CN104293766A - Method of cloning goat IGFBP3 gene cDNA coding sequence - Google Patents

Abstract

A method of cloning a goat IGFBP3 gene cDNA coding sequence is disclosed. The nucleotide sequence of the goat IGFBP3 gene cDNA coding sequence is shown as SEQ ID NO:1 in a sequence table. The method includes: A1) a step of extracting total RNA in tissue of longissimus muscle of the back of a goat, and subjecting the total RNA to reverse transcription to obtain cDNA; A2) a step of designing primers and performing PCR amplification, namely a step of designing the primers in the upstream zone of an initiation codon and in a downstream zone of a termination codon by adopting the sequence of a sheep IGFBP3 gene as a template, wherein the designed forward primer is 5'AGCTCGCTGCCGCCCAGT3' and the designed reverse primer is 5'GCTGATCATGTCCTTGGCAG3'; A3) a step of purifying and recovering a PCR product; and A4) a step of cloning. The method for simply and conveniently obtaining the goat IGFBP3 gene cDNA coding sequence is provided, and lays foundations for further study on functions of the gene in a goat growth and development process.

Description

The method of goat IGFBP3 gene cDNA encoding sequence clone

Technical field

The present invention relates to animal gene engineering technology field, from goat muscle tissue, clone IGFBP3(Insulin-like growth factor binding protein 3 more specifically to one) method of gene cDNA encoding region sequence.

Background technology

Insulin-like growth factor binding protein (IGFBPs) is as a member of insulin-like growth factor system, a complicated growth regulating axle between itself and rhIGF-1 (IGFs): IGFBPs and IGFs and acid-sensitive subunit (ALS) combine and form ternary complex to deliver IGFs, and be combined with IGFs the biologic activity regulating free IGFs by the avidity that IGFBPs is different, IGFBP-3 is the insulin-like growth factor binding protein that blood middle concentration is the highest, also be the main carriers of serum I GFs simultaneously, main and the IGF-I of IGFBP-3 combines, contribute to the bioavailability maintaining IGF-I, ensure the biological effect of IGF-I.Therefore IGFBP3 gene plays an important role in the growth of animal, growth and metabolic process.

RT-PCR clones: be a kind of technology combined in the polymerase chain reaction of the reverse transcription of RNA (RT) and cDNA and molecular cloning.First utilize ThermoScript II that RNA reverse transcription is become cDNA, then be template with cDNA, the goal gene fragment of our needs that increase, then this fragment be connected to be transformed in competent cell with carrier and clone, the plasmid PCR product of acquisition checks order.This technology utilizes PCR technology can carry out efficient gene amplification in vitro, and does not need endonuclease digestion and ligase enzyme process, can obtain other fast and rely on digestion with restriction enzyme method to be difficult to the PCR primer obtained; Tens bases that simultaneously the method can overcome regular-PCR product sequencing primer near-end cannot check order the shortcoming obtained.Compare with RACE (cDNA end rapid amplifying) technology, the precise length of goal gene fragment, cost is lower, and workload is little.The key of this technology is the design of PCR primer, at the upstream design forward primer of initiator codon, at the downstream of terminator codon design reverse primer, makes PCR primer can comprise complete gene coding region complete sequence.

Segmented-PCR cloning: goal gene is divided into several fragment and clones respectively, and then be stitched together by subclone order-checking, this method cost is higher, consuming time many and workload is large, a gene is divided into several sections just to be needed to do a few time cloning, and then carries out sequence assembly.

Obtain goal gene coding region sequence and generally adopt clone or RACE technology, RACE technology is by known one section of cDNA fragment in PCR-based technical foundation, by extending amplification to two ends thus obtaining 3 ' complete end and 5 ' end.But this technology is compared with clone technology, the length of goal gene fragment is indefinite, and experimentation cost is high, and workload is large, higher for the RNA specification of quality extracted, and therefore applies relatively less.

Summary of the invention

Technical problem to be solved by this invention is a kind of method providing goat IGFBP3 gene cDNA encoding sequence clone for the deficiencies in the prior art.Filling up the blank of this gene studies on goat, laying the foundation for studying its function on goat further.

The present invention is by the following technical solutions:

The method of goat IGFBP3 gene cDNA encoding sequence clone, comprises the following steps:

A1, from goat longissimus dorsi muscle tissue, extract total serum IgE, then total serum IgE reverse transcription is become cDNA;

A2: with the sequence of this gene of sheep for template designs primer at the downstream area of upstream from start codon region and terminator codon;

A3: be that template carries out pcr amplification with cDNA;

A4: the glue of amplified production reclaims and purifying;

A5: the product of purifying carries out choning and sequencing, can obtain goat IGFBP3 gene cDNA encoding sequence.

Described method, steps A 1 comprises the following steps: the powder of organizing of taking liquid nitrogen grinding good is about 80mg, adds and fills in the EP pipe of 1mL Trizol in advance, and after vibration mixing, room temperature leaves standstill 5min; Add chloroform 0.2mL (must by 1/5 of cumulative volume), vortex instrument vibration mixing 15s, room temperature leaves standstill 5min; The centrifugal 15min of 12000rpm at 4 DEG C; Upper strata aqueous phase 450 μ L is in the 1.5mLEP pipe that another is new in transfer, adds equal-volume Virahol, and after putting upside down mixing, room temperature leaves standstill 10min; The centrifugal 10min of 12000rpm at 4 DEG C; After discarding supernatant liquid, add 75% ethanol (with the preparation of the DEPC process water) 1mL of 4 DEG C of precoolings, leave standstill 5min, the centrifugal 5min of 7500g at 4 DEG C; Abandon supernatant, draw unnecessary liquid with rifle, dry air is about 3min; Add 30 μ L DEPC process water, piping and druming mixing, fully dissolve RNA, then reverse transcription becomes cDNA immediately.

Described method, in steps A 2, primer is SEQ ID NO:3 and SEQ ID NO:4.

Accompanying drawing explanation

Fig. 1 is the PCR primer electrophorogram of goat IGFBP3 gene.

Fig. 2 is the nucleotide sequence of goat IGFBP3 gene coding region and corresponding aminoacid sequence.

Embodiment

Below in conjunction with specific embodiment, the present invention is described in detail.

Concrete implementation step:

1, histioid collection

After choosing birth, the Nanjiang-Huang goat of 120d is slaughtered, and is placed in rapidly liquid nitrogen and preserves stand-by after getting its longissimus dorsi muscle tissue sample.

2, the extraction of total serum IgE and the synthesis of cDNA

(1) take liquid nitrogen grinding good organize powder 80mg, add and fill in the EP pipe of 1mL Trizol in advance, vibration mixing after, room temperature leaves standstill 5min;

(2) add chloroform 0.2mL (must by 1/5 of cumulative volume), vortex instrument vibration mixing 15 seconds, room temperature leaves standstill 5min; The centrifugal 15min of 12000rpm at (3) 4 DEG C;

(4) shift upper strata aqueous phase 450 μ L in the 1.5mLEP pipe that another is new, add equal-volume Virahol, after putting upside down mixing, room temperature leaves standstill 10min;

The centrifugal 10min of 12000rpm at (5) 4 DEG C;

(6), after discarding supernatant liquid, add 75% ethanol (with the preparation of the DEPC process water) 1mL of 4 DEG C of precoolings, leave standstill 5min,

The centrifugal 5min of 7500g at (7) 4 DEG C;

(8) abandon supernatant, draw unnecessary liquid with rifle, dry air is about 3min; Add 30 μ L DEPC process water, piping and druming mixing, fully dissolves RNA.

(9) detect the quality of total serum IgE with the agarose gel electrophoresis method of 1%, effective reverse transcription immediately becomes cDNA.

3, the amplification of goal gene fragment

(1) design of primer: according to the sheep of announcing in GenBank database ( ovis aries) IGFBP3(NM_001134302) gene order, adopt Primer Premier 5.0 software design primer, the primer of design is:

Forward primer: 5'AGCTCGCTGCCGCCCAGT 3'

Reverse primer: 5'GCTGATCATGTCCTTGGCAG 3'

(2) reaction system of PCR and condition: reaction system (25 μ L): the TaKaRa Taq enzyme of 0.25 μ L, 2 × GC Buffer I of 12.5 μ L, the dNTP Mixture of 4 μ L, each 0.5 μ L of forward and reverse primer, the sterilizing ddH of 6.25 μ L ₂o, template cDNA 1 μ L.Reaction conditions is 95 DEG C of denaturation 4 min, and 35 circulations (94 DEG C, 45 s; 53.4 DEG C, 30 s; 72 DEG C, 90 s), last 72 DEG C of 7 min; The PCR primer sepharose of 1.5% carries out electrophoresis detection.

4, the recovery of PCR primer and purifying

PCR primer reclaims kits with Shanghai raw work UNIQ-10 pillar DNA glue and reclaims, and concrete steps are:

(1) by the agarose gel electrophoresis of 1.5%, target DNA fragment and other DNA are separated as far as possible, then with clean scalpel, the sepharose block containing target DNA fragment is cut, put into 1.5 mL centrifuge tubes.

(2) weigh the weight of gel, according to weight and the concentration of blob of viscose, the ratio adding 400 μ L in every 100mg agarose adds Binding Buffer II.

(3) centrifuge tube is placed in 55 DEG C of Metal constant temperature bath, 5 ~ 10 min, or mixing, until blob of viscose dissolves completely.

(4) (optional step) is as object fragment <500bp, adds the Virahol mixing of used Binding Buffer II 1/3 volume.As object fragment >500bp, this step can be omitted, and directly carries out step (5).

(5) transferred to by the sol solution dissolved in the UNIQ-10 post be mounted in 2ml collection tube, room temperature places 2 min.Centrifugal 1 min of 8000 rpm room temperature.

(6) take off UNIQ-10 post, outwell the waste liquid in collection tube, UNIQ-10 post is put into same collection tube, add 500 μ L Wash Solution, centrifugal 1 min of 10000 rpm room temperature.

(7) repeating step (6) once.

(8) take off UNIQ-10 post, outwell the waste liquid in collection tube, UNIQ-10 post is put into same collection tube, centrifugal 2 min of 12000 rpm room temperature.

(9) UNIQ-10 post is put into 1.5 new mL centrifuge tubes, add 30 μ L Elution Buffer in adsorption film central authorities, room temperature places 1 ~ 2 min.Centrifugal 1 min of 12000 rpm room temperature, the liquid in centrifuge tube is the DNA fragmentation of recovery.

(10) get the DNA 2 μ L of collection, 1.5% agarose gel electrophoresis, detect the DNA quality reclaimed.

4, the clone of product

(1) object fragment is connected with carrier

Glue is reclaimed product to be connected with pMD19-T carrier.By carrier at thawed on ice, the of short duration centrifugal centrifuge tube that carrier is housed, in order to avoid liquid hangs on tube wall.According to following system configurations connecting fluid on ultra-clean operator's console:

Reaction mixture is placed in 16 DEG C of water-baths and connects 3h.

(2) conversion of product is connected

help from the competent cell DH5 α ice bath of-80 DEG C of refrigerators taking-up preservations and melt, draw 50 μ L and join in 10 μ L connecting fluids, rotate mixing gently.

place 30min on ice.

heat-shock transformed: after 42 DEG C of heating 45 s, to be placed on 1 ~ 2min on ice.

add the LB substratum 800 μ L being kept at 37 DEG C in advance and cultivate 45min in 37 DEG C of joltings.

the centrifugal 10min of 4000g under room temperature, sops up supernatant liquor 600 μ L.

draw and connect even spread on product to flat board, be inverted in after liquid is completely absorbed in the incubator of 37 DEG C and cultivate 12 ~ 16 h.

(3) screening of positive colony

With the sterilized single bacterium colony of toothpick picking, be inoculated in the 800 μ L LB substratum containing Amp, 37 DEG C, draw 1 μ L bacterium liquid after 200r/min shaking culture 5 h and make pcr template, system and the condition of foundation pcr amplification carry out PCR qualification, and product is detected by 1.5% agarose gel electrophoresis.According to bacterium liquid PCR detected result, draw the bacterium liquid 800 μ L containing positive colony, be sent to Shanghai Sheng Gong biotechnology company limited and check order.

5, the checking of sequence

DNAstar software is used by sequencing result to carry out school team's splicing, find initiator codon and the terminator codon of gene, the complete coding region sequence of the IGFBP3 gene 882bp obtained, by comparing with the sequence of ox and sheep, the consistence of gained goat IGFBP3 coding sequence and ox and sheep is respectively 94.33% and 99.09%.Show that the method can reach the object of the complete coding region sequence obtaining goat IGFBP3 gene.Submit to this sequence to GenBank database, the accession number of acquisition is JQ341161.

Should be understood that, for those of ordinary skills, can be improved according to the above description or convert, and all these improve and convert the protection domain that all should belong to claims of the present invention.

Sequence table

SEQUENCE LISTING

<110> Sichuan Agricultural University

The method of <120> goat IGFBP3 gene cDNA encoding sequence clone

<130> 2013

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 882

<212> DNA

<213> goat

<400> 1

atgctgcggg cacgccccgc gctctgggct gcggctctga ccgcgctggc attgctccgc 60

ggaccgccgg cggcacgagc tggggcgggc acggcgggcg ccggcccggt ggtgcgctgc 120

gagccgtgcg acgcgcgtgc cgttgcccag tgcgcgccgc cgcccccctc gcccccgtgc 180

accgagttgg tgcgcgagcc gggctgcggt tgctgtctca cttgcgcgct gcgcgagggt 240

cagccttgcg gcgtctacac cgagcgctgt ggctccggcc tccgctgcca gccgccgcct 300

ggcgatccgc gcccgctaca cgcgttgttg gacggccgcg ggctctgcgc caacgccagc 360

gccgtcggcc gcctgagccc ctacctgctg cccgcgccac ccgcgccagg aaatggcagt 420

gagtcggaag aagaccacag catggggagc acggagaacc aggctctccc caccacacgc 480

cgggtgcccg actccaaatc ccacctcgcc cacaccaaga tggatgtcat caaaaaaggt 540

catgccaagg acagccagcg ctacaaggtt gactacgagt ctcagagcac agacacccag 600

aacttctcct ccgagtccaa gcatgagaca gaatacgggc cctgccgccg ggaaatggag 660

gacacactga acgacctcaa gttcctgaac acactcagcc ccagggccat ccacattccc 720

aactgtgaca agaagggctt ctacaagaaa aagcagtgcc gcccttccaa gggcaggaag 780

cggggtttct gctggtgtgt ggataagtac gggcagcccc tcccggcctt cagcgtgaag 840

gggaaagggg acgtgcactg cctcagcacg gagagcaagt ag 882

<210> 2

<211> 293

<212> PRT

<213> goat

<400> 2

Met Leu Arg Ala Arg Pro Ala Leu Trp Ala Ala Ala Leu Thr Ala Leu

1 5 10 15

Ala Leu Leu Arg Gly Pro Pro Ala Ala Arg Ala Gly Ala Gly Thr Ala

20 25 30

Gly Ala Gly Pro Val Val Arg Cys Glu Pro Cys Asp Ala Arg Ala Val

35 40 45

Ala Gln Cys Ala Pro Pro Pro Pro Ser Pro Pro Cys Thr Glu Leu Val

50 55 60

Arg Glu Pro Gly Cys Gly Cys Cys Leu Thr Cys Ala Leu Arg Glu Gly

65 70 75 80

Gln Pro Cys Gly Val Tyr Thr Glu Arg Cys Gly Ser Gly Leu Arg Cys

85 90 95

Gln Pro Pro Pro Gly Asp Pro Arg Pro Leu His Ala Leu Leu Asp Gly

100 105 110

Arg Gly Leu Cys Ala Asn Ala Ser Ala Val Gly Arg Leu Ser Pro Tyr

115 120 125

Leu Leu Pro Ala Pro Pro Ala Pro Gly Asn Gly Ser Glu Ser Glu Glu

130 135 140

Asp His Ser Met Gly Ser Thr Glu Asn Gln Ala Leu Pro Thr Thr Arg

145 150 155 160

Arg Val Pro Asp Ser Lys Ser His Leu Ala His Thr Lys Met Asp Val

165 170 175

Ile Lys Lys Gly His Ala Lys Asp Ser Gln Arg Tyr Lys Val Asp Tyr

180 185 190

Glu Ser Gln Ser Thr Asp Thr Gln Asn Phe Ser Ser Glu Ser Lys His

195 200 205

Glu Thr Glu Tyr Gly Pro Cys Arg Arg Glu Met Glu Asp Thr Leu Asn

210 215 220

Asp Leu Lys Phe Leu Asn Thr Leu Ser Pro Arg Ala Ile His Ile Pro

225 230 235 240

Asn Cys Asp Lys Lys Gly Phe Tyr Lys Lys Lys Gln Cys Arg Pro Ser

245 250 255

Lys Gly Arg Lys Arg Gly Phe Cys Trp Cys Val Asp Lys Tyr Gly Gln

260 265 270

Pro Leu Pro Ala Phe Ser Val Lys Gly Lys Gly Asp Val His Cys Leu

275 280 285

Ser Thr Glu Ser Lys

290

<210> 3

<211> 18

<212> DNA

<213> goat

<400> 3

agctcgctgc cgcccagt 18

<210> 4

<211> 20

<212> DNA

<213> goat

<400> 4

gctgatcatg tccttggcag 20

Claims (3)

1. the method for goat IGFBP3 gene cDNA encoding sequence clone, is characterized in that, comprise the following steps:

Step one: extract total serum IgE from goat muscle tissue sample, then becomes cDNA by total serum IgE reverse transcription;

Step 2: the design of amplimer and PCR reaction: with the sequence of this gene of sheep for template designs primer at the downstream area of upstream from start codon region and terminator codon; The primer of design is:

Forward primer: 5'AGCTCGCTGCCGCCCAGT 3'

Reverse primer: 5'GCTGATCATGTCCTTGGCAG 3'

Be that template first carries out grads PCR reaction with cDNA, annealing region selects 50 DEG C to 60 DEG C totally 8 temperature spots, optimizes the condition of regular-PCR.

2.PCR reaction system is 25 μ L systems: the TaKaRa Taq enzyme of 0.25 μ L, the dNTP Mixture of 2 × GC Buffer II, 4 μ L of 12.5 μ L, each 0.5 μ L of forward and reverse primer, the sterilizing ddH of 6.25 μ L ₂o, template cDNA 1 μ L.

3. reaction conditions is 95 DEG C of denaturation 4 min, and 35 circulations (94 DEG C, 45 s; 53.4 DEG C, 30 s; 72 DEG C, 90 s), last 72 DEG C of 7 min;

Step 3: the recovery of amplified production and purifying;

Step 4: the product of purifying carries out choning and sequencing, obtains the nucleotide sequence of 882bp, as shown in sequence table SEQ ID NO:1, is the coding region complete sequence of goat IGFBP3 gene.