CN104278015A - Phaffia rhodozyma strain obtained by efficiently over-expressing endogenous astaxanthin synthetase gene - Google Patents
Phaffia rhodozyma strain obtained by efficiently over-expressing endogenous astaxanthin synthetase gene Download PDFInfo
- Publication number
- CN104278015A CN104278015A CN201410466752.7A CN201410466752A CN104278015A CN 104278015 A CN104278015 A CN 104278015A CN 201410466752 A CN201410466752 A CN 201410466752A CN 104278015 A CN104278015 A CN 104278015A
- Authority
- CN
- China
- Prior art keywords
- phaffia rhodozyma
- crts
- astaxanthin
- strain
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
Abstract
The invention discloses a phaffia rhodozyma strain obtained by efficiently an over-expressing endogenous astaxanthin synthetase gene. The invention provides a phaffia rhodozyma genetic engineering strain capable of producing astaxanthin with high yield, obtained by over-expressing an endogenous astaxanthin synthetase gene. A phaffia rhodozyma genetic engineering strain (MK19-pGBKT7crtS) capable of producing astaxanthin with high yield is obtained by over-expressing the astaxanthin synthetase gene crtS by virtue of free plasmids and the strain is named CSR19. An endogenous ribosome bind site sequence (Rbs. sequence for short) exists in front of the crtS gene expressed by the strain. By virtue of fermentation cultivation and in comparison with a receptor strain MK19, the astaxanthin yield of the engineering strain is increased by 33.5%, and the engineering strain is good in stability, and thus, the phaffia rhodozyma strain has a good application prospect in the feed industry.
Description
Technical field
The present invention relates to biological technical field, particularly, relate to phaffia rhodozyma bacterial strain and the application thereof of the endogenous astaxanthin synthetic enzyme gene of a plant height effect process LAN.
Background technology
Astaxanthin (chemical name: 3,3 '-dihydroxyl-4,4 '-diketo-β-carotene), molecular formula is C
40h
52o
4, molecular weight is 596.86.A kind of xenthophylls class carotenoid be widespread in nature, some algae, bacterium, fungi and planktonic organism can self synthesizing astaxanthins, and other higher organism is as crustaceans, fish and birds then absorb astaxanthin by food chain, then store in vivo, make outward appearance present redness, improve commercial value.
Astaxanthin is the highest level product of carotenogenesis, and therefore at nature, astaxanthin has the strongest oxidation-resistance, can oxyradical effectively in scavenger cell, has Tumor suppression to occur in animal body, strengthens the function of immunity function.
Based on above characteristic, astaxanthin is in aquaculture, and medicine, health care and cosmetic field have a wide range of applications.Astaxanthin source is in the market mainly chemosynthesis, not only expensive, and with natural astaxanthin significant difference in structure, function, application and security etc., increases thus to the demand of natural astaxanthin.
Phaffia rhodozyma belongs to Basidiomycota, and assorted Basidiomycetes, red phaffia rhodozyma belongs to, and several kinds of carbon source can be utilized to ferment, and is a kind of astaxanthin producing bacterial strain with industrial applications prospect.In order to improve its astaxanthin yield, applicant passes through the means such as superior strain seed selection and fermentation technology optimization in early stage, obtain a strain high-yield astaxanthin phaffia rhodozyma mutant strain MK19 (culture presevation number is CGMCC No.3445), and determine the suitableeest cultural method, effectively improve the combined coefficient of astaxanthin.
Astaxanthin synthetic enzyme (encoding gene is crtS) is a kind of Cytochrome P450 monooxygenase, plays a role in the conversion process of pigment synthesis precursor substance to end product astaxanthin.CrtS has material impact in the how many output to astaxanthin of intracellular expression amount.If can obtain process LAN astaxanthin synthetic enzyme gene crtS phaffia rhodozyma engineering strain, will greatly improve the output of astaxanthin, adapt to industrial production demand growing at present.
Summary of the invention
First object of the present invention be to provide a kind of free plasmid carrier of effective expression pigment synthesis enzyme in phaffia rhodozyma and Efficient Conversion thereof and stable existence in the method for phaffia rhodozyma.
Another object of the present invention is to provide a kind of phaffia rhodozyma engineering strain and cultural method thereof of the high-yield astaxanthin obtained by process LAN astaxanthin synthetic enzyme gene.
In order to realize above object, the present invention is cloned into astaxanthin synthetic enzyme (astaxanthin synthetase) gene crtS from phaffia rhodozyma (Phaffia rhodozyma) bacterial strain, its nucleotide sequence is as shown in SEQ ID No.1, this full length gene is 3302bp, GC content is 52.7%, its mRNA sequence length is 1809bp, open reading frame ORF length is 1674bp, comprise 18 exons and 17 introns, the astaxanthin synthetic enzyme CrtS of coding 557 amino acid compositions, its aminoacid sequence is as shown in SEQ ID No.2.Predict that this molecular weight of albumen is 62.6kD, iso-electric point is 5.67.CrtS belongs to the 3A subfamily in Cytochrome P450 monooxygenase family, and the albumen of it and other P450 monooxygenase families has very high similarity.Comprise aerobic binding site (
339aGYETS
344), G wherein
340and T
343for conserved residues.Heme binding domain (
488fISGPRACFG
497), and the conserved domain of participation stabilize proteins three-dimensional structure (
394eSLR
397).
The plasmid vector of process LAN crtS gene in phaffia rhodozyma that the present invention selects is pGBKT7, and this plasmid is sequestered expression plasmid, at first for S. cervisiae.Its constitutive promoter P
aDH1the high expression of downstream fusion rotein can be started, and by 2 μ replication sites, self-replicating in yeast.This plasmid has higher transformation efficiency for yeast cell.
The present invention extracts total serum IgE from phaffia rhodozyma MK19, the first chain cDNA is obtained by reverse transcription, be that template amplification obtains the crtS gene comprising upstream from start codon 17bp ribosome bind site sequence with cDNA, cutting ligation by enzyme is inserted on pGBKT7 plasmid, obtains the plasmid vector pGBKT7-crtS (shown in Fig. 1) of process LAN astaxanthin synthetic enzyme CrtS.
Prepared by following steps:
A) extraction of phaffia rhodozyma total serum IgE
(1) get appropriate phaffia rhodozyma (Phaffia rhodozyma) cell, liquid nitrogen grinding, adds 1mlTrizol reagent (Invitrogen), concuss 5 minutes, incubated at room 5 minutes;
(2) 0.2ml chloroform is added, thermal agitation 15-30 second, incubated at room 3 minutes;
(3) 4 DEG C, centrifugal 15 minutes of 12000rpm, sample can be divided into three layers, is transferred in new pipe by colourless for upper strata aqueous phase, then carries out next step operation;
(4) add monoploid and amass Virahol, put upside down mixing, room temperature places 10 minutes, 4 DEG C, and centrifugal 10 minutes of 12000rpm, discards supernatant;
(5) add 1ml75% washing with alcohol precipitation, 4 DEG C, centrifugal 5 minutes of 7500rpm, discards supernatant;
(6) uncap, room temperature dry 10 minutes on ice;
(7) add the appropriate water dissolution of RNA enzyme that do not have to precipitate, obtain total rna solution; B) preparation of phaffia rhodozyma cDNA first chain
Reverse transcription adopts the ThermoScript II (M-MLV) of being produced by Promega company, and concrete operation step is as follows:
Reaction system is 25 μ l, is added to by following composition in the centrifuge tube of a nuclease free:
Total serum IgE 2 μ g
OligdT(0.5μg/μL)?2μL
70 DEG C are heated 5 minutes, unwind, put 2 minutes immediately on ice.
M-MLV?buffer(5×)?5μL
M-MLV ThermoScript II (200U/ μ L) 1 μ L
dNTPs(10mM)?1.25μL
RNA enzyme inhibitors 0.625 μ L
RNase free water mends to 25 μ L
42 DEG C of temperature are bathed 60 minutes, 95 DEG C of heating, 5 minutes termination reactions, freezen protective; C) design of primers
According to the sequence (GenBank accession number is DQ002006) of crtS gene in GenBank, design and synthesis cloning primer is as follows:
CRTSCPF:5’—AATG
CCATGGCCACCTACTTTCTCCATATG—3’
CRTSCPR:5’—AA
CTGCAGGACGACGTAGAAGTCATAGC—3’
NcoI and PstI restriction enzyme site (in see above-mentioned sequence italic have the part of underscore) is designed with respectively at cloning primer two ends
Pcr amplification containing the phaffia rhodozyma astaxanthin synthetic enzyme gene crtS of ribosome bind site: be primer with CRTSCPF, CRTSCPR, with the phaffia rhodozyma cDNA of above-mentioned acquisition for template, amplification obtains the cDNA fragment of crtS, and PCR reaction system is as follows:
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min.
D) from PCR reaction product, object fragment is reclaimed
From PCR primer, purifying reclaims the employing of goal gene fragment and cuts the method that post crossed by glue, PCR reaction product is after agarose gel electrophoresis, goal gene DNA is cut under the irradiation of ultraviolet lamp, goal gene length is 1809bp, the method reclaiming test kit (purchased from Tian Gen company, production code member is DP209-02) specification sheets according to DNA reclaims;
E) TA clone
PCR being reclaimed product is connected on carrier pMD18-T-Simple, and test kit (Code No.D104A) the specification sheets operation that ligation provides according to TaKaRa company, builds and obtain plasmid pMD18-T-crtS;
F) goal gene is connected to Yeast expression carrier pGBKT7
Carry out double digestion to pMD18-T-crtS and pGBKT7 respectively with restriction enzyme NcoI and PstI, then reclaim object fragment, connect with T4DNA ligase enzyme, obtain expression plasmid pGBKT7-crtS, its collection of illustrative plates as shown in Figure 1.Increase in its transformation of E. coli DH5 α (purchased from Shanghai Sheng Gong biotechnology company limited), with the correct transformant of method preliminary screening of bacterium colony PCR, Zai Song invitrogn company checks order, result shows that goal gene crtS sequence is for the sequence shown in SEQ ID NO.1, the amino acid shown in its coding SEQ ID No.2.
The host cell that in the present invention, above-mentioned recombinant plasmid vector transforms is the middle warm type high-yield astaxanthin phaffia rhodozyma mutant strain MK19 that applicant builds early stage, and preserving number is CGMCC No.3445, see Chinese patent CN101717731A.This bacterial strain is obtained through too much taking turns NTG and Co60 mutagenesis screening by wild type strain JCM9042.Its culture temperature is 25 DEG C, under shake flask culture conditions, and the more original starting strain of content astaxanthin improves 17 times.
The electricity of the structure phaffia rhodozyma engineering strain used in the present invention transforms and screening method is:
1) by the phaffia rhodozyma seed of incubated overnight in YPD substratum by 0.5% inoculum size be inoculated in 100ml YPD substratum, 21 DEG C, 200rpm, is cultured to OD
600value is 1;
2) 4 DEG C, 8000rpm, within centrifugal 8 minutes, collect Fife's mutant yeast strains MK19 cell, use 13ml 50mM, pH value is potassium phosphate buffer (the comprising 25mM dithiothreitol (DTT)) re-suspended cell of 7.0, and 21 DEG C are incubated 15 minutes;
3) cell 13ml STM damping fluid washes twice, is finally resuspended in the STM damping fluid of 0.8ml;
(STM damping fluid: 270mM sucrose, 10mM Tris HCl, pH7.5,1mM MgCl
2)
4) the pGBKT7-crtS plasmid DNA of 4 μ l (5 μ g/ul) is mixed with the above-mentioned re-suspended cell of 80 μ l, place 15 minutes on ice, be transferred in the 0.2cm electricity revolving cup of precooling afterwards;
5) electricity turns condition and is: voltage is 2.0kV, and pulse length is 4ms, and interelectrode distance is 0.2cm, adds the 1mlYPD substratum of precooling immediately, rejuvenation 2.5 hours.
6) cell after rejuvenation respectively with 1,10
-1, 10
-2, 10
-3, 10
-4, 10
-5extent of dilution coating PDA dull and stereotyped, cultivate observations after 4-5 days for 21 DEG C;
7) checking of positive transformant: cultivate transformant to mid-log phase with liquid YPD medium, get 1ml fermented liquid collected by centrifugation thalline, use glass bead method smudge cells, extract test kit with commercially available yeast plasmid and extract plasmid DNA, as template, adopt the existence of the method validation plasmid of PCR.Forward primer CRTSIDF is the sequencing primer of T7 promotor, and reverse primer CRTSIDR is positioned at crtS gene internal.
Primer sequence: CRTSIDF:GTAATACGACTCACTATAGGGCG
CRTSIDR:GAGGTAAAGACTGAAGAACGC
PCR reaction system is as follows:
Plasmid template 1 μ l
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min.
The pGBKT7-crtS plasmid built is transferred in phaffia rhodozyma bacterial strain MK19, obtains the phaffia rhodozyma engineering strain (CSR19) of process LAN astaxanthin synthetic enzyme gene.
Thus, present invention also offers the method utilizing above-mentioned phaffia rhodozyma engineering strain CSR19 fermentative production astaxanthin:
(1) seed activation: picking CSR19 lawn is seeded to fresh PDA inclined-plane, cultivates 3 ~ 7 days for 21 ~ 25 DEG C;
(2) liquid seeds activation: picking lawn is in liquid seed culture medium from the PDA inclined-plane of step (1), 21 ~ 25 DEG C, 200-220rpm, cultivates 2-4 days;
Aforesaid liquid seed to be transferred liquid seed culture medium with the inoculum size of 8%-12% second time, 21 ~ 25 DEG C, 200-220rpm, nutrient solution OD
600=9 ~ 12 stop cultivating;
(3) fermentation culture: the liquid seeds of step (2) is seeded to liquid fermenting synthetic medium with 4%-8% mass ratio, 21 ~ 25 DEG C, 200-220rpm, cultivates 4-6 days.
Particularly, the present invention utilizes the method for phaffia rhodozyma engineering strain CSR19 fermentative production astaxanthin to comprise the steps:
(1) seed activation: preserve a small amount of CSR19 lawn of PDA inclined-plane picking from 4 DEG C and be seeded to fresh PDA inclined-plane, cultivate 5 days for 22 DEG C;
(2) liquid seeds activation: picking two ring lawn is to 30ml liquid seed culture medium from the fresh PDA solid of step (1), and liquid seed culture medium is contained in 300ml Erlenmeyer flask, 22 DEG C, 210rpm, cultivates 3 days;
Aforesaid liquid seed to be transferred liquid seed culture medium with the inoculum size second time of 10%, and 21 DEG C, 210rpm, cultivates 36 hours, nutrient solution OD
600about=9 ~ 12;
(3) fermentation culture: aforesaid liquid seed is seeded to liquid fermenting synthetic medium with 6%, 21 DEG C, 210rpm, cultivates 5 days.
Described liquid seed culture medium, its formula is: 36-44g glucose, 3.6-4.4g yeast powder, 2.0-2.8g urea, 1.6-2.2g potassium primary phosphate, and 0.4-0.6g magnesium sulfate 7 hydrate is dissolved in distilled water, is settled to 1000ml, and pH value is 5.8-6.2.
Preferably, described liquid seed culture medium (g/L): glucose 40.0g, yeast powder 4.0g, urea 2.4g, potassium primary phosphate 2.0g, bitter salt 0.5g, is settled to 1000ml.
Described liquid fermenting synthetic medium (g/L): glucose 110.0g, urea 1.8g, potassium primary phosphate 2.0g, magnesium sulfate 0.5g, sodium-chlor 0.1g, calcium chloride 0.1g, 115 DEG C of high-temp steam sterilizings 25 minutes, in this substratum of cooling, add metallic ion mixed liquor and the VITAMIN mixing solutions of filtration sterilization, interpolation concentration is as follows:
VITAMIN mixing solutions VITAMIN adds concentration (μ g/L):
Metal ion adds concentration (μ g/L):
The present invention utilizes pGBKT7 plasmid for the plasmid that sets out, and inserts the astaxanthin synthetic enzyme gene crtS containing self ribosome bind site sequence, builds and obtains being suitable for the free plasmid vector pGBKT7-crtS expressed in phaffia rhodozyma.Forwarded in dominant strain MK19 by this plasmid electricity, obtaining a strain can the engineering strain (MK19-pGBKT7crtS) of high expression astaxanthin synthetic enzyme (CrtS), by its called after CSR19.The astaxanthin synthetic enzyme (CrtS) of high expression level have activated the high expression of key enzyme in pigment synthesis approach, through fermentation culture and compared with F-strain MK19, this project bacterial strain astaxanthin yield improve 33.5%, and good stability, have a good application prospect in fodder industry.
Accompanying drawing explanation
Fig. 1 is the collection of illustrative plates of process LAN plasmid pGBKT7-crtS.
Fig. 2 is the plasmid DNA electrophorogram extracted from phaffia rhodozyma transformant with the method validation of PCR.Swimming lane 1 is DNA molecular amount standard (kb): 4.5,3.0,2.0,1.2,0.8,0.50.2; Swimming lane 2 is the DNA fragmentation that the plasmid pGBKT7-crtS before turning with electricity goes out for template amplification; Swimming lane 3 is the DNA fragmentation gone out for template amplification with the plasmid extracted from positive transformant.
Fig. 3 is phaffia rhodozyma bacterial strain CSR19 and the starting strain MK19 biomass comparison diagram of process LAN astaxanthin synthetic enzyme.
The comparison diagram of Fig. 4 process LAN bacterial strain (CSR19) and starting strain (MK19) astaxanthin yield.
Embodiment
Following examples are used for further illustrating content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to scope of the present invention.
If without specializing, the conventional means that technique means used in embodiment is well known to those skilled in the art.
The percentage sign " % " related in the present invention, if not specified, refers to mass percent; Per-cent between liquid, refers to the ratio of capacity 20 DEG C time.The normal experiment operation stepss such as involved enzyme is cut, reclaim, connect, transform, pcr amplification refer to " molecular cloning (third edition) ".Primer synthesis and order-checking are completed by English fine horse (Invitrogen) biotech firm.
The preparation of embodiment 1 phaffia rhodozyma cDNA
The extraction of 1.1 phaffia rhodozyma total serum IgE
(1) appropriate phaffia rhodozyma (Phaffia rhodozyma) the MK19 cell [being disclosed in Chinese patent CN101717731A] being cultured to mid-log phase is got, liquid nitrogen grinding, add 1mlTrizol reagent (Invitrogen), concuss 5 minutes, incubated at room 5 minutes;
(2) 0.2ml chloroform is added, thermal agitation 15-30 second, incubated at room 3 minutes;
(3) 4 DEG C, centrifugal 15 minutes of 12000rpm, sample can be divided into three layers, is transferred in new pipe by colourless for upper strata aqueous phase, then carries out next step operation;
(4) add monoploid and amass Virahol, put upside down mixing, room temperature places 10 minutes, 4 DEG C, and centrifugal 10 minutes of 12000rpm, discards supernatant;
(5) add 1ml75% washing with alcohol precipitation, 4 DEG C, centrifugal 5 minutes of 7500rpm, discards supernatant;
(6) uncap, room temperature dry 10 minutes on ice;
(7) add the appropriate water dissolution of RNA enzyme that do not have to precipitate, obtain total rna solution.
The preparation of 1.2 phaffia rhodozyma cDNA first chains
Reverse transcription adopts the ThermoScript II (M-MLV) of being produced by Promega company, and concrete operation step is as follows:
Reaction system is 25 μ l, is added to by following composition in the centrifuge tube of a nuclease free:
Total serum IgE 2 μ g
OligdT(0.5μg/μL)?2μL
70 DEG C are heated 5 minutes, unwind, put 2 minutes immediately on ice.
M-MLV?buffer(5×)?5μL
M-MLV ThermoScript II (200U/ μ L) 1 μ L
dNTPs(10mM)?1.25μL
RNA enzyme inhibitors 0.625 μ L
RNase free water mends to 25 μ L
42 DEG C of temperature are bathed 60 minutes, 95 DEG C of heating, 5 minutes termination reactions, freezen protective.
Embodiment 2 contains the acquisition of phaffia rhodozyma astaxanthin synthetic enzyme gene crtS and the structure of this gene expression plasmid of ribosome bind site
2.1 design of primers
According to the sequence (GenBank accession number is DQ002006) of crtS gene in GenBank, design and synthesis cloning primer is as follows:
CRTSCPF:5’—AATG
CCATGGCCACCTACTTTCTCCATATG—3’
CRTSCPR:5’—AA
CTGCAGGACGACGTAGAAGTCATAGC—3’
NcoI and PstI restriction enzyme site (in see above-mentioned sequence italic have the part of underscore) is designed with respectively at cloning primer two ends
2.2 containing the pcr amplification of phaffia rhodozyma astaxanthin synthetic enzyme gene crtS of ribosome bind site
Be primer with CRTSCPF, CRTSCPR, with the phaffia rhodozyma cDNA of above-mentioned acquisition for template, amplification obtains the cDNA fragment of crtS, and PCR reaction system is as follows:
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min.
2.3 reclaim object fragment from PCR reaction product
From PCR primer, purifying reclaims the employing of goal gene fragment and cuts the method that post crossed by glue, PCR reaction product is after agarose gel electrophoresis, goal gene DNA is cut under the irradiation of ultraviolet lamp, goal gene length is 1809bp, the method reclaiming test kit (purchased from Tian Gen company, production code member is DP209-02) specification sheets according to DNA reclaims.
2.4 TA clones
PCR is reclaimed product and be connected to (purchased from TaKaRa company) on carrier pMD18-T-Simple, test kit (Code No.D104A) the specification sheets operation that ligation provides according to TaKaRa company, builds and obtains plasmid pMD18-T-crtS.
2.5 goal gene are connected to Yeast expression carrier pGBKT7
Carry out double digestion to pMD18-T-crtS and pGBKT7 respectively with restriction enzyme NcoI and PstI, then reclaim object fragment, connect with T4DNA ligase enzyme, obtain expression plasmid pGBKT7-crtS, its collection of illustrative plates as shown in Figure 1.Increase in its transformation of E. coli DH5 α (purchased from Shanghai Sheng Gong biotechnology company limited), with the correct transformant of method preliminary screening of bacterium colony PCR, Zai Song invitrogn company checks order, result shows that goal gene crtS sequence is for the sequence (in sequence, 1-17 base is the Rbs. sequence of crtS gene) shown in SEQ ID NO.1, the amino acid shown in its coding SEQ ID No.2.
Embodiment 3 overexpression astaxanthin synthetic enzyme in phaffia rhodozyma MK19 promotes the raising of astaxanthin yield
The preparation of 3.1 phaffia rhodozyma MK19 Electroporation-competent cells and electroporated
1) by the phaffia rhodozyma seed of incubated overnight in YPD substratum by 0.5% inoculum size be inoculated in 100ml YPD substratum, 21 DEG C, 200rpm, is cultured to OD
600value is 1;
2) 4 DEG C, 8000rpm, centrifugal 8 minutes collecting cells, use 13ml 50mM, and pH value is potassium phosphate buffer (comprising 25mM dithiothreitol (DTT)) the Eddy diffusion cell of 7.0, and 21 DEG C are incubated 15 minutes;
3) cell 13ml STM damping fluid washes twice, is finally resuspended in the STM damping fluid of 0.8ml;
(STM damping fluid: 270mM sucrose, 10mM Tris HCl, pH7.5,1mM MgCl
2)
4) by the plasmid DNA of 4 μ l (5 μ g/ul) and the above-mentioned Eddy diffusion cytomixis of 80 μ l, place 15 minutes on ice, be transferred in the 0.2cm electricity revolving cup of precooling afterwards;
5) electricity turns condition and is: voltage is 2.0kV, and pulse length is 4ms, and interelectrode distance is 0.2cm, adds the 1mlYPD substratum of precooling immediately, rejuvenation 2.5 hours.
6) cell after rejuvenation respectively with 1,10
-1, 10
-2, 10
-3, 10
-4, 10
-5extent of dilution coating PDA dull and stereotyped, cultivate observations after 4-5 days for 21 DEG C;
Result shows, and efficiency electroporated is several times all at 90%-100%
7) checking of phaffia rhodozyma positive transformant: liquid seed culture medium cultivates transformant to mid-log phase, get 1ml fermented liquid collected by centrifugation thalline, use glass bead method smudge cells, test kit extraction plasmid DNA is wherein extracted with yeast plasmid, because the plasmid DNA content in cell is not high, the follow-up existence need using the method validation plasmid of PCR.Forward primer CRTSIDF is the sequencing primer of T7 promotor, and reverse primer CRTSIDR is positioned at crtS gene internal.
Described liquid seed culture medium, its formula is: described liquid seed culture medium (g/L): glucose 40.0g, yeast powder 4.0g, urea 2.4g, potassium primary phosphate 2.0g, and bitter salt 0.5g, is settled to 1000ml, and pH value is 6.0.
Primer sequence: CRTSIDF:GTAATACGACTCACTATAGGGCG
CRTSIDR:GAGGTAAAGACTGAAGAACGC
PCR reaction system is as follows:
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min.
The detection of 3.2 positive transformants
(1) cultivation of positive transformant
1) seed activation: preserve a small amount of CSR19 lawn of PDA inclined-plane picking from 4 DEG C and be seeded to fresh PDA inclined-plane, cultivate 5 days for 22 DEG C;
2) liquid seeds activation: from step 1) fresh PDA solid picking two ring lawn to 30ml liquid seed culture medium, liquid seed culture medium is contained in 300ml Erlenmeyer flask, 22 DEG C, 210rpm, cultivates 3 days;
Aforesaid liquid seed to be transferred liquid seed culture medium with the inoculum size second time of 10%, and 21 DEG C, 210rpm, cultivates 36 hours, nutrient solution OD
600about=9 ~ 12;
3) fermentation culture: aforesaid liquid seed is seeded to liquid fermenting synthetic medium with 6%, 21 DEG C, 210rpm, cultivates 5 days.
Described liquid seed culture medium (g/L): glucose 40.0g, yeast powder 4.0g, urea 2.4g, potassium primary phosphate 2.0g, bitter salt 0.5g, is settled to 1000ml.
Described liquid fermenting synthetic medium (g/L): glucose 110.0g, urea 1.8g, potassium primary phosphate 2.0g, magnesium sulfate 0.5g, sodium-chlor 0.1g, calcium chloride 0.1g, 115 DEG C of high-temp steam sterilizings 25 minutes, in this substratum of cooling, add metallic ion mixed liquor and the VITAMIN mixing solutions of filtration sterilization, interpolation concentration is as follows:
VITAMIN mixing solutions VITAMIN adds concentration (μ g/L):
Metal ion adds concentration (μ g/L):
(2) measuring method of biomass
OD
600light absorption value: aseptically, gets the nutrient solution 1ml in fermentation, selects suitable extent of dilution, measure light absorption value with spectrophotometer (SHIMADZU, UVmini-1240).
Dry cell weight: get 30-50ml fermented liquid, 4000rpm, centrifugal 10 minutes, collects bacterial sediment, then uses deionized water wash cell twice, dry to constant weight, calculate the dry cell weight in often liter of fermented liquid, represent with g/L in 105 DEG C.Result is MK19 dry cell weight be 18.888g/L, CSR19 is 25.798g/L.
(3) extraction of astaxanthin and assay
The extraction of astaxanthin:
Get 1ml fermented liquid 12000rpm and collect thalline in centrifugal 1 minute, with deionized water wash thalline 2 times, add the methyl-sulphoxide of preheating, concuss mixes, and 60 DEG C of water bath heat preservations 20 minutes, add extracting solution (methyl alcohol: methylene dichloride=3:1) 1ml, static several minutes, centrifugal 1 minute of 2000rpm, is transferred to supernatant in new pipe, and precipitation repeats with methyl-sulphoxide extraction to thalline is white.
High pressure lipuid chromatography (HPLC) detects the content of astaxanthin:
Said extracted thing is after high speed centrifugation, and detect with high performance liquid chromatography, chromatographic column is enlightening horse diamond two generation post, filler C-18, dp5 μm, column length 25cm, internal diameter 4mm; Moving phase is methyl alcohol: water=97:3, and flow velocity is 1.0ml/min, and determined wavelength is 476nm, and the concentration detecting thing is determined (representing with mg/L) according to the typical curve of standard substance.
4) mensuration of process LAN strain stability
Positive transformant transfer every day in PDA slant medium, continuously 12 generations of switching, through liquid submerged culture, detects Growth of Cells, plasmid and pigment content, find that in cell, process LAN plasmid stabilisation exists, and process LAN albumen and pigment content are stablized.
By the engineering strain (MK19-pGBKT7-crtS) of the phaffia rhodozyma process LAN astaxanthin synthetic enzyme obtained of structure 7.5 liters of fermentor cultivation, its biomass (dry cell weight) accumulation and astaxanthin yield comparatively starting strain (MK19) improve 36.6% and 33.9% respectively, see Fig. 3,4.
Although above with general explanation, embodiment and test, the present invention is described in detail, and on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.
Claims (10)
1., containing the phaffia rhodozyma astaxanthin synthetic enzyme CrtS of self ribosome bind site sequence, its aminoacid sequence is:
A) aminoacid sequence shown in SEQ ID No.2; Or
B) aminoacid sequence shown in SEQ ID No.2 is through replacing, lacking and/or add the aminoacid sequence with same function of one or several amino-acid residue formation.
2. encode the gene crtS of phaffia rhodozyma astaxanthin synthetic enzyme described in claim 1, be following a) or b):
A) its nucleotide sequence is as shown in SEQ ID No.1 in sequence table; Or
B) be substituted one or several Nucleotide by nucleotide sequence shown in SEQ ID No.1, obtain the nucleotide sequence of coding bPrP.
3. the process LAN plasmid vector containing gene described in claim 2.
4. over-express vector as claimed in claim 3, it is pGBKT7-crtS.
5. over-express vector as claimed in claim 4, be is characterized in that, prepared by following steps:
A) extraction of phaffia rhodozyma total serum IgE
B) preparation of phaffia rhodozyma cDNA first chain, 25 μ l reaction systems are: total serum IgE 2 μ g, the OligdT 2 μ L of 0.5 μ g/ μ L, the M-MLV ThermoScript II 1 μ L of M-MLV buffer 5 μ L, 200U/ μ L, dNTPs 1.25 μ L, RNA enzyme inhibitors 0.625 μ L, mends to 25 μ L without RNA enzyme water, and 42 DEG C of temperature are bathed 60 minutes, 95 DEG C of heating, 5 minutes termination reactions, freezen protective;
C) containing the pcr amplification of the phaffia rhodozyma astaxanthin synthetic enzyme gene crtS of ribosome bind site, be primer with CRTSCPF, CRTSCPR, with the phaffia rhodozyma cDNA obtained for template, amplification obtains the cDNA fragment of crtS, the PCR reaction system of 20 μ l is as follows: the template cDNA 1 μ l of 10 μ g/ μ l, 10 × Buffer 2 μ l, 2 × Taq mix 10 μ l, upstream and downstream primer each 0.5 μ l, ddH
2o 6 μ l;
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min;
CRTSCPF:5’—AATG
CCATGGCCACCTACTTTCTCCATATG—3’
CRTSCPR:5’—AA
CTGCAGGACGACGTAGAAGTCATAGC—3’;
D) from PCR reaction product, reclaim object fragment, PCR is reclaimed product and be connected on carrier pMD18-T-Simple, build and obtain plasmid pMD18-T-crtS;
E) goal gene is connected to Yeast expression carrier pGBKT7, respectively double digestion is carried out to pMD18-T-crtS and pGBKT7 with restriction enzyme NcoI and PstI, then object fragment is reclaimed, connect with T4DNA ligase enzyme, obtain expression plasmid pGBKT7-crtS.
6. the phaffia rhodozyma bacterial strain CSR19 of the endogenous astaxanthin synthetic enzyme gene of a plant height effect process LAN.
7. prepare the method for phaffia rhodozyma bacterial strain CSR19 described in claim 6, it is characterized in that, comprise the following steps:
1) by the phaffia rhodozyma seed of incubated overnight in YPD substratum by 0.5% inoculum size be inoculated in YPD substratum, 21 DEG C, 200rpm, is cultured to OD
600value is 1; Described phaffia rhodozyma is high-yield astaxanthin phaffia rhodozyma mutant strain MK19, and preserving number is CGMCCNo.3445;
2) 4 DEG C, 8000rpm, within centrifugal 8 minutes, collect Fife's mutant yeast strains MK19 cell, use 13ml 50mM, pH value is the potassium phosphate buffer re-suspended cell of 7.0, and 21 DEG C are incubated 15 minutes; Described potassium phosphate buffer comprises 25mM dithiothreitol (DTT);
3) wash cell 2 times with 13ml STM damping fluid, be finally resuspended in the STM damping fluid of 0.8ml; Described STM buffer formulation is 270mM sucrose, 10mM Tris HCl, pH7.5,1mM MgCl
2;
4) the pGBKT7-crtS plasmid DNA 4 μ l of 5 μ g/ul is mixed with the above-mentioned re-suspended cell of 80 μ l, place 15min on ice, be transferred in the 0.2cm electricity revolving cup of precooling afterwards;
5) electricity turns condition and is: voltage is 2.0kV, and pulse length is 4ms, and interelectrode distance is 0.2cm, adds the 1mlYPD substratum of precooling immediately, rejuvenation 2.5 hours;
6) cell after rejuvenation respectively with 1,10
-1, 10
-2, 10
-3, 10
-4, 10
-5extent of dilution coating PDA dull and stereotyped, cultivate observations after 4-5 days for 21 DEG C;
7) checking of positive transformant: liquid seed culture medium cultivates transformant to mid-log phase, get 1ml fermented liquid collected by centrifugation thalline, use glass bead method smudge cells, extract plasmid DNA, as template, adopt the existence of the method validation plasmid of PCR: forward primer CRTSIDF is the sequencing primer of T7 promotor, and reverse primer CRTSIDR is positioned at crtS gene internal
Primer sequence: CRTSIDF:GTAATACGACTCACTATAGGGCG
CRTSIDR:GAGGTAAAGACTGAAGAACGC
20 μ lPCR reaction systems are as follows: 10 × Buffer2 μ l, 2 × Taq mix 10 μ l, upstream and downstream primer each 0.5 μ l, ddH
2o 6 μ l;
Reaction conditions is: 94 DEG C of 3min; 94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 5min; 4 DEG C of 2min.
8. phaffia rhodozyma bacterial strain CSR19 is preparing the application in astaxanthin.
9. the method for phaffia rhodozyma bacterial strain CSR19 fermentative production astaxanthin, is characterized in that, comprise the following steps:
(1) seed activation: picking CSR19 lawn is seeded to fresh PDA inclined-plane, cultivates 3 ~ 7 days for 21 ~ 25 DEG C;
(2) liquid seeds activation: picking lawn is in liquid seed culture medium from the PDA inclined-plane of step (1), 21 ~ 25 DEG C, 200-220rpm, cultivates 2-4 days;
Aforesaid liquid seed to be transferred liquid seed culture medium with the inoculum size second time of 10%, 21 ~ 25 DEG C, 200-220rpm, nutrient solution OD
600=9 ~ 12 stop cultivating;
(3) fermentation culture: the liquid seeds of step (2) is seeded to liquid fermenting synthetic medium with 4%-8% mass ratio, 21 ~ 25 DEG C, 200-220rpm, cultivates 4-6 days.
10. the microbial inoculum containing phaffia rhodozyma bacterial strain CSR19.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410466752.7A CN104278015B (en) | 2014-09-12 | 2014-09-12 | One plant height effect is overexpressed the phaffia rhodozyma bacterial strain of endogenous chemical activators enzyme gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410466752.7A CN104278015B (en) | 2014-09-12 | 2014-09-12 | One plant height effect is overexpressed the phaffia rhodozyma bacterial strain of endogenous chemical activators enzyme gene |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104278015A true CN104278015A (en) | 2015-01-14 |
CN104278015B CN104278015B (en) | 2018-05-01 |
Family
ID=52253361
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410466752.7A Expired - Fee Related CN104278015B (en) | 2014-09-12 | 2014-09-12 | One plant height effect is overexpressed the phaffia rhodozyma bacterial strain of endogenous chemical activators enzyme gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104278015B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109097384A (en) * | 2018-08-13 | 2018-12-28 | 中国科学院青岛生物能源与过程研究所 | A method of the ribosome bind site by changing non-throttling enzyme improves isoprene engineering bacteria yield |
CN111635907A (en) * | 2020-07-02 | 2020-09-08 | 浙江华睿生物技术有限公司 | Method for constructing astaxanthin-producing strain |
CN117363502A (en) * | 2023-10-17 | 2024-01-09 | 山东福瑞达医药集团有限公司 | Phaffia rhodozyma strain with high astaxanthin yield and method for preparing astaxanthin by using rhodozyma strain |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1266101A (en) * | 1999-03-09 | 2000-09-13 | 霍夫曼-拉罗奇有限公司 | Astaxanthin synthetic enzyme |
CN101717731A (en) * | 2009-12-07 | 2010-06-02 | 中国农业大学 | Phaffiarhodozyma mutant strain MK19 of glucose metabolism de-repression high-yield astaxanthin and culturing method thereof |
CN103805623A (en) * | 2014-01-17 | 2014-05-21 | 河北大学 | Astaxanthin synthetic gene recombinant plasmid as well as preparation method and application of astaxanthin synthetic gene recombinant plasmid |
CN104004075A (en) * | 2014-05-30 | 2014-08-27 | 山东大学 | Plagiochasma appendiculatum bHLH transcription factor, expression gene thereof and application of expression gene |
-
2014
- 2014-09-12 CN CN201410466752.7A patent/CN104278015B/en not_active Expired - Fee Related
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1266101A (en) * | 1999-03-09 | 2000-09-13 | 霍夫曼-拉罗奇有限公司 | Astaxanthin synthetic enzyme |
CN101717731A (en) * | 2009-12-07 | 2010-06-02 | 中国农业大学 | Phaffiarhodozyma mutant strain MK19 of glucose metabolism de-repression high-yield astaxanthin and culturing method thereof |
CN103805623A (en) * | 2014-01-17 | 2014-05-21 | 河北大学 | Astaxanthin synthetic gene recombinant plasmid as well as preparation method and application of astaxanthin synthetic gene recombinant plasmid |
CN104004075A (en) * | 2014-05-30 | 2014-08-27 | 山东大学 | Plagiochasma appendiculatum bHLH transcription factor, expression gene thereof and application of expression gene |
Non-Patent Citations (3)
Title |
---|
KAZUYUKI OJIMA ET AL: "Cloning of the astaxanthin synthase gene from Xanthophyllomyces dendrorhous (Phaffia rhodozyma) and its assignment as a b-carotene 3-hydroxylase/4-ketolase", 《MOL GEN GENOMICS》 * |
LODATO,P ET AL: "astaxanthin synthetase [Xanthophyllomyces dendrorhous]", 《GENBANK: AAY20974.1》 * |
LODATO,P ET AL: "Xanthophyllomyces dendrorhous astaxanthin synthetase (Ast) mRNA, complete cds", 《GENBANK: DQ002007.1》 * |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109097384A (en) * | 2018-08-13 | 2018-12-28 | 中国科学院青岛生物能源与过程研究所 | A method of the ribosome bind site by changing non-throttling enzyme improves isoprene engineering bacteria yield |
CN109097384B (en) * | 2018-08-13 | 2021-08-13 | 中国科学院青岛生物能源与过程研究所 | Method for improving yield of isoprene engineering bacteria by changing ribosome binding site of non-rate-limiting enzyme |
CN111635907A (en) * | 2020-07-02 | 2020-09-08 | 浙江华睿生物技术有限公司 | Method for constructing astaxanthin-producing strain |
CN117363502A (en) * | 2023-10-17 | 2024-01-09 | 山东福瑞达医药集团有限公司 | Phaffia rhodozyma strain with high astaxanthin yield and method for preparing astaxanthin by using rhodozyma strain |
Also Published As
Publication number | Publication date |
---|---|
CN104278015B (en) | 2018-05-01 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109666683B (en) | Acetyl coenzyme A acetyltransferase gene RKAcaT2 and application thereof | |
CN112410355B (en) | Acyl-coenzyme A oxidase 2 gene RKACOX2 and application thereof | |
CN106884025B (en) | Method for directionally preparing alginate oligosaccharides by enzymatic hydrolysis | |
CN114107340B (en) | Mevalonate kinase gene RKMK and application thereof | |
CN110747206B (en) | 3-hydroxy-3-methylglutaryl coenzyme A reductase gene RKHMGR and application thereof | |
CN116286900B (en) | Acetic acid permease A gene RkAcpa and application thereof | |
CN115011616B (en) | Acetaldehyde dehydrogenase gene RKALDH and application thereof | |
CN108699547B (en) | Yeast strain for high yield of cAMP and application thereof | |
CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
CN102994439A (en) | Escherichia coli recombinant strain producing shikimic acid, and construction method and application thereof | |
CN104789539B (en) | A kind of mutant of trehalose synthase and its preparation method and application | |
CN108034667B (en) | Monascus ruber alpha-amylase gene, and preparation method and application thereof | |
CN106754607A (en) | A kind of recombinant bacterial strain and its construction method for producing tyrosol | |
CN111454854A (en) | Rhodosporidium toruloides gene engineering strain for producing astaxanthin | |
CN104278015A (en) | Phaffia rhodozyma strain obtained by efficiently over-expressing endogenous astaxanthin synthetase gene | |
CN109337932B (en) | Method for increasing yield of monascus pigment | |
KR102473375B1 (en) | Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10 | |
CN110592084B (en) | Recombinant strain transformed by rhtA gene promoter, construction method and application thereof | |
CN112111472A (en) | Novel beta-xylosidase and preparation thereof | |
CN106701800B (en) | A kind of Aureobasidium pullulans polyketide synthases gene and its application | |
CN115838645A (en) | Yeast strain for high yield of orotic acid and application thereof | |
CN109371053B (en) | Construction method of monascus pigment producing strain | |
CN114736918A (en) | Recombinant escherichia coli for producing salidroside through integrated expression and application thereof | |
CN103382496B (en) | Method for preparation of S-adenosylmethionine | |
CN112852847A (en) | Recombinant saccharomyces cerevisiae strain and construction method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180501 Termination date: 20190912 |