CN104292329A - Preparation method of antibody of toxoplasma gondii compact granular protein 6 - Google Patents
Preparation method of antibody of toxoplasma gondii compact granular protein 6 Download PDFInfo
- Publication number
- CN104292329A CN104292329A CN201410468090.7A CN201410468090A CN104292329A CN 104292329 A CN104292329 A CN 104292329A CN 201410468090 A CN201410468090 A CN 201410468090A CN 104292329 A CN104292329 A CN 104292329A
- Authority
- CN
- China
- Prior art keywords
- antibody
- protein
- dense granule
- granule protein
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a preparation method of an antibody of a toxoplasma gondii compact granular protein 6. The preparation method comprises the following steps: (1) selecting a target fragment as a target gene for expressing a recombinant protein; (2) synthesizing the toxoplasma gondii compact granular protein 6; (3) separating and purifying the toxoplasma gondii compact granular protein 6; (4) preparing a rabbit polyclonal antibody of the toxoplasma gondii compact granular protein 6, namely taking the recombinant toxoplasma gondii compact granular protein 6 purified in the step (3) as an antigen to immune a rabbit to obtain antiserum containing an antibody resisting the recombinant toxoplasma gondii compact granular protein 6; and (5) separating and purifying the antiserum containing the antibody resisting the toxoplasma gondii compact granular protein 6 obtained in the step (4) to obtain antibody dry powder resisting the recombinant toxoplasma gondii compact granular protein 6. The antibody dry powder prepared by the preparation method disclosed by the invention can be used as a diagnosis raw material for serological examination; and moreover, the expression yield of the toxoplasma gondii compact granular protein 6 is high.
Description
Technical field
The present invention relates to field of immunology, be specifically related to a kind of preparation method of toxoplasma gondii dense granule protein 6 antibody.
Background technology
Toxoplasma gondii (Toxoplasma gondii) is obligatory parasitism protozoon in a kind of cell, can cause that pregnant woman miscarries, premature labor, monster and stillborn foetus, therefore detect toxoplasma gondii become pregnant before and pregnancy period necessary project.
At present, the detection method of toxoplasma gondii has a variety of: etiological examination, as microscopy polypide from body fluid and tissue, find polypide to make a definite diagnosis, but the method recall rate is lower, and intersection consuming time; Genetic test, as methods such as DNA probe technology, polymerase chain reactions, these methods have higher Sensitivity and Specificity, but complicated operation and extremely strict to the requirement of experimental situation, be not suitable for routine testing;
And Serological testing, have stain test (DT), enzyme linked immunosorbent assay (ELISA), indirect hemagglutination test (IHA) although, the method such as immunoblotting has higher susceptibility, it is easy compared with genetic test to operate, but poor specificity, mainly possesses specific diagnosis raw material because lack.Therefore, be badly in need of will developing a kind of diagnosis raw material being applicable to Serological testing in order to improve the specificity of above method detection kit.
Summary of the invention
The object of the invention is the preparation method that a kind of toxoplasma gondii dense granule protein 6 antibody is provided to solve the problem, antibody dry powder prepared by the method can be used as the diagnosis raw material of Serological testing, and toxoplasma gondii dense granule protein 6 of the present invention to express output high.
The present invention is achieved through the following technical solutions:
A preparation method for toxoplasma gondii dense granule protein 6 antibody, is characterized in that, comprise the steps:
(1) select object fragment as the goal gene of expressing recombinant protein: selected object fragment is as shown in sequence table 1;
(2) synthesis of toxoplasma gondii dense granule protein 6: by the object fragment shown in SEQ ID No.1 in sequence table by pcr amplification, described amplification uses primer as follows,
Upstream primer: 5'GACTAATTCGTTGGGTGGAGTCG 3'
Downstream primer: 5'GGCCTTTAGCGTTTCTGTGTTCGTTTG 3'
Insert after amplification in plasmid pET28a, form pET28a-GRA6 plasmid vector and transform Escherichia coli BL21 (DE3), the single bacterium colony of screening containing recombinant plasmid on the flat board adding corresponding antibodies, extraction recombinant plasmid is verified, in Escherichia coli BL21 (DE3), express target protein;
(3) separation and purification of toxoplasma gondii dense granule protein 6: adopt Ni column purification, comprise protein extraction and protein purification;
(4) prepare rabbit resisting toxoplasmosis dense granule protein 6 polyclonal antibody: remove immune rabbit with the recombinant toxoplasma dense granule protein 6 after step (3) purifying as antigen, obtain the antiserum(antisera) containing anti-recombinant toxoplasma dense granule protein 6 antibody;
(5) separation and purification is carried out to the antiserum(antisera) of resisting toxoplasmosis dense granule protein 6 antibody obtained in step (4), obtain anti-recombinant toxoplasma dense granule protein 6 antibody dry powder.
In technique scheme, described in step (3), the step of protein extraction is: collect the Escherichia coli BL21 (DE3) cultivated, centrifugally abandon supernatant; Sedimentation cell NTA-0 buffer solution forms buffer system; In buffer system, add N,O-Diacetylmuramidase, put cooled on ice process; Buffer system is poured in beaker in supersound process on ice; Supernatant is got afterwards once centrifugal again, after the membrane filtration of 0.22 μm with centrifuge.
In technique scheme, described in step (3), protein purification is: get Ni post and drain off, after washing Ni post; With EDTA solution washing Ni post; Wash Ni post again with water; With NTA-0 buffer solution Ni post; After use NiSO
4washing Ni post, drains off; Identical with NTA-0 pH of buffer to effluent liquid with NTA-0 buffered soln washing Ni post again; With 1mL/min speed loading; With the washing of NTA-0 buffered soln to the constant basket of G250; Wash Ni post with 20mM, 60mM, 200mM and 500mM imidazole solution afterwards, till the constant basket of detection G250, collect flowing liquid respectively, run recombinant toxoplasma dense granule protein 6 purity in glue analytical solution.
In technique scheme, the concrete steps of immune rabbit are in step (4): get recombinant toxoplasma dense granule protein 6 in step (3) after purifying fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, a booster immunization injection within 2nd week, is carried out after first immunisation injection, once every booster immunization injection in two weeks later, each booster immunization injected dose is identical with first immunisation injected dose, get during booster immunization recombinant toxoplasma dense granule protein 6 fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, venous blood collection, obtain the antiserum(antisera) containing anti-recombinant toxoplasma dense granule protein 6 antibody.
In technique scheme, the antiserum(antisera) of resisting toxoplasmosis dense granule protein 6 antibody carries out the concrete steps of separation and purification and is in step (5): (1) Dispersal risk affinity column: mixed with hematocrit CNBr-Sepharose 4B by toxoplasma gondii dense granule protein 6, successively through being cross-linked, cleaning, close, again clean, fill post, balance, obtain recombinant toxoplasma dense granule protein 6 affinity column; (2) affinity chromatography: by recombinant toxoplasma dense granule protein 6 antibody-solutions by the affinity column prepared by (1), carry out desorb after removing non-specific adsorption, Fractional Collections stripping liquid; (3) antibody obtains: the stripping liquid (2) collected, dialysis, lyophilize, both obtains recombinant toxoplasma dense granule protein 6 antibody dry powder.
The present invention has the following advantages:
The present invention is by selecting suitable primer (see sequence table SEQ ID No.2 and SEQ ID No.3) to increase to the gene fragment that can produce stronger immunogenicity site in toxoplasma gondii dense granule protein 6 (GRA6), and adopt the aminoacid sequence in this site to prepare recombinant protein fragment, obtain the antibody of specificity for this site with this fragment immune animal.In prepared by recombinant protein, adopt escherichia expression system, well can ensure the expression of recombinant protein, express output high, be conducive to large batch ofly preparing recombinant protein and corresponding antibody, be suitable for the technology as diagnosis raw material and vaccine development.
Accompanying drawing explanation
The pET28a-GRA6 plasmid vector construct schematic diagram that Fig. 1 has built.
Recombinant toxoplasma dense granule protein 6 electrophorogram after Fig. 2 separation and purification.
Fig. 3 Western Blot verifies anti-recombinant toxoplasma dense granule protein 6 antibody effects figure.
Embodiment
Below in conjunction with drawings and embodiments, the present invention is described in further detail.Following examples are only exemplary; only further describe in detail in order to do technical scheme of the present invention; those of ordinary skill in the art is to be understood that; not departing from the spirit and scope of technical solution of the present invention, the amendment carry out technical scheme or replaced all should be encompassed in claims of the present invention.
1, clone shown in toxoplasma gondii dense granule protein 6 (GRA6) immunogenic fragments (as SEQ ID No.1 in sequence table), the concrete primer information adopted is as follows:
Upstream primer: 5'
gACTaATTCGTTGGGTGGAGTCG 3'
Downstream primer: 5'
gGCCTTTAgCGTTTCTGTGTTCGTTTG 3'
Carry out the pcr amplification of object fragment with this primer pair, obtain the nucleic acid fragment corresponding to SEQ ID No.1 in sequence table.
2, conventional molecular biology method is adopted, increasing, toxoplasma gondii dense granule protein 6 (GRA6) immunogenic fragments obtained is inserted in expression vector, this expression vector is selected from: pET28a, pET30a, pET32a, pGEX etc., is preferably pET28a (carrier is purchased from precious biotechnology (Dalian) company limited).GRA6 immunogenic fragments is inserted in plasmid pET28a, construction recombination plasmid, Fig. 1 is exactly the pET28a-GRA6 plasmid vector construct schematic diagram built, after recombinant plasmid vector is transformed in escherichia coli (E.coli) BL21 (DE3), the single bacterium colony of screening containing recombinant plasmid on the flat board adding corresponding antibodies, extraction recombinant plasmid is verified, obtains building correct recombinant plasmid;
3, in escherichia coli (E.coli) BL21 (DE3), target protein is expressed.37 DEG C of cultivations have transformed BL21 to the OD value 0.6 of recombinant plasmid, add IPTG to 0.5mM, 30 DEG C of induction 5h.
4, the separation and purification of recombinant toxoplasma dense granule protein 6.Collect the intestinal bacteria cultivated, centrifugally abandon supernatant; Sedimentation cell NTA-0 buffer solution; In buffer system, add N,O-Diacetylmuramidase, put and process for some time on ice; Reaction system is poured in beaker in supersound process on ice; Supernatant is got afterwards once centrifugal again, the filter membrane of rear mistake 0.22 μm with centrifuge; Protein purification is: get Ni post and drain off, after washing Ni post; With EDTA solution washing Ni post; Wash Ni post again with water; With NTA-0 buffer solution Ni post; After use NiSO
4washing Ni post, drains off; Identical with NTA-0 pH of buffer to effluent liquid with NTA-0 buffered soln washing Ni post again; With 1mL/min speed loading; With the washing of NTA-0 buffered soln to the constant basket of G250; Wash pillar with 20mM, 60mM, 200mM and 500mM imidazole solution afterwards, till the constant basket of detection G250, collect flowing liquid respectively, run recombinant toxoplasma dense granule protein 6 purity in glue analytical solution.Fig. 2 is exactly the electrophorogram after separation and purification after target protein expression.
5, the sero-fast preparation of recombinant toxoplasma dense granule protein 6.Get recombinant toxoplasma dense granule protein 6 fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, a booster immunization injection within 2nd week, is carried out after first immunisation injection, once every booster immunization injection in two weeks later, each booster immunization injected dose is identical with first immunisation injected dose, get during booster immunization recombinant toxoplasma dense granule protein 6 fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, venous blood collection, obtain the antiserum(antisera) containing anti-recombinant toxoplasma dense granule protein 6 antibody.
6, the sero-fast separation and purification of recombinant toxoplasma dense granule protein 6.(1) Dispersal risk affinity column: recombinant toxoplasma dense granule protein 6 is mixed with hematocrit CNBr-Sepharose 4B, successively through being cross-linked, cleaning, close, again clean, fill post, balance, obtain recombinant toxoplasma dense granule protein 6 affinity column; (2) affinity chromatography: by recombinant toxoplasma dense granule protein 6 antibody-solutions by the affinity column prepared by (1), carry out desorb after removing non-specific son's wife, Fractional Collections stripping liquid; (3) antibody obtains: the stripping liquid (2) collected, dialysis, lyophilize, both obtains recombinant toxoplasma dense granule protein 6 antibody dry powder.By the antibody effects that Western Blot checks the method to prepare, specifically see Fig. 3.
SEQUENCE LISTING
<110> Shen, crane clouds
The preparation method of <120> toxoplasma gondii dense granule protein 6 antibody
<130>
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 360
<212> DNA
<213> Toxoplasma gondii
<400> 1
cgtcaattcg ttgggtggag tcgctgtcgc agcagacagc ggtggtgtta agcagacccc 60
ttcggaaacc ggttcgagcg gtggacagca agaagcagtg gggaccactg aagactatgt 120
caactcttcg gcgatgggcg gtggccaagg cgactcgtta gctgaagatg atacaacctc 180
cgaagcggcg gagggcgacg ttgacccttt tcccgtgctg gcgaatgagg ggaagtcgga 240
ggcgcgtggc ccgtcgctcg aggaaagaat cgaagaacag ggcacaagac gacgttactc 300
ctctgttcaa gaaccacaag cgaaggtgcc tagcaaacga acacagaaac gccacagact 360
<210> 2
<211> 23
<212> DNA
<213> artificial sequence
<400> 2
gactaattcg ttgggtggag tcg 23
<210> 3
<211> 27
<212> DNA
<213> artificial sequence
<400> 3
ggcctttagc gtttctgtgt tcgtttg 27
Claims (5)
1. a preparation method for toxoplasma gondii dense granule protein 6 antibody, is characterized in that, comprise the steps:
(1) select object fragment as the goal gene of expressing recombinant protein: selected object fragment is as shown in sequence table 1;
(2) synthesis of toxoplasma gondii dense granule protein 6: by the object fragment shown in SEQ ID No.1 in sequence table by pcr amplification, described amplification uses primer as follows,
Upstream primer: 5'GACTAATTCGTTGGGTGGAGTCG 3'
Downstream primer: 5'GGCCTTTAGCGTTTCTGTGTTCGTTTG 3'
Insert after amplification in plasmid pET28a, form pET28a-GRA6 plasmid vector and transform Escherichia coli BL21 (DE3), the single bacterium colony of screening containing recombinant plasmid on the flat board adding corresponding antibodies, extraction recombinant plasmid is verified, in Escherichia coli BL21 (DE3), express target protein;
(3) separation and purification of toxoplasma gondii dense granule protein 6: adopt Ni column purification, comprise protein extraction and protein purification;
(4) prepare rabbit resisting toxoplasmosis dense granule protein 6 polyclonal antibody: remove immune rabbit with the recombinant toxoplasma dense granule protein 6 after step (3) purifying as antigen, obtain the antiserum(antisera) containing anti-recombinant toxoplasma dense granule protein 6 antibody;
(5) separation and purification is carried out to the antiserum(antisera) of resisting toxoplasmosis dense granule protein 6 antibody obtained in step (4), obtain anti-recombinant toxoplasma dense granule protein 6 antibody dry powder.
2. the preparation method of toxoplasma gondii dense granule protein 6 antibody as claimed in claim 1, it is characterized in that, described in step (3), the step of protein extraction is: collect the Escherichia coli BL21 (DE3) cultivated, and centrifugally abandons supernatant; Sedimentation cell NTA-0 buffer solution forms buffer system; In buffer system, add N,O-Diacetylmuramidase, put cooled on ice process; Buffer system is poured in beaker in supersound process on ice; Supernatant is got afterwards once centrifugal again, after the membrane filtration of 0.22 μm with centrifuge.
3. the preparation method of toxoplasma gondii dense granule protein 6 antibody as claimed in claim 1, it is characterized in that, described in step (3), protein purification is: get Ni post and drain off, after washing Ni post; With EDTA solution washing Ni post; Wash Ni post again with water; With NTA-0 buffer solution Ni post; After use NiSO
4washing Ni post, drains off; Identical with NTA-0 pH of buffer to effluent liquid with NTA-0 buffered soln washing Ni post again; With 1mL/min speed loading; With the washing of NTA-0 buffered soln to the constant basket of G250; Wash Ni post with 20mM, 60mM, 200mM and 500mM imidazole solution afterwards, till the constant basket of detection G250, collect flowing liquid respectively, run recombinant toxoplasma dense granule protein 6 purity in glue analytical solution.
4. the preparation method of toxoplasma gondii dense granule protein 6 antibody as claimed in claim 1, it is characterized in that, the concrete steps of immune rabbit are in step (4): get recombinant toxoplasma dense granule protein 6 in step (3) after purifying fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, a booster immunization injection within 2nd week, is carried out after first immunisation injection, once every booster immunization injection in two weeks later, each booster immunization injected dose is identical with first immunisation injected dose, get during booster immunization recombinant toxoplasma dense granule protein 6 fully emulsified with isopyknic freund's adjuvant after in rabbit back subcutaneous injection, injection volume is 500ug/, venous blood collection, obtain the antiserum(antisera) containing anti-recombinant toxoplasma dense granule protein 6 antibody.
5. the preparation method of toxoplasma gondii dense granule protein 6 antibody as claimed in claim 1, it is characterized in that, the antiserum(antisera) of resisting toxoplasmosis dense granule protein 6 antibody carries out the concrete steps of separation and purification and is in step (5): (1) Dispersal risk affinity column: mixed with hematocrit CNBr-Sepharose 4B by toxoplasma gondii dense granule protein 6, successively through being cross-linked, cleaning, close, again clean, fill post, balance, obtain recombinant toxoplasma dense granule protein 6 affinity column; (2) affinity chromatography: by recombinant toxoplasma dense granule protein 6 antibody-solutions by the affinity column prepared by (1), carry out desorb after removing non-specific adsorption, Fractional Collections stripping liquid; (3) antibody obtains: the stripping liquid (2) collected, dialysis, lyophilize, both obtains recombinant toxoplasma dense granule protein 6 antibody dry powder.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410468090.7A CN104292329A (en) | 2014-09-15 | 2014-09-15 | Preparation method of antibody of toxoplasma gondii compact granular protein 6 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410468090.7A CN104292329A (en) | 2014-09-15 | 2014-09-15 | Preparation method of antibody of toxoplasma gondii compact granular protein 6 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104292329A true CN104292329A (en) | 2015-01-21 |
Family
ID=52312305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410468090.7A Pending CN104292329A (en) | 2014-09-15 | 2014-09-15 | Preparation method of antibody of toxoplasma gondii compact granular protein 6 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104292329A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103235119A (en) * | 2013-04-11 | 2013-08-07 | 南京农业大学 | A diagnosis antigen for Toxoplasma gondii infection and a preparation method and applications thereof |
| CN103451187A (en) * | 2013-08-19 | 2013-12-18 | 武汉华美生物工程有限公司 | Recombinant neutrophil gelatinase associated lipocalin and preparation method of protein antibody |
| WO2014060448A1 (en) * | 2012-10-16 | 2014-04-24 | Universite Joseph Fourier - Grenoble 1 | Recombinant gra antigens and the use of same for early diagnosis of toxoplasmosis |
| CN103837688A (en) * | 2014-03-27 | 2014-06-04 | 吉林农业大学 | Indirect enzyme-linked immuno sorbent assay (ELISA) kit for detecting canine and feline Toxoplasma gondii antibodies |
-
2014
- 2014-09-15 CN CN201410468090.7A patent/CN104292329A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014060448A1 (en) * | 2012-10-16 | 2014-04-24 | Universite Joseph Fourier - Grenoble 1 | Recombinant gra antigens and the use of same for early diagnosis of toxoplasmosis |
| CN103235119A (en) * | 2013-04-11 | 2013-08-07 | 南京农业大学 | A diagnosis antigen for Toxoplasma gondii infection and a preparation method and applications thereof |
| CN103451187A (en) * | 2013-08-19 | 2013-12-18 | 武汉华美生物工程有限公司 | Recombinant neutrophil gelatinase associated lipocalin and preparation method of protein antibody |
| CN103837688A (en) * | 2014-03-27 | 2014-06-04 | 吉林农业大学 | Indirect enzyme-linked immuno sorbent assay (ELISA) kit for detecting canine and feline Toxoplasma gondii antibodies |
Non-Patent Citations (1)
| Title |
|---|
| MAJID GOLKAR ET AL: "Evaluation of protective effect of recombinant dense granule antigens GRA2 and GRA6 formulated in monophosphoryl lipid A (MPL) adjuvant against Toxoplasma chronic infection in mice", 《VACCINE》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104619862B (en) | The high-flux sequence of single celled many transcripts | |
| TWI670279B (en) | Antibody purification and purity monitoring | |
| CN107266569B (en) | Preparation method of tussah silk fibroin monoclonal antibody | |
| BR112019013947A2 (en) | ANTIBODY, CHEMICAL ANTIGEN RECEPTOR, IMMUNOCOMPETENT CELL, ANTIBODY GENE, VECTOR, HOST CELL, METHOD FOR DETECTING GPC3, AND, GPC3 DETECTION KIT. | |
| US20200055925A1 (en) | Method for preparing whole bovine-derived broadly neutralizing antibody against serotype o foot-and-mouth disease virus | |
| CN102634486B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof | |
| CN103451187B (en) | The preparation method of restructuring neutrophil gelatinase-associated lipocalin and this protein antibodies | |
| CN113045652B (en) | anti-DOG 1 protein monoclonal antibody and cell strain, preparation method and application thereof | |
| CN101463395B (en) | Reagent kit for detecting porcine reproductive and respiratory syndrome virus and detecting method | |
| CN108484758B (en) | anti-Ebola virus VP40 protein monoclonal antibody A2G7 and application thereof | |
| CN105801701A (en) | Heavy chain and light chain variable regions of PCSK9 antibody and application of heavy chain and light chain variable regions | |
| CN114395574B (en) | Porcine epidemic diarrhea virus fusion protein, and encoding gene and application thereof | |
| CN109306008B (en) | Single-chain antibody of swine-origin anti-classical swine fever virus and preparation method thereof | |
| CN102634487B (en) | GPC3 (glypican-3) monoclonal antibody hybridoma strain 8G6, and preparation method and application thereof | |
| CN111018989B (en) | anti-PD-L1 monoclonal antibody and application thereof in preparation of anti-cancer drugs | |
| CN113527474A (en) | Monoclonal antibody for resisting new coronavirus N protein and application thereof | |
| CN103173457B (en) | Sequences of variable regions of anti-CD20 monoclonal antibody and method for preparing same | |
| CN104292329A (en) | Preparation method of antibody of toxoplasma gondii compact granular protein 6 | |
| CN108250293B (en) | anti-Ebola virus VP40 protein monoclonal antibody G7A6 and application thereof | |
| CN112501192B (en) | Hybridoma cell strain for generating anti-human IL21 monoclonal antibody and application thereof | |
| CN103543264A (en) | Preparation, detection and application of polyclonal antibody of yam virus X | |
| CN103897051A (en) | Specific PPMP-type antigen of Clonorchis sinensis | |
| CN106977605A (en) | Anti- CD19 protein monoclonal antibodies and application thereof | |
| CN108623683B (en) | Monoclonal antibody for resisting Pax-5 protein, cell strain, preparation method and application thereof | |
| CN111217905A (en) | Preparation method of recombinant rabbit monoclonal antibody |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20180110 Address after: 430000 Hubei Wuhan city East Lake Development Zone Hi-tech Avenue 818 Gao medical equipment garden B11 No. 2 Applicant after: WUHAN GENECREATE BIO-ENGINEERING CO., LTD. Address before: 430206 hi tech medical equipment Park No. 818, hi tech Avenue, East Lake Development Zone, Wuhan, Hubei, B11 Applicant before: Shen Hexiao |
|
| TA01 | Transfer of patent application right | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150121 |
|
| RJ01 | Rejection of invention patent application after publication |