

Described mammal is selected from the mankind, mice, Canis familiaris L., rabbit, cattle or monkey; The preferred mankind or mice; The most preferably mankind.

As required, pharmaceutical composition also comprises pharmaceutically suitable carrier, and it includes but not limited to: diluent, buffer agent, suspensoid, Emulsion, granule, encapsulation agents, excipient, filler, binding agent, spray, cutaneous permeable agent, wetting agent, disintegrating agent, absorption enhancer, surfactant, coloring agent, correctives or absorption carrier.

Accompanying drawing explanation

Fig. 1 is presented at miR-431 in microarray and knocks out the expression in Mus and wild-type mice at myostatin gene.

Fig. 2 shows miR-431 in real-time quantitative PCR checking microarray and knocks out the result of the expression in Mus and wild-type mice at myostatin gene.

Fig. 3 shows the expression in the satellite cell that miR-431 knocks out Mus and wild-type mice at myostatin gene.

Fig. 4 shows and utilizes the muscle mass of restructuring to process the expression of miR-431 after C2C12 cell with different dosage (0,0.5,1,1.5 μ g/ml).

Fig. 5 show utilize the muscle mass of restructuring with 1 μ g/ml dosage process respectively C2C12 cell different time (12,24,36,48h) expression of miR-431 afterwards.

Fig. 6 display utilizes the expression of muscle mass and inhibitor follicostatin (Follistatin) co-treatment C2C12 cell miR-431 after 24 hours thereof.

Fig. 7 to show after the inhibitor PD98059 of Mek and muscle mass co-treatment C2C12 cell p-Erk in the expression of protein level.

Fig. 8 shows the expression of miR-431 after the inhibitor PD98059 of Mek and muscle mass co-treatment C2C12 cell.

Fig. 9 show muscle mass process C2C12 (DN-Ras) cell of Ras negativity sudden change and matched group C2C12 cell simultaneously after p-Erk, p-Mek in the expression of protein level.

Figure 10 shows muscle mass and processes the expression of miR-431 after C2C12 (DN-Ras) cell of Ras negativity sudden change and matched group C2C12 cell simultaneously.

Figure 11 shows the gene expression abundance of miR-431 in the different tissues of adult mice.

Figure 12 shows the expression change of miR-431 in C2C12 cell differentiation procedure.

Figure 13 shows the expression change of miR-431 in skeletal muscle satellite cell atomization.

Figure 14 shows C2C12 cell differentiation immunofluorescent staining result of myogenin (Myognin, MyoG) after matched group and stable transfection miR-431 after 24 hours.

Figure 15 shows C2C12 cell differentiation immunofluorescent staining result of myoglobulin heavy chain (MHC) after matched group and stable transfection miR-431 after 36 hours.

Figure 16 show C2C12 cell differentiation after 24 hours after matched group and stable transfection miR-431 myogenin at the expression of transcriptional level.

Figure 17 show C2C12 cell differentiation after 24 hours after matched group and stable transfection miR-431 myogenin at the expression of protein level.

Figure 18 and Figure 19 show C2C12 cell differentiation after 36 hours after matched group and stable transfection miR-431 myoglobulin heavy chain at the expression of transcriptional level and protein level.

Figure 20 shows CTX and induces flesh (TA flesh) cross section HE coloration result before 8-10 week mouse muscle injury regeneration 7 days ossa tibiale posteriuses.

Figure 21 to show after muscle injury 7 days tibialis anterior cross section cokers muscle fiber number ration statistics in central authorities.

Figure 22 shows miR-431 transgenic mice and wild-type mice damages 1 day rear MyoD (green) immunofluorescence dyeing result of reason afterwards at CTX, DAPI dyeing (redness) positioning cells core.

Figure 23 shows the statistical result of MyoD positive cell quantity, often organizes statistics more than 10 visuals field.

Figure 24 shows the testing result of miR-431 transgenic mice and wild-type mice Pax7 and MyoD protein level after CTX damages 1 day, and GAPDH is as quantitative control.

Figure 25 shows miR-431 transgenic mice and wild-type mice damages 3 days rear Pax7 (redness) MyoD (green) immunofluorescence dyeing results of reason afterwards at CTX, DAPI dyeing (blueness) positioning cells core.

Figure 26 shows the two positive cell quantity statistical result of Pax7 and MyoD, often organizes statistics more than 10 visuals field.

Figure 27 shows the testing result of miR-431 transgenic mice and wild-type mice Pax7 and MyoD protein level after CTX damages 3 days, and GAPDH is as quantitative control.

Figure 28 and Figure 29 shows the testing result of miR-431 transgenic mice and wild-type mice expression of eMHC after CTX damages 3 and 7 days.

Figure 30 display from miR-431 transgenic mice be separated satellite cell wild-type mice after cultivate the immunofluorescent staining result of differentiation MHC after 36 hours.

Figure 31 display from miR-431 transgenic mice be separated satellite cell wild-type mice after cultivate the number of differentiation MHC positive cell after 36 hours, the visual field of each statistics more than 10.

Figure 32 display from miR-431 transgenic mice be separated satellite cell wild-type mice after cultivate the detection of differentiation expression of MHC after 36 hours.

Figure 33 display from miR-431 transgenic mice be separated single muscle fiber wild-type mice after the suspension culture result that after 72 hours, point Pax7 (redness), MyoD (green) and DAPI (blueness) dye respectively.

Figure 34 shows differentiation (Pax7 ^-/ MyoD ⁺) ratio of Status satellite cell.

Figure 35 A and 35B is the immunofluorescence dyeing that mdx::miR-431 (B) and mdx (A) tibialis anterior azovan blue EBD infiltrate (redness) area and Lamin (green) showed cell film.

Figure 36 is shown as the area statistics result that in mdx::miR-431 and mdx tibialis anterior tibialis anterior (TA), azovan blue is contaminated.

Figure 37 shows creatine kinase horizontal detection result in mdx::miR-431 and mdx tibialis anterior (TA) serum.

Figure 38 is shown as mdx::miR-431 and mdx mice running experiment movement time record result.

Figure 39 and 40 is shown as mdx::miR-431 and mdx muscle strength testing result.

Detailed description of the invention

Muscle injury model described in the disclosure refers to the acute muscle injury model caused with snake venom cardiotoxin (Cardiotoxin/CTX) intramuscular injection tibialis anterior.After this model provides muscle injury preferably, muscle stem cell plays the process of function.

Muscular dystrophy model of the present invention refers to and utilizes mdx mouse model, is widely used as DMD muscular dystrophy model, and this model simulates human muscular's disease in the progressive mode of gentleness.

C2C12 cell is mouse muscle-forming cell system.

Embodiment 1. muscle mass is by the expression of Ras/Raf/Mek/Erk signal path negative regulation miR-431

1. screen the miR-431 by muscle mass negative regulation

Select in myostatin gene knock-out mice skeletal muscle tissue up-regulated miR-431 alternatively miRNA to its function and oneself expression regulation and control be studied.In 5 stages of skeletal development, the expression of miR-431 in myostatin gene knock-out mice is all higher than wild-type mice (as Fig. 1).From the skeletal muscle tissue of myostatin gene knock-out mice (purchased from Nanjing model animal institute) and wild type siblings mice (littermate control of knock out mice) different developmental phases (E15.5,4 weeks, 10 weeks, 16 weeks and 40 weeks), extract total serum IgE, utilize the miRNA of differential expression in miRNA chip of expression spectrum method screening and identification myostatin gene knock-out mice and wild-type mice skeletal muscle tissue.By statistical analysis, identify the miR-431 that there are differences in myostatin gene knock-out mice and wild-type mice skeletal muscle are expressed.

The result of Fig. 1 shows: miR-431 expresses the expression higher than wild-type mice prompting muscle mass negative regulation miR-431 in myostatin gene knock-out mice.

2. (Real-time) checking in real time

Get the total serum IgE of the skeletal muscle tissue of myostatin gene knock-out mice and wild type siblings mice different developmental phases (E15.5,4 weeks, 10 weeks, 16 weeks and 40 weeks).

(1) reverse transcription: add following reagent in the PCR reaction tube of 0.2mL:

16 DEG C of reactions open hairpin structure in 30 minutes, 42 DEG C of reactions 30 minutes, 85 DEG C of inactivators 5 minutes;

(2) PCR in real time: MicroRNA PCR in real time: add following reagent in 96 orifice plates:

The result of Fig. 2 shows: miR-431 expresses higher than wild-type mice in myostatin gene knock-out mice, and experiment confirms muscle mass negative regulator miR-431.

3. the detection of miR-431 expression in myostatin gene knock-out mice and wild-type mice satellite cell

(1) 3-4 myostatin gene knock-out mice in age in week is got and the wild-type mice neck that breaks is put to death, alcohol disinfecting.Tear skin from direction of toe of last and get tibialis anterior, gastrocnemius, quadriceps femoris respectively, avoid getting tendon as far as possible, avoid being stained with Mus hair as far as possible; In 35mm culture dish, with shears, muscle is shredded into gravel size; (2) add 2ml Digestive system, put into incubator and digest 15 minutes, then dispel separating muscle tissue with rifle head as far as possible; (3) again put into incubator and digest 15 minutes, and then dispel as far as possible, until there is no bulk tissue; (4) add in 3ml culture medium and Digestive system; (5) tissue that 8ml PBS dilutes digestion is added; (6) 40 μm of filtrations; (7) the centrifugal 10min of 1500rpm; (8) the proliferated culture medium re-suspended cell of supernatant 6ml is abandoned; (9) differential velocity adherent is added in the culture dish of 10cm 1 hour; (10) supernatant is transferred in the good 60mm culture dish of use glue primordial covering, adds 2.5ng/ml bFGF Inhibited differentiation simultaneously, hatches in the incubator of 5%CO237 DEG C; (11) (1:2) is gone down to posterity after 4-5 days; Receive the RNA of proliferation period (GM) simultaneously.(12) 0.25% trypsin PBS dilute 3 times; (13) get 1.5ml peptic cell, add the neutralization of 1.5ml complete medium; (14) RNA of (DM) is collected the idiophase after breaking up 36 hours with equal densities repopulating cell.(15) expression of miR-431 in proliferation period and idiophase satellite cell is detected in real time.

The result of Fig. 3 shows: expression is higher than wild-type mice in the satellite cell of myostatin gene knock-out mice for miR-431, and experimental result proves muscle mass negative regulation miR-431 further.

4. the muscle mass process C2C12 cell of vitro recombination

First with 2 × 10 ⁴cell/cm ²repopulating cell changes division culture medium after 12 hours processing C2C12 cell with various dose (0,0.5 μ g/mL, 1 μ g/mL, 1.5 μ g/mL) receives RNA (Fig. 4) after 24 hours simultaneously; Then process the different time point of C2C12 cell (12h, 24h, 36h, 48h) respectively with 1 μ g/mL dosage and receive RNA (Fig. 5) afterwards; Finally add Follinstatin co-treatment C2C12 cell with 1 μ g/mL dosage simultaneously and receive RNA in 24 hours.Then detect respectively in various dose, different time and the expression (Fig. 6) of miR-431 after simultaneously adding Follinstatin.

The result of Fig. 4, Fig. 5 and Fig. 6 shows: experiment in vitro confirms the expression of muscle mass negative regulation miR-431 further.

5. muscle mass lowers miR-431 expression by Mek/Erk signal path.

First with 2 × 10 ⁴cell/cm ²repopulating cell adds the muscle mass process C2C12 cell of 1 μ g/mL dosage after 24 hours after changing the inhibitor PD98059 half an hour that division culture medium adds Mek simultaneously after 12 hours, receives protein and RNA.First detect muscle mass and PD98059 performance function, then detect the expression of miR-431.The phosphorylation that western blot detects Eek determines that PD plays function.

The result of Fig. 7, Fig. 8 shows: muscle chalone is by Mek/Erk signal path negative regulation miR-431.

6. muscle mass lowers miR-431 expression by Ras/Raf signal path.

First with 2 × 10 ⁴cell/cm ²plantation DN-Ras C2C12 cell adds the muscle mass process C2C12 cell of the dosage of 1 μ g/mL after 24 hours, receives protein and RNA after changing the inhibitor PD98059 half an hour that division culture medium adds Mek simultaneously after 12 hours.First detect muscle mass and play function, then detect the expression of miR-431.

The result of Fig. 9, Figure 10 shows: muscle mass is by the expression of Ras/Raf signal path negative regulation miR-431.

Conclusion: in the above results display body and Vitro Experimental Results confirm the expression of muscle mass negative regulation miR-431, experiment in vitro confirms that muscle mass passes through the expression of Ras/Raf/Mek/Rrk signal path negative regulation miR-431 further.

Embodiment 2.miR-431 increases in the enrichment of skeletal muscle tissue camber and along with the atomization expression of C2C12 cell and satellite cell.

For the function of research miR-431 in skeletal muscle, the express spectra of miR-431 is studied.First Northern trace is adopted to survey the gene expression abundance of miR-431 in 8 week age each histoorgan of mice.In order to determine the expression of miR-431 further, have detected the expression of miR-431 under the different differentiation state of C2C12 cell, also have detected the expression of miR-431 in skeletal muscle satellite different differentiation phases simultaneously.

MiR-431 is in the enrichment of skeletal muscle tissue camber

Experimentation: the mice selecting 8 week age, collects lung, liver, heart, spleen, skeletal muscle, kidney, pancreas, small intestinal, brain and gastric tissue respectively and extracts RNA first respectively and then carry out Northern Blot hybridization.Process is as follows:

(1) RNA extracts

Get fresh or frozen tissue material 50-100mg, add liquid nitrogen grind into powder in mortar, transferred in 15ml centrifuge tube by a small amount of liquid nitrogen of powder, add 5ml Trizol homogenate, room temperature leaves standstill 5 minutes.Add 1ml chloroform (every milliliter of Trizol adds 0.2ml chloroform) concussion mixing, room temperature leaves standstill 10 minutes.12000g, 4 DEG C centrifugal 15 minutes.Supernatant is transferred to new centrifuge tube and add 2.5ml isopropyl alcohol (every milliliter of Trizol adds 0.5ml isopropyl alcohol) mixing, room temperature leaves standstill 10 minutes.12000g, 4 DEG C centrifugal 10 minutes.By 75% washing with alcohol of precipitation 5ml, dry, how much be dissolved in appropriate DEPC water depending on precipitation, be placed on ice.

(2) the denaturing formaldehyde gel electrophoresis of RNA

Prepare denaturing formaldehyde glue (1.2%): take 1.2g agarose, add 87ml DEPC H ₂o, heating and melting; To be cooled to 60 DEG C time, add 10 × MOPS buffer of 10ml and the formaldehyde 3ml of 37%, mixing; Add fluorescent dye EB to final concentration 0.5 μ g/ml; Pour in ready agarose gel groove.

The preparation (10-15 μ g) of RNA sample: the Methanamide of 10 × MOPS buffer of 2.5 μ l, 4.4 μ l 37% formaldehyde, 12.5 μ l is mixed; Add the RNA of 10-15 μ g, add DEPC H2O to 25 μ l; At 55 DEG C of heating in water bath 15min; Add the sample-loading buffer of 5 μ l Methanamides, point sample.

Denaturing formaldehyde gel electrophoresis: dilution 10 × MOPS buffer to 1 × MOPS, pours in clean electrophoresis tank; The gel prepared is placed in the electrophoresis tank of 1 × MOPS buffer, prerunning is intact with checkout equipment; Point sample; Electrophoresis under 2v/cm voltage drop, moves to gel edges to bromjophenol blue and stops; Transferring film after taking a picture.

(3) transferring film: after electrophoresis terminates, soaks 30 minutes in deionized water by gel; Gel is placed in 10 × SSC (or 20 × SSC) and soaks 30min; After nylon membrane water-soaked, put into 10 × SSC (or 20 × SSC) and soak 10min; Be buckled in as support in pallet using gel groove, lengthen bar 3MM filter paper bridge, and support is spread the two-layer 3MM filter paper identical with glue size, the gel handled well is tipped upside down on support, put nylon membrane, then put two-layer 3MM filter paper, put the absorbent paper that a folded 7-8cm is thick; Pour 10 × SSC (or 20 × SSC) in pallet into, coated with preservative film, on absorbent paper, press 500g weight, spend the night (more than 6 hours).After transferring film terminates, observe nucleic acid transfer completely under the uviol lamp in darkroom after, the position of control gel pencil labelling loading wells and molecular weight Marker or 28SrRNA, 18SrRNA on nylon membrane.Finally clip nylon membrane with two-layer 3MM filter paper, the nucleic acid on UV-crosslinked fixing film, also can put 80 DEG C of baking oven heat fixations 2 hours.Film through fixing can be placed in dry place until hybridization.

(4) probe mark, purification and degeneration

Probe mark: reclaim purified product with the PCR purified product of object fragment or plasmid enzyme restriction and make template mark probe, at present conventional random primering, labeled reactant by specification carries out (Promega).

Probe Purification: the object of purified probes be in order to remove the free α that do not mix- ³²p-dCTP, by Sephadex G-50 sieve chromatography by do not mix free α- ³²p-dCTP is separated with the nucleic acid fragment of labelling, collect eluent namely containing the good nucleic acid fragment of labelling free α- ³²p-dCTP can be trapped in chromatography media.There is commercial Sephadex G-50 molecular sieve chromatography at present, the centrifugal nucleic acid fragment can collecting labelling after loading.

Probe degeneration: the probe that purification is good boils degeneration in 5 minutes through 100 DEG C, is placed in rapidly 2 minutes on ice, a little centrifugal.Be stored in-20 DEG C for subsequent use.

(5) prehybridization and hybridization

Prehybridization: nylon membrane is put into hybrid pipe, adds appropriate hybridization solution, and 68 DEG C (not adding the hybridization solution of Methanamide) or 42 DEG C (adding the hybridization solution of 50% Methanamide) are more than prehybridization half an hour.

Hybridization: the probe adding degeneration in hybrid pipe, adds the amount of probe generally at every milliliter of hybridization solution 2 × 10 ⁵--1 × 10 ⁶cpm.68 DEG C (not adding the hybridization solution of Methanamide) or 42 DEG C (adding the hybridization solution of 50% Methanamide) hybridize more than 8 hours.

(6) film is washed

Film is washed, the free probe that removing is not hybridized after hybridization terminates, can tabletting autography.

(7) tabletting autography

Wrapped by nylon membrane with preservative film, be fixed in X-light magazine, coated with X-mating plate, magazine is placed in-70 DEG C of refrigerator autoradiography, the general autography time is 3-5 days, and signal is more weak sometimes can autography more than one week.

(8) punching

After autography terminates, with developer solution and fixative solution punching in darkroom, there is the swimming lane of hybridization signal can occur the band of a black in X-mating plate relevant position.

The result of Figure 11 shows: miR-431 is in the enrichment of skeletal muscle tissue camber; The result of Figure 12, Figure 13 shows: miR-431 increases along with the atomization expression of skeleton satellite cell.

Conclusion: the above results display miR-431 simultaneously points out miR-431 may participate in skeletal development also myoblastic atomization along with myoblast differentiation process expression increases this in the enrichment of skeletal muscle camber.

Embodiment 3.miR-431 promotes C2C12 cell differentiation.

In order to study the function of miR-431 in skeletal muscle, in C2C12 cell, have detected the function of miR-431.First, construct the stably transfected cell line of process LAN miR-431 (about 60 times) in C2C12 cell line, and utilize the C2C12 cell line of the process LAN miR-431 set up to carry out following functions detection.

First with the cell of certain density plantation stable transfection mi-431, change division culture medium in propagation after 24 hours, break up the expression detecting differentiation early molecule labelled molecule myogenin (Myogenin) and late differentiation markers molecule MHC after 24 hours, 36 hours respectively.Found by immunofluorescent staining, break up after 24 hours, process LAN miR-431 significantly increases the quantity of myogenin positive cell, and the expression of myogenin significantly increases at transcriptional level and protein level simultaneously; Break up after 36 hours, process LAN miR-431 significantly increases the quantity of MHC positive cell, and the expression of MHC significantly increases at transcriptional level and protein level simultaneously.The above results shows that process LAN miR-431 promotes C2C12 cell differentiation.

(1) cell line of stable transfection is built

First day

Before test, virus is placed in thaw on ice (slow virus-GPF is contrast); At 35mm ²culture dish in add 1mL culture medium, prepare the centrifuge tube of 2 1.5mL; Peptic cell counts, and gets 1mL 2 × 10 ⁵individual cell is in the centrifuge tube of 1.5mL; Add 20 μ L viruses in centrifuge tube, mix gently with rifle head; Add 3.2 μ L polybrene rifle heads to mix gently; The cell mixed is added drop-wise at 35mm ²culture dish in, put into incubator cultivate.

Second day

Cell is transferred to 60mm ²culture dish in.

3rd day

Cell is transferred to 10cm ²culture dish in, adding final concentration is 1.5 μ g/mL puromycins; The cell of transfection slow virus-GPF matched group is almost all died two days later, and the cell of test group keeps good growth conditions, shows that surely turning cell line successfully constructs.Detect expression efficiency, go down to posterity conservation.

(2) Immunofluorescence test

Fixative: the formalin of 37% is diluted to final concentration 2%-4% in PBS; Saturatingization liquid: 0.5%TritonX-100/PBS; Confining liquid: 1-3%BSA/PBS; Mountant: prepare the glycerite of 90% with the 2%DABCO/PBS prepared in advance.

Step: coverslip gradation is inserted in concentrated acid and soaks 2h, drying at room temperature after cleaning.To drop in the Poly-L-Lysine Solution of ten times of dilutions through acid-treated coverslip, room temperature be taken out in 60 DEG C of dry 1h after placing 5min.Coverslip to be soaked in 75% ethanol at least 30min with front.Transfection or the cell carrying out respective handling clean 3 times with PBS, drain away the water, fix 10min with fixative room temperature; PBS rinsing 3 times.Under room temperature, cell 0.5%Triton-X100/PBS changes process 3 × 10min thoroughly.With 1-3%BSA/PBS closing cell, 37 DEG C of 30min; Parafilm film adds 40 μ L dilute (usual 1:50) by a certain percentage primary antibodie with PBS-T, is sealed in wet box, 37 DEG C of 1h.Under room temperature, 0.5%Triton-X100/PBS rinsing 3 × 10min.What Parafilm film added 40 μ L dilute (usual 1:80) by a certain percentage with PBS-T two resists, and to be sealed in wet box 37 DEG C, 1h.Under room temperature, 0.5%Triton-X100/PBS rinsing 3 × 10min.1:10000DAPI (DAPI/0.5%Triton) is added during second time rinsing; Rinsed with deionized water desalts.Get 10 μ L mountant to drop on microscope slide.Take a picture with fluorescence microscope or confocal laser scanning microscope at once.

Conclusion: Figure 14 to Figure 19 result display miR-431 can promote the differentiation of C2C12 cell.

Embodiment 4.miR-431 promotes the process of Skeletal muscle injury regeneration.

Experimentation

MiR-431 transgenic mice constructed by the model animal of Nanjing, wild-type mice three littermate control in test.For determining the function of miR-431 in skeletal injury regeneration, construct miR-431 transgenic mice CTX damage model, the right lower limb tibialis anterior of mice injects 50 μ L × 10 μM CTX, left lower limb injection contrasts just as the PBS of volume, after injury 1,3, within 7 days, collect skeletal muscle tissue respectively, observe anathreptic process and form by HE dyeing.By the expression of immunofluorescence dyeing and western blot technology for detection Pax7 or MyoD.Study the function of skeletal muscle satellite cell in vivo, one of common method is by setting up skeletal muscle tissue injury regeneration model at mice skeletal tissue injection CTX.

It is first inflammatory reaction after Skeletal muscle injury, a large amount of inflammatory factors is released, the skeletal muscle satellite cell being in quiescent condition is activated, the satellite cell activated is bred the muscle fiber then entering differentiation program and damage in a large number and is merged, and utilizes MyoD positive cell number to assess the satellite cell number that profit activates.After skeletal muscle tissue damages 3 days, satellite cell is bred in a large number, can be assessed the process of satellite cell propagation by the number detecting satellite cell; Damaging and within 7 days, form the muscle fiber of a large amount of core in the new formation of central authorities afterwards, to assess the process of differentiation by comparing core in the sectional area size of the muscle fiber horizontal stroke of the new formation of central authorities and the dynamic change of eMHC.

(1) paraffin embedding and haematoxylin and Yihong (HE) dyeing: the tibialis anterior taken off is fixed on 24-48 hour in 10% formalin (formalin 1:10 is dissolved in PBS); Each 1 little of dewatering completely through 70%, 80%, 95%, 100% soak with ethanol after fixing; Dimethylbenzene transparent twice each half an hour is transferred to after dehydration; In the 50-60 DEG C of saturating wax of temperature and embedding (the full-automatic embedding machine of Leica EG1150); Finishing wax stone sample, section 3-4 micron (Leica RM2255 fully-automatic rotation microtome); Section is separated, puts in the tepidarium of 40 DEG C and open up sheet (Leica HI1220 spread out sheet machine) bak stay on microscope slide, dry upper 60 DEG C of boiling hot plate (Leica HI1210 bakes sheet machine); Tissue slice is placed in dimethylbenzene and soaks 10 minutes, soaks 10 minutes again after changing dimethylbenzene.Soak 5 minutes in dehydrated alcohol; Soak 5 minutes in 95% ethanol; Soak 5 minutes in 70% ethanol; Finally enter distilled water immersion 2 minutes; Hematoxylin aqueous solution dyeing 5 minutes is put into by entering the section after distilled water.Color separation in sour water and ammonia, each several seconds.Running water enters distilled water for a moment after 5 minutes.Enter in 70% and 90% ethanol to dewater each 5 minutes.Enter ethanol eosin stains liquid dyeing 2-3 minutes.Through absolute alcohol dehydration after dyeing, then make section transparent through dimethylbenzene, use neutral gum mounting.

(2) to take a picture and data statistics: with just putting photo under microscope (Olypums BX 53) × 20 times of mirrors, the core of new formation in manual count damage field unit are is at the muscle fiber number of central authorities.

(3) frozen section preparation: the fresh tibialis anterior muscular tissue of taking off is put into and fills embedding medium (oriental cherry; 4583) in mould; mould being immersed liquid nitrogen makes it solidify; with full-automatic slicing machine (Leica CM3050), embedded block is cut into slices to 10 micron thickness; by thin slice sticker on microscope slide, put into-70 DEG C of refrigerators and preserve.

(4) Pax7 immunofluorescence dyeing: frozen section is taken out from-70 DEG C of refrigerators placement room temperature and dry; 20 minutes are fixed in 4% paraformaldehyde (4 grams of paraformaldehydes (Sigma) are dissolved in 100 milliliters of PBS); Clean 3 times in PBS, each 5 minutes; Permeate 6 minutes in-20 DEG C of methanol; Clean 3 times in PBS, each 5 minutes; Configuration 0.01M sodium citrate buffer solution (0.294 gram of two citric acid monohydrate trisodium is dissolved in 100 milliliters of PBS, adjust ph to 6.0), is preheated to 90 DEG C; Section is immersed the sodium citrate buffer solution of heat, hatch 5 minutes for 80 DEG C, renew the sodium citrate buffer solution of preheating, hatch 5 minutes again for 80 DEG C; Room temperature cooling section, cleans 3 times in PBS, each 5 minutes; In 4%BSA (0.4 gram of BSA (Jackson) is dissolved in 10 milliliters of PBS), room temperature closes 2-3 hour; Clean 2 minutes in PBS; In dilution FAB (Jackson) 1:100 to PBS, in FAB, room temperature closes 30 minutes; Clean 2 minutes in PBS; With Pax7 antibody (DSHB, 1:20 are dissolved in 4%BSA) in 4 DEG C of overnight incubation; Clean 2 minutes in PBS; 3 times are washed, each 10 minutes in 0.1%BSA; In GaM-Biotin (Jackson, 1:1000 are dissolved in 4%BSA) incubated at room 45 minutes; Clean 2 minutes in PBS; 3 times are washed, each 10 minutes in 0.1%BSA; In Cy3-Strep (Jackson, 1:1000 are dissolved in 4%BSA) incubated at room 30 minutes; Clean 3 times in PBS, each 10 minutes; DAPI contaminates core, cleans 10 minutes in PBS; Mounting is taken a picture.

(5) MyoD immunofluorescence dyeing: frozen section is taken out from-70 DEG C of refrigerators placement room temperature and dry; 20 minutes are fixed in 4% paraformaldehyde; Clean 3 times in PBS, each 5 minutes; Permeate 6 minutes in-20 DEG C of methanol; Clean 3 times in PBS, each 5 minutes; 5%BSA room temperature closes 2 hours; With MyoD antibody (Santa Cruz, 1:50 is dissolved in 5%BSA) in 4 DEG C of overnight incubation; Clean 3 times in PBS, each 10 minutes; Two anti-incubated at room 1 hour; Clean 3 times in PBS, each 10 minutes; DAPI contaminates core, cleans 10 minutes in PBS; Mounting is taken a picture.

In conclusion: Figure 20-21 display miR-431 transgenic mice, injury regeneration process is significantly faster than wild-type mice.Figure 22-24 shows after miR-431 transgenic mice damages 1 day more MyoD positive cell, and Figure 25-27 shows miR-431 transgenic mice has the two positive cell of more Pax7+/MyoD+ in damage after 3 days.Figure 28-29 shows the differentiation of miR-431 transgenic mice Satellite cell faster than wild-type mice.Above-mentioned data display miR-431 accelerates the injury regeneration process of satellite cell by the activationa and proliferation and differentiation accelerating satellite cell.

Embodiment 5.miR-431 promotes skeletal muscle satellite differentiation.

Experimentation

In order to confirm that miR-431 promotes the function of the differentiation of skeletal muscle satellite cell, be separated the skeletal muscle satellite cell of miR-431 transgenic mice and wild-type mice, be planted in 12 orifice plates with identical density, after differentiation 36, also be separated single myofibrillar isolated culture by the expression of dyeing differentiation marker gene M CH positive cell and detection MHC mRNA simultaneously, contaminate dissimilar satellite cell respectively with Pax7, MyoD, DAPI respectively.

The single muscle fiber of separating mouse skeletal muscle

Preparation: 0.2% collagenase I is dissolved in plasma-free DMEM medium; Cleaning mixture: serum DMEM culture medium, adds 2% dual anti-; Muscle fiber proliferated culture medium: DMEM cultivates, and adds 20% hyclone (FBS), 1% chick embryo extract adds 1% dual anti-; With hyclone (FBS) bag by culture dish.

Test procedure

Get the male Mus 1 in 6-10 age in week, disconnected neck is put to death, and sprays alcohol disinfecting.Skin is torn from direction of toe of last, do not hurt tibialis anterior as far as possible, first be separated the tendon of tibialis anterior (TA) and extensor digitorum longus (EDL) at direction of toe of last with dissecting needle, determine the position of tibialis anterior (TA), it is made to be separated with extensor digitorum longus (EDL), then the tendon of quadriceps femoris is cut off at knee joint place, the upper end tendon of extensor digitorum longus (EDL) is found in careful separation, then cut off with scalpel, gently complete extensor digitorum longus (EDL) is taken away in toe end.(this step is whole Success in Experiment whether key); Complete extensor digitorum longus (EDL) is put into and 2ml 0.2% collagenase I Digestive system is housed at 37 DEG C of digestion 40-60 minute, until see that the fiber having hairline sample stops digestion; Transferred to one by one in cleaning mixture by muscle fiber single in Digestive system 10 μ L rifle heads under the microscope, single muscle fiber is transferred to after washing 2 times in muscle fiber proliferated culture medium, cultivates 72 hours; The expression of Pax7 or MyoD is detected thus labelling satellite cell, the quantity of satellite cell on the single muscle fiber of manual count by immunofluorescence dyeing.

Conclusion

As shown in Figure 30-32, miR-431 can promote the differentiation of skeletal muscle satellite cell, is in the satellite cell of idiophase significantly more than wild-type mice in miR-431 transgenic mice as shown in Figure 33-34.As above experiment proves that miR-431 promotes the differentiation of skeletal muscle satellite cell.

Embodiment 6.miR-431 significantly can improve the Pathophysiology phenotype of mdx mice

Experimentation

Mdx mice is the model mice of Du Shi muscular dystrophy disease.Cause dystrophin on skeletal muscle sarolemma due to the dystrophin gene sudden change of Xp21 to lack wholly or in part and cause.Dystrophin is in connection cell interior and external structure, and the stability aspect of intracellular signaling and cell membrane plays important function.In Mdx mouse disease model, the disappearance due to Dystroglycan causes the breakage of muscle cell membrane structure, and intracellular matter such as creatine kinase leaks, and the fragility of muscle increases, and contracts last ability reduces.The damage of myocyte can activate satellite and carry out injury repairing, forms the newborn muscle fiber of core in central authorities.Due to the existence of dystrophin mutant gene, the very fast new sarcolemma formed is damaged, and muscle fiber is impaired, and stimulation satellite cell carries out injury repairing again.Therefore, Mdx mice is in muscle fiber breakage with the circulation of injury repairing always.

The result display miR-431 of preceding embodiment can by promoting that Skeletal muscle injury regenerative process is accelerated in the differentiation of satellite cell, and so whether miR-431 can alleviate the Pathology of Mdx disease model mice to a certain extent.The degree of injury of Mdx Muscle Tissue is judged through the sarcolemma situation of infiltrating in Skeletal Muscle Cell of breakage by detecting leak concentration in serum and azovan blue of creatine kinase in myocyte.Assess Mdx mice skeletal function by the running test of mice and the test of in vitro skeletal muscle fiber pulling force simultaneously.

For determining whether miR-431 can to a certain degree improve Pathology and the physiological function of Mdx disease model mice, first Mdx mice and miR-431 transgenic mice are carried out copulation, male Mdx:miR-431 and the Mdx mice obtained is for experiment, B6 mice normal control mice, thus the Pathology detecting whether miR-431 can improve Mdx mice.

(1) detection of CK level in serum

Generally within 2-4 hour after mice is run, detect CK value;

Pluck eyeball and get blood;

Centrifugal 10 minutes of 4 DEG C of standing 1-2 hour, 12000rpm by serum transfers in new EP pipe;

Configuration reactant liquor: every hole adds 10 μ L substrates, the reaction buffer of 100 μ L and the enzyme of 1 μ L;

110 μ L:100 μ L H are added in enzyme mark version ₂o and 10 μ L standard substance (Calibrator) and 100 μ L reactant liquors and 10 μ L blood 37 DEG C hatch the light absorption value utilizing microplate reader to read 340nm for 20 minutes, then continue to hatch the light absorption value that 20 minutes read 340nm, then utilize formulae discovery CK value.

$\mathrm{CK}(U/L)=\frac{{\mathrm{OD}}_{40\min }-{\mathrm{OD}}_{20\min }}{{\mathrm{OD}}_{\mathrm{CALIBRATOR}}-{\mathrm{OD}}_{H_{2}O}}\×150$

(2) mice is run and tests

Mdx:miR-431, Mdx and B6 mice is under identical rearing conditions, and running test experiments carries out (Exer3/6Columbus Instruments) on dull and stereotyped treadmill.Experiment is divided into training and official testing, and experimental session uses 20 degree of descending inclinations angle.Before official testing, train twice, carry out every other day.Running condition setting is as follows: starting velocity 10 ms/min, after three minutes, accelerate to 20 ms/min with the speed of 1 m/min, till then going to mice fatigue with 20 ms/min of speed, generally arranging NOS (mice is parked in the number of times on stimulator) is 100 always.After training, start official testing, altogether test 4 times, be all carry out every other day at every turn.

(3) the in vitro pull test of skeletal muscle

Configuration electrolyte is adjusted to PH=7.0, adds in four chamber water baths, and general tissue temperature regulates temperature to be 25 ° at 37 ° of Mdx skeletal muscle, wherein by 95% oxygen-5% carbon dioxide, more than half an hour.

Be separated complete extensor digitorum longus (EDL) according to the method be separated in single muscle fiber, whether complete the Influence on test result last to experiment that skeletal muscle tissue is separated be very large.The EDL of complete separation is fixed on (this step operates in the electrolytic solution, and action wants fast as far as possible) between an another electrode.First balance 10 minutes in the electrolytic solution.

The condition of tic tension detect: use 10V voltage, the persistent period is the square wave of 0.3ms.Repeat 3 times, every septum secundum 10 seconds once.

The condition that tetanic tension detects: use 10V voltage, the persistent period is a string ripple of 200ms, wherein each for the persistent period be the square wave of 0.3ms.Repeat 3 times, every minor tick 3 minutes.

Conclusion

MiR-431::mdx mice muscle group azovan blue is contaminated area and is obviously reduced (Figure 35 A and 35B); Representatively, only show the picture (Figure 36) that azovan blue in tibialis anterior contaminates muscle injury, Figure 37 to show in miR-431::mdx mice group serum creatine kinase level comparatively matched group obviously reduce.Figure 38 shows miR-431::mdx mice group running achievement and is better than matched group.Figure 39 and 40 display miR-431::mdx mice group synthetic data Mdx mouse muscle pulling force is better than matched group.

Comprehensive above-mentioned miR-431 process LAN miR-431 in mankind DMD disease model Mdx mice can improve Pathology and the physiological function of Mdx mice significantly.

List of references

1.Lancaster,G.I.and?M.A.Febbraio,Skeletal?muscle:not?simply?an?organ?for?locomotion?and?energy?storage.J?Physiol,2009.587(Pt?3):p.509-10.

2.Mauro,A.,Satellite?cell?of?skeletal?muscle?fibers.J?Biophys?Biochem?Cytol,1961.9:p.493-5.

3.Grounds,M.D.and?Z.Yablonka-Reuveni,Molecular?and?cell?biology?of?skeletal?muscle?regeneration.Mol?Cell?Biol?Hum?Dis?Ser,1993.3:p.210-56.

4.Kuang,S.,M.A.Gillespie,and?M.A.Rudnicki,Niche?regulation?of?muscle?satellite?cell?self-renewal?and?differentiation.Cell?Stem?Cell,2008.2(1):p.22-31.

5.Lepper,C.,T.A.Partridge,and?C.M.Fan,An?absolute?requirement?for?Pax7-positive?satellite?cells?in?acute?injury-induced?skeletal?muscle?regeneration.Development,2011.138(17):p.3639-46.

6.McCarthy,J.J.,et?al.,Effective?fiber?hypertrophy?in?satellite?cell-depleted?skeletal?muscle.Development,2011.138(17):p.3657-66.

7.Murphy,M.M.,et?al.,Satellite?cells,connective?tissue?fibroblasts?and?their?interactions?are?crucial?for?muscle?regeneration.Development,2011.138(17):p.3625-37.

8.Sambasivan,R.,et?al.,Pax7-expressing?satellite?cells?are?indispensable?for?adult?skeletal?muscle?regeneration.Development,2011.138(17):p.3647-56.

9.Naguibneva,I.,et?al.,The?microRNA?miR-181?targets?the?homeobox?protein?Hox-A11?during?mammalian?myoblast?differentiation.Nat?Cell?Biol,2006.8(3):p.278-84.

10.Chen,Y.,et?al.,MiR-351?transiently?increases?during?muscle?regeneration?and?promotes?progenitor?cell?proliferation?and?survival?upon?differentiation.Physiol?Genomics,2012.44(21):p.1042-51.

11.Liu,N.,et?al.,microRNA-206?promotes?skeletal?muscle?regeneration?and?delays?progression?of?Duchenne?muscular?dystrophy?in?mice.J?Clin?Invest,2012.122(6):p.2054-65.

12.Maciotta,S.,et?al.,Hmgb3?is?regulated?by?microRNA-206?during?muscle?regeneration.PLoS?One,2012.7(8):p.e43464.

13.Chen,J.F.,et?al.,microRNA-1?and?microRNA-206?regulate?skeletal?muscle?satellite?cell?proliferation?and?differentiation?by?repressing?Pax7.J?Cell?Biol,2010.190(5):p.867-79.

14.Dey,B.K.,et?al.,miR-26a?is?required?for?skeletal?muscle?differentiation?and?regeneration?in?mice.Genes?Dev,2012.26(19):p.2180-91.

15.Ge,Y.,Y.Sun,and?J.Chen,IGF-II?is?regulated?by?microRNA-125b?in?skeletal?myogenesis.J?Cell?Biol,2011.192(1):p.69-81.

16.Yin,H.,et?al.,MicroRNA-133?controls?brown?adipose?determination?in?skeletal?muscle?satellite?cells?by?targeting?Prdm16.Cell?Metab,2013.17(2):p.210-24.

17.McPherron,A.C.and?S.J.Lee,Double?muscling?in?cattle?due?to?mutations?in?the?myostatin?gene.Proc?Natl?Acad?Sci?U?S?A,1997.94(23):p.12457-61.

18.Kambadur,R.,et?al.,Mutations?in?myostatin(GDF8)in?double-muscled?Belgian?Blue?and?Piedmontese?cattle.Genome?Res,1997.7(9):p.910-6.

19.Grobet,L.,et?al.,A?deletion?in?the?bovine?myostatin?gene?causes?the?double-muscled?phenotype?in?cattle.Nat?Genet,1997.17(1):p.71-4.

20.Mosher,D.S.,et?al.,A?mutation?in?the?myostatin?gene?increases?muscle?mass?and?enhances?racing?performance?in?heterozygote?dogs.PLoS?Genet,2007.3(5):p.e79.

21.Clop,A.,et?al.,A?mutation?creating?a?potential?illegitimate?microRNA?target?site?in?the?myostatin?gene?affects?muscularity?in?sheep.Nat?Genet,2006.38(7):p.813-8.

22.Schuelke,M.,et?al.,Myostatin?mutation?associated?with?gross?muscle?hypertrophy?in?a?child.N?Engl?J?Med,2004.350(26):p.2682-8.

23.Partridge,T.A.,et?al.,Conversion?of?mdx?myofibres?from?dystrophin-negative?to-positive?by?injection?of?normal?myoblasts.Nature,1989.337(6203):p.176-9。

Claims (10)

1. The purposes of 1.miR-431 in the medicine of preparation treatment muscle disease.
2. 2. purposes according to claim 1, wherein said muscle disease is selected from muscle injury and muscular dystrophy.
3. 3. purposes according to claim 2, described treatment refer to be selected from following one or more: promote myoblastic differentiation, promote Skeletal muscle injury regeneration, improve pathology and physiological phenotype;

   Preferably, the myoblastic differentiation of described promotion refers to the expression improving myogenin and/or myoglobulin heavy chain;

   Preferably, the regeneration of described promotion Skeletal muscle injury refer to promote satellite cell activation, propagation and differentiation;

   Preferably, described pathology and the physiological phenotype of improving is selected from following one or more: reduce serum creatine kinase level, improve tired and improve muscle fiber tension force.
4. 4. purposes according to claim 2, wherein said muscle injury is acute muscle injury.
5. 5. purposes according to claim 2, wherein said muscular dystrophy is selected from Duchenne/Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy; Preferably, described muscular dystrophy is Duchenne/Becker type muscular dystrophy.
6. 6. the purposes according to any one of claim 1 to 5, the nucleotide sequence of wherein said miR-431 is as shown in SEQ ID No.1.
7. 7.miR-431 promotes the purposes in the medicine of muscle stem cell activation, proliferation and growth in preparation.
8. 8. be used for the treatment of a pharmaceutical composition for muscle disease, it comprises the miR-431 for the treatment of effective dose; Wherein said muscle disease is selected from muscle injury and muscular dystrophy.
9. 9. pharmaceutical composition according to claim 8, wherein said muscle injury is acute muscle injury.
10. 10. pharmaceutical composition according to claim 8, wherein said muscular dystrophy is selected from Duchenne/Becker type muscular dystrophy, face shoulder-upper arm type muscular dystrophy, limb-girdle type muscular dystrophy, quadriceps femoris type muscular dystrophy, distal muscular dystrophy, ocular myopathy type muscular dystrophy and eye muscle-pharynx flesh type muscular dystrophy; Preferred described muscular dystrophy is Duchenne/Becker type muscular dystrophy.