CN104293982B - Detect newcastle disease virus and the gene chip of avian infectious bronchitis virus and test kit - Google Patents

Abstract

The invention discloses and a kind of detect newcastle disease virus and/or the gene chip of avian infectious bronchitis virus and test kit.Gene chip of the present invention includes solid phase carrier and the probe being fixed on solid phase carrier；Described probe includes shown in SEQ ID NO:1～2 any one or two genetic fragments, and/or any one or two genetic fragments shown in SEQ ID NO:3～4.Test kit of the present invention includes forementioned gene chip and newcastle disease virus and the reagent of chicken infectious bronchitis virogene.Gene chip of the present invention and detection kit can be accurate and effective detection newcastle disease virus and avian infectious bronchitis virus, and high specificity, highly sensitive, the shortest, quickly, application prospect is good in detection.

Description

Detection newcastle disease virus and the gene chip of avian infectious bronchitis virus and Test kit

Technical field

The present invention relates to a kind of detect newcastle disease virus, the gene chip of avian infectious bronchitis virus and reagent Box.

Background technology

Along with improving constantly of China's aviculture intensive degree, the generation of various diseases is also in the trend risen year by year. The aggregate level of China's poultry disease prevention and control is the highest, and generation and the harm of fowl diseases are the most extremely serious, according to incompletely statistics, endanger at present The disease that China's aviculture produces reaches more than 80 kinds, and wherein infectious disease accounts for the 75% of fowl diseases sum, and harm is serious.Fowl diseases simultaneously Occurring new feature also occur, the infectious disease as new constantly occurs；The kind of kainogenesis fowl diseases increases；The SARS of infectious disease incidence There is new change in type and cause of disease；Mixed infection and compound disease make disease increasingly complex.

These 2 kinds of diseases of newcastle disease, infectious bronchitis of chicken are widely current in China and many countries and regions, are invaded by virus The chicken group attacked can cause large quantities of death, and the growth promoter of resistance to mistake is slow, and mortality increases, and disturbs the immunity of other vaccine, Make chicken easy secondary infection Other diseases, and cause serious economic loss.These 3 kinds of sick common traits can cause respiratory tract disease Shape, and symptom is quite similar, is difficult to accurately judge in clinical diagnosis, the most easily with other respiratory tract disease such as bird flu, slowly Property respiratory tract disease etc. is obscured mutually.All there is unsurmountable limitation, as epidemic disease is mixed in the detection of existing fowl diseases or monitoring technology Close infection, inapparent infection and vaccine virus and the differentiation etc. of open country poison, all there be difficulties involved when when detection.Simultaneously for multiple epidemic disease Sick mixed infection needs same process or distinct methods repeatedly to detect, it is therefore necessary to strengthen detecting animal epidemic Or the research of monitoring new technique.

At present, to these 2 kinds general Antigen isolation and identification and the conventional serological methods of using of sick diagnosis, but these methods Exist trivial operations, waste time and energy, the deficiency such as sensitivity is poor.Particularly there is newcastle disease, avian infectious gas as chicken group When the multiple virus such as Guan Yan infects, it is difficult to apply these traditional methods to be used for quickly detecting and Differential Diagnosis, to a certain extent Have impact on the effective anti-system to these epidemic diseases.The most all establish PCR/RT-PCR detection method, and multiplex PCR inspection Survey method, but it is not met by detecting more fast and accurately the requirement of multiple cause of disease mixed infection.

Molecular Biology and the development of technology, particularly gene chip have high flux, multiformity, miniaturization and automatically The feature changed, these characteristics make the information above it to be read rapidly and accurately, require seldom, to save reagent to the amount of sample And cost, processing speed greatly speeds up, and in the detection to various pathogen, the detection of pathogen gene and analysis are the most credible , and the RNA of various pathogen can be carried out qualitative and determine quantitative analysis by biochip technology, thus help clinician to sense The kind of dye and the degree of infection are analyzed.

Cao Sanjie, " newcastle disease, the structure of infectious bronchitis of chicken gene chip and detection technique research thereof ", Sichuan Agriculture university's thesis for the doctorate in 2004 discloses a kind of base simultaneously detecting newcastle disease virus, avian infectious bronchitis virus Because of chip, its minimal detectable concentration of newcastle disease virus, avian infectious bronchitis virus is respectively 0.44ng/ μ L and 0.87ng/ μ L, sensitivity is low.

Summary of the invention

In order to solve the problems referred to above, the invention provides a kind of special detection Newcastle disease strong, highly sensitive Poison and/or the new gene chip of avian infectious bronchitis virus and test kit.

The present invention detects the gene chip of newcastle disease virus and/or avian infectious bronchitis virus, and it includes solid phase Carrier and the probe being fixed on solid phase carrier；Described probe includes shown in SEQ ID NO:1～2 any one or two Genetic fragment, and/or any one or two genetic fragments shown in SEQ ID NO:3～4.

Gene chip, is again DNA microarray, refer to refer to by distinct methods by biomolecule (oligonucleotide, cDNA, Genomic DNA, polypeptide, antibody, antigen etc.) it is bonded to silicon chip, sheet glass (pearl), plastic sheet (pearl), gel, nylon membrane etc. admittedly The biomolecule dot matrix formed on phase mediator, its prominent feature is miniaturization, integrated, parallelization and high flux.

Preferably, it also includes positioning probe, and location probe is the genetic fragment shown in SEQ ID NO:13.

The present invention detects the test kit of newcastle disease virus and/or avian infectious bronchitis virus, and it includes aforesaid Gene chip and amplification newcastle disease virus and/or the reagent of chicken infectious bronchitis virogene, wherein, expand chicken new city The reagent of epidemic disease virus gene includes primer pair shown in SEQ ID NO:5～6 and/or SEQ ID NO:7～8；Expand avian infectious The reagent of bronchitis virogene includes primer pair shown in SEQ ID NO:9～10 and/or SEQ ID NO:11～12.

Described test kit also includes primer pair shown in SEQ ID NO:14～15.

The mol ratio of downstream primer shown in described primer centering, forward primer shown in SEQ ID NO:5 and SEQ ID NO:6 For 1:10；Forward primer shown in SEQ ID NO:7,9,11 with the mol ratio of downstream primer shown in SEQ ID NO:8,10,12 is 1:20.

Described forward primer is marked with fluorescent dye.

Described test kit also includes gold colloidal.

Gold colloidal is to be acted at reducing agent such as white phosphorus, ascorbic acid, sodium citrate, tannic acid etc. by gold chloride (HAuCl4) Under, can be grouped to a certain size gold grain, and owing to electrostatic interaction becomes a kind of stable colloidal state, formed electronegative Hydrophobic sol solution, becomes stable colloidal state, therefore claims gold colloidal due to electrostatic interaction.

Gold colloidal of the present invention is prepared by the following method: take 200mL sterilizing ultra-pure water and 2mL1%HAuCl4 is mixed in 500ml In large beaker, then measure 20mL and be sub-packed in 10 50mL small beakers of numbering 1-10, use heating magnetic stirring apparatus to divide The colloidal gold solution of dress heats 5min successively, rapidly joins 1% citric acid three sodium solution, and addition is respectively 0.1mL, 0.2mL, 0.24mL, 0.28mL, 0.32mL, 0.36mL, 0.4mL, 0.6mL, 1.0mL, 1.2mL.Color from pale yellow rapidly goes to black again When becoming redness, more continuously stirred 10min stops, and waits solution to be cooled to room temperature, filters with cellulose nitrate film, i.e. can get institute Need gold colloidal.

The present invention also provides for shown in SEQ ID NO:1 or 2 any one or two genetic fragments, and/or SEQ ID Shown in NO:3 or 4, any one or two genetic fragments are in preparation detection newcastle disease virus and/or avian infectious bronchus Purposes in the gene chip of scorching virus.

Preferably, described gene chip also includes positioning probe, and location probe is the gene sheet shown in SEQ ID NO:13 Section.

Present invention also offers primer pair shown in SEQ ID NO:5～6 and/or SEQ ID NO:7～8, with SEQ ID Primer shown in NO:9～10 and/or SEQ ID NO:11～12 is to preparation amplification avian infectious bronchitis virus and chicken simultaneously Purposes in the reagent of Avian pneumo-encephalitis virus.

Present invention also offers shown in SEQ ID NO:1～2 any one or two genetic fragments and SEQ ID Primer pair shown in NO:5～6 and/or SEQ ID NO:7～8, and/or any one or two shown in SEQ ID NO:3～4 Primer shown in genetic fragment and SEQ ID NO:9～10 and/or SEQ ID NO:11～12 is in preparation detection newcastle disease Purposes in the test kit of virus and/or avian infectious bronchitis virus；Wherein, primer is to for amplifing reagent；SEQ ID NO:1～4 is detection probe.

The mol ratio of downstream primer shown in described primer centering, forward primer shown in SEQ ID NO:5 and SEQ ID NO:6 For 1:10；Forward primer shown in SEQ ID NO:7,9,11 with the mol ratio of downstream primer shown in SEQ ID NO:8,10,12 is 1:20.

Gene chip of the present invention can effectively detect newcastle disease virus and avian infectious bronchitis virus, specificity By force, highly sensitive, the minimal detectable concentration of two-strain sample is 1.8 × 10⁴Copy/μ L (0.2pg/ μ L), the shortest, detection Quickly, have a good application prospect.

The detailed description of the invention of form by the following examples, makees the most specifically the foregoing of the present invention Bright.But this should not being interpreted as, the scope of the above-mentioned theme of the present invention is only limitted to below example.All based on right of the present invention want The technology that the content asking secretary to carry is realized belongs to the scope of the present invention.

Accompanying drawing explanation

The matrix arrangement situation of Fig. 1 gene chip；

Fig. 2 gold colloidal affect result；

Fig. 3 specificity experiments result；

Fig. 4 sensitivity experiment result；

Fig. 5 stability experiment result.

Detailed description of the invention

One, experiment material and instrument

Bacterial strain: NDV LaSota strain, IBV H120 strain are purchased from China Veterinary Drugs Supervisory Inst., this laboratory preserve.

Main agents and culture medium: Omega plasmid extraction kit, be purchased from Omega biotech company；2×Taq PCR Master Mix, Reverse Transcription box, total RNA extraction reagent box, sky root DNA extraction kit and 100bp DNA Ladder； Amp: taking 1gAmp and being dissolved in concentration in 10mL sterilizing ultra-pure water is 100mg/mL；LB liquid medium: tryptone 2.0g, chlorine Changing sodium 2.0g, yeast extract 1.0g, after being completely dissolved in 180.0mL ultra-pure water, regulate pH=7.2 with NaOH, constant volume arrives 200mL, autoclaving 30min, be cooled to about 55 DEG C, and 100mLLB adds the Amp of 100ul, 4 DEG C of preservations；Solid LB media: to The LB of 100mL adds the agar powder of 1.5g, is cooled to about 55 DEG C after autoclaving, adds the 100mg/mL Amp of 100uL, pours into flat In plate, 4 DEG C save backup；50 × TAE:0.5mol/L EDTA50.0mL, glacial acetic acid 28.55mL, Tris 121.0g, use hydrogen-oxygen Change sodium regulation pH=8.0, constant volume to 500mL.Amino-group substrate:Amino microscope slide, spotting buffer:Point sample delays Rush liquid, be purchased from Shanghai hundred proud biological engineering company limited.Cy3-dCTP is purchased from Amersham company of the U.S.；100× Denhardt: bovine serum albumin 0.2g, polyethylene adjoins pyrrolidone 0.2g, ficoll 0.2g, is added to ddH₂In O 10mL completely Dissolve；20 × SSC: sodium citrate 8.82g, sodium chloride 17.53g, ultra-pure water 80.0mL, NaOH adjust pH=7.0, and constant volume arrives 100.0mL, 4 DEG C of preservations；Washing liquid 1:2 × SSC/0.1%SDS, washing liquid 2:0.2 × SSC/0.1%SDS, washing liquid 3:0.16 × SSC/0.1%SDS, washing liquid 4:ddH2O

Key instrument equipment: superclean bench, SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.；Electronic balance, Sartorius BP 310S；Constant-temperature table, Thermo Forma, the U.S. produces；Grads PCR instrument, P × 2, Thermo hybaid, The U.S. produces；Ultra-pure water instrument, Milli Qplus, method is domestic；Electrophresis apparatus, POWER Pac300, Bio-RAD, Italy produces；Gel Electrophoretic image system, Bio-RAD, Italy produces；High speed refrigerated centrifuge 3K18 type, Sigma, Germany produces；Nucleic acid-protein detects Instrument, SmartSpaee TM 3010, Bio-RAD, Italy produces；Hybridization Oven, Thermo hybaid, the U.S. produces； SmartArrayer 16 gene chip sample applying instrument, Capitalbio Corporation, Beijing Bo Ao biotech firm；Vacuum is taken out Dry machine, SinBo, is produced from Hong Kong；Gene chip hybridization box, Beijing Bo Ao biotech firm；LuxScan 10K gene chip is swept Retouch instrument, Capitalbio Corporation, Beijing Bo Ao biotech firm.

The preparation of embodiment 1 gene chip of the present invention

1, bacterial strain

NDV LaSota strain, IBV H120 strain.

2, experimental technique

2.1PCR primer, the preparation of detection probe

(1) design cause of disease specific probe: by the newcastle disease virus included in GenBnak, avian infectious gas The comparison analysis of the nucleotide sequence of pipe inflammation virus, selected conservative region sequence: NDV-F/HN, IBV-IBM/IBN.For conservative sequence Row design detects multipair probe, selects the probe sequence of high specificity.

(2) specific primer of probe sequence is designed: for above-mentioned conservative probe sequence, utilize bioinformatics software DNAman, Primer5.0 etc. design specific primer.Specific primer is synthesized by Shanghai bio-engineering corporation.

(3) prepared by probe: extract newcastle disease virus, chicken biography with virus/fluid sample DNA/RNA extraction agent box in a small amount Metachromia bronchitis virus, utilizes above-mentioned specific primer that two kinds of cause of disease nucleic acid carry out PCR amplification, and purification concentration measures.

Reverse transcription system and condition (with reference to the method for PrimeScript RT reagent Kit)

PCR amplification system and condition:

Reaction condition is as follows:

(4) screening of probe: with gene chip sample applying instrument point at amino after synthetic probe is dissolved and dilutes in right amount Change and make DNA microarray on glass substrate, carry out probe screening by cross experiment, finally give for preparing present invention detection Specific probe needed for DNA microarray: NDV-F/HN, IBV-IBM/IBN.

The sequence of primer and probe is as follows:

SEQ ID NO:1 (NDV-F)

Source gene source: NDV LaSota strain

Gene size and sequence: 440bp

CAAGAACCCAGCACCTATGATGCTGACTATCCGGGTTGCGCTGGTACTGAGTTGCATCTGTCCGGCAAA CTCCATTGATGGCAGGCCTCTTGCAGCTGCAGGAATTGTGGTTACAGGAGACAAAGCCGTCAACATATACACCTCAT CCCAGACAGGATCAATCATAGTTAAGCTCCTCCCGAATCTGCCCAAGGATAAGGAGGCATGTGCGAAAGCCCCCTTG GATGCATACAACAGGACATTGACCACTTTGCTCACCCCCCTTGGTGACTCTATCCGTAGGATACAAGAGTCTGTGAC TACATCTGGAGGGGGGAGACAGGGGCGCCTTATAGGCGCCATTATTGGCGGTGTGGCTCTTGGGGTTGCAACTGCCG CACAAATAACAGCGGCCGCAGCTCTGATACAAGCCAAACAAAATGCTGCCAACATCCTCCGAC

SEQ ID NO:2 (NDV-HN)

Source gene source: NDV LaSota strain

Gene size and sequence: 464bp

CTGGACGGTTTGGTGGGAAACGCATACAGCAGGCTATCTTATCTATCAAGGTGTCAACATCCTTAGGCGAAGACCCG GTACTGACTGTCCGCCCAACACAGTCACACTCATGGGGGCCGAAGGCAGAATTCTCACAGTAGGGACATCTCATTTC TTGTATCAACGAGGGTCATCATACTTCTCTCCCGCGTTATTATATCCTATGACAGTCAGCAACAAAACAGCCACTCT TCATAGTCCTTATACATTCAATGCCTTCACTCGGCCAGGTAGTATCCCTTGCCAGGCTTCAGCAAGATGCCCCAACT CGTGTGTTACTGGAGTCTATACAGATCCATATCCCCTAATCTTCTATAGAAACCACACCTTGCGAGGGGTATTCGGG ACAATGCTTGATGGTGTACAAGCAAGACTTAACCCTGCGTCTGCAGTATTCGATAGCACATC CCGCAGTCGC ATTACTC

SEQ ID NO:3 (IBV-M)

Source gene source: IBV H120 strain

Gene size and sequence: 368bp

ACACAGGAGGTCTTGTCGCAGCGATAATACTTACTGTGTTTGCGTGTCTTTCTTTTGTAGGTTATTGGATCCAGAGT ATTAGACTCTTTAAGCGGTGTAGATCTTGGTGGTCATTTAACCCAGAATCTAACGCCGTAGGTTCAATACTCCTAAC TAATGGTCAACAATGTAATTTTGCTATAGAGAGTGTGCCGATGGTGCTTTCTCCTATTATAAAGAATGGTGTTCTTT ATTGTGAGGGTCAGTGGCTTGCTAAATGTGAACCAGACCACTTGCCTAAAGACATATTTGTATGCACACCAGATAGA CGTAATATCTATCGTATGGTGCAGAAATACATTGGTGACCAAAGCGGAA ATAAGAAAAGG

SEQ ID NO:4 (IBV-N)

Source gene source: IBV H120 strain

Gene size and sequence: 292bp

CAATACCCGCTACGATTCTCAGATGGAGGACCTGATGGTAATTTCCGTTGGGACTTCATTCCAATAAAT CGTGGTAGGAGTGGAAGATCAACAGCGGCTTCATCAGCAGCATCTAGTAGAGCACCGTCGCGTGATGGCTCGCGTGG ACGTAGAAGCGGAGCTGAAGATGATCTTATAGCTCGTGCAGCAAAGATCATTCAGGATCAGCAGAAGAAGGGTTCTC GCATTACTAAAGCTAAGGCCGATGAAATGGCTCATCGCCGGTATTGTAAGCGTACTATCCCACCTGGTT

SEQ ID NO:5～6 (F-primer)

F 5`-CAAGAACCCAGCACCTATGATG-3`

R 5`-GTCGGAGGATGTTGGCAGC-3`

SEQ ID NO:7～8 (HN-primer)

F 5`-CTGGACGGTTTGGTGGGAA-3`

R 5`-GAGTAATGCGACTGCGGGATG-3`

SEQ ID NO:9～10 (IM-primer)

F 5`-ACACAGGAGGTCTTGTCGCAG-3'

R 5`–CCTTTTCTTATTTCCGCTTTGG-3`

SEQ ID NO:11～12 (IN-primer)

F 5`-CAATACCCGCTACGATTCTCAG-3`

R 5`-AACCAGGTGGGATAGTACGCTTA-3`

The sequence (SEQ ID NO:13) of gene location

SEQ ID NO:14～15 (amplimer of gene location complementary series)

F:AAAGCGACGCAATGAGGCACT

R:GTTCCACGACCGCAACTGC

For verifying the effectiveness of primer of the present invention, carry out substance symmetry PCR and multiple respectively according to following system and condition Symmetrical PCR, is divided into two groups to expand respectively, and two groups of primers are respectively, system 1:NDV-F, IBV-N；System 2:NDV-HN, IBV-M.

PCR labelling system:

The concentration of primer is all 25umol/L up and down.

In test, Cy3-dCTP fluorescein uses final concentration of 2.5umol/L, when adding fluorescein and operates later and all exists Darkroom is carried out.Reaction condition is as follows:

After having expanded, taking 10 μ L products, whether with 2% agarose gel electrophoresis analysis, evaluating can be mutual between primer Impact.

Result shows, the amplified production of multiple RT-PCR is consistent with corresponding substance RT-PCR amplified band,This is described Will not interfere between the primer of bright amplification two-strain, can the most effectively expand 2 kinds of viral genes。

The structure of 2.2 standard plasmids

2.2.1NDV with the extracting of IBV genome

The total serum IgE extracting of NDV and IBV uses the total RNA extraction reagent box of sky root, and with reference to explanation, concrete operation method is such as Under:

1) directly take 200 μ L virus allantoic fluids in 1.5mL centrifuge tube, add 600 μ L lysates, mixing of fully vibrating；

2) homogenised sample is placed 5min at 15-30 DEG C；

3) 4 DEG C, 12000r/min is centrifuged 5min, and supernatant is drawn onto in new centrifuge tube；

4) adding 200 μ L chloroforms, vibrate 15sec the most up and down, and room temperature stands 3min；

5) 4 DEG C, 12000r/min is centrifuged 10min, and sample can produce layering, is forwarded to by aqueous phase colourless for the superiors lightly In new pipe；

6) 0.5 times of volume dehydrated alcohol is added, mixing, transfer in adsorption column, 4 DEG C, 12000r/min is centrifuged 30sec；

7) adding 500 μ L protein liquid removals, 4 DEG C, 12000r/min is centrifuged 30sec；

8) adding 600 μ L rinsing liquids, stand 2min, 4 DEG C, 12000r/min is centrifuged 30sec；It is repeated once

9) 4 DEG C, 12000r/min is centrifuged 2min, discards residual liquid；

10) being forwarded to by adsorption column in RNase-Free centrifuge tube, add 50 μ L RNase-Free ultra-pure waters, room temperature stands 2min, 4 DEG C, 12000r/min is centrifuged 2min.The viral RNA that centrifugal liquid i.e. obtains, saves backup at-20 DEG C or directly carries out Reverse transcription.

2.2.2 RT-PCR and the PCR amplification of probe gene

With the RNA of NDV and IBV of extracting as template, synthesize cDNA, reaction system with Random 6primers for primer As follows:

RT Enzyme Mix	0.5μL
		Random 6primers	0.5μL
5×PrimeScript RT Buffer	2.0μL
		RNA	2.0μL
RNase-Free ultra-pure water	5.0μL
		Total	10.0μL

CDNA synthesis is carried out by following program: response procedures is 37 DEG C, 15min after above-mentioned system being mixed；85 DEG C, 5sec；4 DEG C, preserve.

With the cDNA of NDV, IBV of reverse transcription synthesis as template, carrying out PCR reaction, reaction system is as follows:

2×Taq PCR MasterMix	12.5μL
		cDNA/DNA	2.0μL
Upstream specific primer (25.0 μm ol/L)	0.5μL
		Downstream specific primer (25.0 μm ol/L)	0.5μL
Ultra-pure water	9.5μL
		Total	25.0μL

Reaction condition is as follows:

After PCR, take 7 μ L amplified production agarose gel respectively and carry out electrophoretic analysis.

2.2.3 the glue of probe gene reclaims

The glue of probe gene reclaims, and uses OMEGA glue in a small amount to reclaim test kit, carries out reclaimer operation, step with reference to explanation As follows:

1) take 20 μ LPCR products and carry out electrophoresis, 6V/cm, 25min, uviol lamp incision glue, weigh.Illustrate according to test kit Carry out glue recovery；

2) adding Binding Buffer (XP2) in the ratio of 1:1,55 DEG C of-60 DEG C of water-baths are all melted until glue, period Turn upside down centrifuge tube every 2-3min；

3) adding in adsorption column by liquid, room temperature 12000r/min is centrifuged 1min, outwells filtrate；

4) adding 300Binding Buffer (XP2), room temperature 12000r/min is centrifuged 1min, outwells filtrate；

5) adding 700mL rinsing liquid SPW, room temperature 12000r/min is centrifuged 1min, outwells filtrate；

6) room temperature 12000r/min is empty from 2min, outwells filtrate；

7) being put in by adsorption column in new centrifuge tube, add 30mL elution buffer, room temperature stands 1min；

8) room temperature 12000r/min is centrifuged 2min, takes 7 μ L recovery products and carries out electrophoresis, verifies recovering effect, and remaining reclaims Product saves backup in-20 DEG C.

2.2.4 the connection restructuring of probe gene

Using pMD19-T Simple Vector Cloning Kit, carry out the connection restructuring of probe gene, concrete steps are pressed Explanation is carried out.Linked system is as follows:

PMD19-T Simple carrier	0.5μL
		Glue reclaims PCR primer	5.0μL
Solution I	4.5μL
		Total	10.0μL

4 DEG C connect overnight, connect product and are used for converting DH5 α competent cell.

2.2.5 the preparation of competent cell and preservation

With reference to " Molecular Cloning: A Laboratory guide " Calcium Chloride Method^[56]Preparation DH5 α competent cell, the competence prepared is thin Born of the same parents are packed as 100 μ L/ pipes, are directly used in conversion or in-70 DEG C of preservations.

2.2.6 the conversion of product is connected

100 μ L receptor cells are placed on ice, add 10 μ L wherein and connect product, ice bath 30min；42 DEG C of water-bath heat shocks 90s, quick ice bath cooling 5min；Add immediately 600 μ L 37 DEG C preheating LB fluid medium (without on ice operation), 37 DEG C, 150r/min shaken cultivation 1h, makes recipient bacterium restore normal growth state；Take 150 μ L cultures to be spread evenly across LB flat board and (contain 100mg/mL Amp), dry, cultivate about 12h in 37 DEG C, picking colony is identified.

2.2.7 the qualification of probe plasmid bacterial and preservation

2.2.7.1 the DNA extracting of probe plasmid bacterial

Positive plasmid bacterium is inoculated in 5mL LB (containing 100mg/mL Amp) fluid medium, 37 DEG C of shaken cultivation 12h； Extract test kit illustration method by Omega mini-scale plasmid and extract plasmid.Specifically comprise the following steps that

1) inhaling 1mL bacterium solution in centrifuge tube, room temperature 12000r/min is centrifuged 1min, inhales and abandons supernatant；

2) adding 250 μ L Solution I (4 DEG C of storages), vibration makes thalline suspend；

3) adding 250 μ L Solution II, reverse mixing, stands 2min lightly；

4) 350 μ L Solution III are added, gentle reverse for several times to forming white flock precipitate thing, room temperature 12 000r/min, centrifugal 10min；

5) proceeding in adsorption column by the liquid of previous step, room temperature 12000r/min is centrifuged 1min, outwells filtrate；

6) adding 500 μ L Buffer HB to it, room temperature 12000r/min is centrifuged 1min, outwells filtrate；

7) adding 700 μ L Buffer Wash Buffer to it, room temperature 12000r/min is centrifuged 1min, outwells filtrate；Repeat Once；

8) room temperature 12000r/min is empty from 2min, is loaded on by pillar in a clean centrifuge tube, adds 30 μ L to it Elution Buffer, stands 2min, 12000r/min and is centrifuged 1min, and the centrifugal liquid of collection is the plasmid DNA of extraction.

2.3.7.2 the PCR of probe plasmid bacterial identifies

The probe plasmid bacterial extracted is carried out PCR qualification respectively, makees feminine gender with pMD19-T Simple empty vectors simultaneously Comparison, reaction system is as follows:

2×Taq PCR MasterMix	7.5μL
		Upstream specific primer (25.0 μm ol/L)	0.5μL
Downstream specific primer (25.0 μm ol/L)	0.5μL
		Plasmid (50 times of dilutions)	2.0μL
Ultra-pure water	4.5μL
		Total	15.0μL

Response procedures is ibid.React complete, take respectively 5 μ L in 2.0% agarose gel carry out electrophoretic analysis.

2.2.8 the Sequencing and Characterization of probe plasmid bacterial

Use the double deoxidation chain termination method of Sanger that the probe plasmid bacterial being accredited as the positive through PCR is carried out sequence survey Fixed, sequencing efforts transfers to Shanghai Jie Li Bioisystech Co., Ltd to complete.

Plasmid bacterial T/F that must check order correct, T/HN, T/M, T/N, contain following genetic fragment respectively: SEQ ID NO:1 (NDV-F), SEQ ID NO:2 (NDV-HN), SEQ ID NO:3 (IBV-M), SEQ ID NO:4 (IBV-N).

2.2.9 the preservation of probe plasmid bacterial

Probe plasmid bacterial bacterium amplification culture correct for sequencing, then freeze using 20% defatted milk powder as protective agent Dry ,-70 DEG C of preservations.

Prepared by 2.3 chips

(1) design of chip matrix: every chip is divided into four districts, four districts to be four repeat arrays, with hybridization fence Separate, in order to carry out the hybridization of multiple different sample simultaneously.Each array parameter is as shown in Figure 1: often row's probe gene and Gene location is 9 sampling points, various kinds dot center spacing 450 μm, and spot diameter is 220 μm.

The point system of detection DNA microarray: spotting buffer is configured to sampling liquid, will include that newcastle disease virus, chicken are infected Property bronchitis virus, gene location be quantitatively 250ng/ μ L to concentration, be heated to 95 DEG C keep 5min, be subsequently placed in Cooled on ice 10min.

By chip design requirements add in 96 (384) hole load sample plate holes dilute degeneration good include newcastle disease virus, Avian infectious bronchitis virus probe, gene location and blank Quality Control buffer, seal orifice plate, use gene chip sample applying system (Microarray Printing System, SpotArrayTM 16) contact point sample on amination substrate.Point sample environment Relative humidity is 55%-65%, temperature 15-30 DEG C.

The chip that point makes stands and is fully dried overnight (＞ 8h), then by 60-80 DEG C of hydration-treated 10s, immediately in adding Heat is dried to 80 DEG C of In situPCR instrument, after ultraviolet-crosslinkable 30min, washs 5min with 0.2%SDS liquid, quicker with distilled water Centrifugal drying after washing, seal, 4 DEG C save backup.

Embodiment 2 detection method

1, nucleic acid extraction

The extracting of viral RNA: use kit method extracting viral RNA, test uses virus/fluid sample RNA in a small amount Extraction agent box.By this test kit, extracting RNA being described, method is as follows:

A) taking measuring samples 300 μ L to be placed in centrifuge tube, acutely vibrating after adding 500 μ L RV liquid, 2min rear chamber is gentle and quiet puts 5min。

B) add 750 μ L isopropanols, shake up gently.

C) pipetting 800 μ L in adsorption column, at 4 DEG C, 12 000rpm are centrifuged 30s.

D) abandoning liquid in collecting pipe, moved in adsorption column by remaining lysate, at 4 DEG C, 12 000r are centrifuged 30s.

E) adding 500 μ L RP liquid after abandoning collection liquid, at 4 DEG C, 12 000rpm are centrifuged 30s and remove isolating protein.

F) adding 500 μ L W3 liquid, after standing lmin, at 4 DEG C, 12 000rpm are centrifuged 15s.

G) step f is repeated.

H) being transferred to by adsorption column in another clean centrifuge tube, add 30 μ L ultra-pure waters in adsorbed film central authorities, room temperature is quiet Put 2min.

I) 12 000rpm are centrifuged 2min, and centrifugal liquid is the RNA extracted, and-70 DEG C save backup.

The reverse transcription of viral RNA: NDV, IBV reverse transcription system 10.0 μ L system:

Reverse transcription reaction program is as follows: 42 DEG C, reverse transcription 30min；85 DEG C, 30s inactivates reverse transcription；4 DEG C of holdings.

2, the asymmetric PCR labelling amplification of cDNA/DNA

Obtaining cDNA as template with reverse transcription, carry out PCR reaction, reaction system is as follows:

The concentration of all forward primer is that shown in 10umol/l, SEQ ID NO:6, the concentration of downstream primer is 100umol/ Downstream primer concentration shown in l, SEQ ID NO:8,10,12 is that downstream primer concentration shown in 200umol/l, SEQ ID NO:21 is 10umol/l。

5 ' ends of each downstream primer all have Cy3 fluorescent labeling, and therefore adding primer must be carried out in darkroom.

Reaction condition is as follows:

3, detection

The gene chip using embodiment 1 detects.

The prehybridization of gene chip

Take the gene chip that preparation preserves, chip be placed in hybridization cabin, add prehybridization solution 25ul in chip point sample district, Coverslip is put down gently on it, in order to avoid forming bubble, making prehybridization solution uniform fold chip region, chip being placed in the wet box of sealing Prehybridization 1h at 44 DEG C.

The hybridization of gene chip

Absorbing prehybridization solution, the nucleic acid samples expanded by PCR and hybridization buffer mix after 95 DEG C of degeneration 5min, immediately Put cooling 3min in ice, take this mixed liquor 20-40ul and be added to chip region, put down gently on it with coverslip, chip is put into hybridization cabin Interior lucifuge hybridization in a wet box, hybridizes the 3h time under 48 DEG C of hybridization temperatures.After having hybridized, after coverslip removes, successively Washing 3min successively with the cleanout fluid 1 of warm, cleanout fluid 2, cleanout fluid 3, cleanout fluid 4, low-speed centrifugal is scanned after drying.

The chip gene chip scanning instrument of scanning analysis centrifugal dryingScanning Detction.Scanning ginseng Number is Laserpower 95%, PMGT 75%, resolution 20um, and scanning result preserves image with 16 TIFF and BMP forms.

The impact on gene chip hybridization efficiency of embodiment 3 gold colloidal

1, the preparation of gold colloidal

The HAuCl4 of preparation 1%, 1% citric acid three sodium solution.Take 1.0gHAuCl4 powder to be dissolved in and fill 100mL sterilizing In the clean beaker of ultra-pure water, the HAuCl4 of 1% i.e. made, and be stored in brown bottle, lucifuge 4 DEG C saves backup.

Take 200mL sterilizing ultra-pure water and 2mL1%HAuCl4 is mixed in 500ml large beaker, then measure 20mL and be sub-packed in volume In 10 50mL small beakers of number 1-10, heating magnetic stirring apparatus is used the colloidal gold solution of subpackage to be heated 5min successively, soon Speed adds 1% citric acid three sodium solution, and addition is respectively 0.1mL, 0.2mL, 0.24mL, 0.28mL, 0.32mL, 0.36mL, 0.4mL, 0.6mL, 1.0mL, 1.2mL.Color from pale yellow rapidly goes to black when becoming redness again, more continuously stirred 10min stops Only, waiting solution to be cooled to room temperature, filter with cellulose nitrate film, i.e. available required colloidal gold solution, 4 DEG C keep in Dark Place.Make Used time, it is diluted to the solution that gold colloidal concentration is 25nmol/L.

2, the gold colloidal impact on gene chip hybridization effect

In addition to adding colloidal gold solution (25nmol/L) in PCR system, addition is 0.6uL, and remaining condition is with real Execute example 2, the biased sample of detection NDV and IBV.

3, experimental result

Shown in experimental result chart 1, table 2 and Fig. 2.

Table 1 is added without gold colloidal scanning result

Table 2 adds gold colloidal scanning result

By table 1, table 2 and Fig. 2 it can be seen that can well increase the yield of asymmetric PCR after adding gold colloidal, miscellaneous Hand over the average signal value ratio finding to add gold colloidal to be not added with the high by about 2000 of gold colloidal, illustrate that gold colloidal can allow strand Amplification increases, and inhibits non-specific hybridization.

Experimental result illustrates, gold colloidal is so that testing result is more accurate.Therefore, detection kit of the present invention is preferably wrapped Containing gold colloidal.

Embodiment 4 specific test

One, test method

By the method for embodiment 2, detect tetra-kinds of pathogen of NDV, IBV, IBDV, AIV, to detect its specificity.

Two, result

Experimental result is as it is shown on figure 3, the inventive method can effectively detect NDV, IBV of the present invention, without detecting other Virus, e.g., IBDV, AIV, show the high specificity of test kit of the present invention and gene chip, other virus will not be expanded.

Experimental result illustrates, gene chip of the present invention and the high specificity of test kit.

Embodiment 5 sensitivity test

One, test method

4 kinds of plasmid DNA nucleic acid-protein instrument that embodiment 1 is built quantitatively after, plasmid copy number is adjusted to 1.8 × 10¹²Copy/μ L carries out 10 times of gradient dilutions, dilutes 8 gradients, the liquid of each gradient adds 5 μ L gene location mixing, presses Method according to embodiment 2 detects.

Two, result

Result is as shown in Fig. 4 and Biao 3:

Table 3 gene chip sensitivity technique result

It can be seen that be 10 at target gene dilution factor⁸(plasmid copy number is adjusted to 1.8 × 10⁴Copy/μ L) time, NDV, IBV all has more significantly hybridization spot, and average signal value is more than 1000, and SNRm is more than 1.5, and positive control spot is obvious And negative control spots is inconspicuous.

When using the inventive method to detect, the minimal detectable concentration of each virus sample is 1.8 × 10⁴Copy/μ L (0.2pg/ μ L), illustrates the highly sensitive of gene chip of the present invention and test kit.

Embodiment 6 stability test

One, test method

Random extraction 3 from microarray prepared by two batches of different times, for identical target nucleic acid (NDV-F, NDV-HN) Labelling also carries out hybridization, and the usage amount of its target nucleic acid, hybridization conditions are completely the same with normal process.

Two, result

As it is shown in figure 5, the gene chip that the gene chip produced for same batch and different batches produce, it detects knot Fruit meets expection, and without many great fluctuation processes, positive control spot is obvious and negative control spots is inconspicuous, and stability and repeatability are good Good.

Experimental result illustrates, gene chip good stability of the present invention.

Embodiment 7 uses genechip detection pathological material of disease of the present invention

One, detection method

1, the taking and pretreatment of pathological material of disease:

1) the taking of pathological material of disease: collect 12 cities and counties of Chongqing Sichuan (Chengdu Chongzhou City, Dayi, Chengdu, Liangping, Chongqing, Mianyang, south Fill, Meishan Hongya, the high eyebrow of Meishan, Meishan Danleng, Weiyuan, inland river, Yaan Yu Cheng, Yaan asbestos, Changning, Yibin) 20 parts of performances exhale Inhale the chicken of road symptom, Columba livia sample, including trachea and lung tissue.

2) pretreatment of pathological material of disease: the pathological material of disease sterilizing PBS gathered is ground, acts on 30 minutes at 37 DEG C, multigelation 3 times And by ultrasonic Treatment, centrifugal, supernatant-20 DEG C preservation.

2, detection

The PCR system and the condition that use embodiment 2 carry out single PCR and detect NDV, IBV respectively, use embodiment 1 simultaneously Gene chip, according to embodiment 2 method detect.

Two, testing result

Clinical sample testing result

Experimental result illustrates, test kit of the present invention and gene chip can detect newcastle disease virus, chicken accurately and efficiently Infectious bronchitis virus.

To sum up, test kit of the present invention and gene chip can effectively detect newcastle disease virus, infectious bronchitis of chicken Virus, high specificity, sensitivity are high, the shortest, and detection quickly, has a good application prospect.

Claims (9)

1. the gene chip detecting newcastle disease virus and avian infectious bronchitis virus, it is characterised in that: it includes Solid phase carrier and the probe being fixed on solid phase carrier；Described probe be shown in SEQ ID NO:1～2 any one or two Individual genetic fragment, and any one or two genetic fragments shown in SEQ ID NO:3～4.

Gene chip the most according to claim 1, it is characterised in that: it also includes positioning probe, and location probe is SEQ Genetic fragment shown in ID NO:13.

3. the test kit detecting newcastle disease virus and avian infectious bronchitis virus, it is characterised in that: it includes power Profit requires the gene chip described in 1 or 2 and amplification newcastle disease virus and the reagent of chicken infectious bronchitis virogene, its In, the reagent of amplification Newcastle disease virus gene includes primer pair shown in SEQ ID NO:5～6 and/or SEQ ID NO:7～8； The reagent of amplification chicken infectious bronchitis virogene includes SEQ ID NO:9～10 and/or SEQ ID NO:11～12 institute Show primer pair.

Test kit the most according to claim 3, it is characterised in that: it also includes primer shown in SEQ ID NO:14～15 Right.

Test kit the most according to claim 3, it is characterised in that: it also includes gold colloidal.

Test kit the most according to claim 3, it is characterised in that: described primer centering, upstream shown in SEQ ID NO:5 is drawn Thing is 1:10 with the mol ratio of downstream primer shown in SEQ ID NO:6；Forward primer and SEQ shown in SEQ ID NO:7,9,11 The mol ratio of downstream primer shown in ID NO:8,10,12 is 1:20.

Shown in any one or two genetic fragments shown in 7.SEQ ID NO:1 or 2 and SEQ ID NO:3 or 4 any one Or the use that two genetic fragments are in the gene chip of preparation detection newcastle disease virus and avian infectious bronchitis virus On the way.

Purposes the most according to claim 7, it is characterised in that: described gene chip also includes positioning probe, positions probe It it is the genetic fragment shown in SEQ ID NO:13.

Any one or two genetic fragments, SEQ ID NO:5～6 and/or SEQ ID shown in 9.SEQ ID NO:1～2 Primer shown in NO:7～8 is to any one or two genetic fragments, SEQ ID NO:9～10 shown in, SEQ ID NO:3～4 And/or primer shown in SEQ ID NO:11～12 is at preparation detection newcastle disease virus and avian infectious bronchitis virus Purposes in test kit；Wherein, primer is to for amplifing reagent；SEQ ID NO:1～4 is detection probe.