CN104263830A - Method for detecting nucleic acid molecules based on acrylamide gel chip - Google Patents
Method for detecting nucleic acid molecules based on acrylamide gel chip Download PDFInfo
- Publication number
- CN104263830A CN104263830A CN201410500118.0A CN201410500118A CN104263830A CN 104263830 A CN104263830 A CN 104263830A CN 201410500118 A CN201410500118 A CN 201410500118A CN 104263830 A CN104263830 A CN 104263830A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- acid molecule
- acrylamide
- dna
- section
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting nucleic acid molecules based on an acrylamide gel chip. The method comprises the following steps: fixing and sectioning tissues or cells according to an ordinary nucleic acid in-situ hybridization process, performing hybridization on single-chain DNA molecules containing closed loops and to-be-detected nuclear molecules by virtue of a base pairing principle, and also combining an amplification primer modified by acrylamide with another site of loop-closed single-chain DNA; adhering sections combined with loop-closed single-chain DNA and the amplification primer to acrylamide modified glass slides, and solidifying the sections by adding an acrylamide liquid above the sections; adding a rolling circle amplification system to ensure that the primer combined with the closed loops of the sections is subjected to rolling circle amplification along the closed loop molecules; and performing detection, calculation and positioning on the quantities and expression positions of to-be-detected nucleic acid molecules after the amplification is completed. The method disclosed by the invention achieves digital quantitative analysis of the nucleic acid molecules, provides a novel method for the quantitative analysis of the nucleic acid molecules, and can be used for establishing a rapid, accurate and cheap nucleic acid detection technique.
Description
Technical field
The invention belongs to technical field of bioengineering, be specifically related to a kind of method based on acrylamide gel chip detection nucleic acid molecule.
Background technology
Fluorescence in situ hybridization (fluorescence in situ hybridization, FISH) be a kind of on-radiation molecular cytogenetics technology grown up on the basis of radioactive in situ hybridization technology, a kind of new in-situ hybridization method formed with fluorescent mark replacement isotopic labeling.The ultimate principle of FISH is marked by the special nucleic acid molecule of DNA (or RNA) probe, and nucleic acid probe used is homologous complementary with detected nucleic acid, and the two, through sex change-annealing-renaturation, can form the crossbred of target DNA and nucleic acid probe.By reporter molecules on a certain nucleotide marker of nucleic acid probe as vitamin H, digoxin, the immuno-chemical reaction between this report molecule and fluorescein-labeled special avidin can be utilized, under mirror, qualitative, quantitative or relative positioning analysis are carried out to determined nucleic acid through fluorescent detection system.
Have at present and the location of goal gene mRNA level in-site in tissue and the research aspect of differential expression change have been applied, in FISH research in the past, because the power of probe its own signal is different, the display Shortcomings of hybridization signal.Although the fluorescent microscope adopted or laser confocal microscope are observed results of hybridization, still can not overcome hybridization signal well and show unclear problem.Although at present more carry out FISH detection to crossing the method that signal amplifies, but problems faced or be need multiple different probes, causes high cost; That the way increased by original position carries out signal amplification, such as have recently and carry out signal amplification at original rolling circle amplification, but, its process is too complicated: need first to carry out original position reverse transcription to target mRNA, then original position connection is carried out, then original position rolling circle amplification is only, whole process not only complicated operation, and in the process of carrying out, easily cause Loss Of Signal, simultaneously because amplified production can not be fixed on the position of original mRNA well, easily cause the loss of follow-up experimentation product.Therefore, reduce the operation steps of original position rolling circle amplification process and the particularly important that seems is fixed to amplified production.
Summary of the invention
The present invention aims to provide a kind of method of the original position rolling circle amplification detection by quantitative nucleic acid molecule based on acrylamide gel chip, nucleic acid molecule forms a mono-clonal amplified production after solid-phase amplification on chip, product is after micrometering sequence or fluorescent probe molecule detect, just the signal of each clone's point can be read, each signaling point just represents the quantity of original object DNA molecular, reaches the object of digital measuring target nucleic acid molecules.For nucleic acid molecule quantitative analysis provides a kind of novel method, set up fast, accurately, cheap nucleic acid detection technique.
The present invention is achieved through the following technical solutions:
A kind of method based on acrylamide gel chip detection nucleic acid molecule, after tissue or cell nucleic acid hybridization in situ method are routinely fixed, cut into slices, single strand dna containing closed loop is hybridized through basepairing rule and core molecule to be detected, the amplimer that is modified through acrylamide is combined with another site of the single stranded DNA of closed loop simultaneously; The section of the single stranded DNA and amplimer that are combined with closed loop pastes on the slide of acrylamide modification, adds acrylamide soln, allow it solidify above section; Add rolling circle amplification system, allow the primer be attached in the closed loop of section carry out rolling circle amplification along closed loop molecule; Undertaken detecting by probe molecule after having increased, calculate, locate determined nucleic acid molecular amounts and express position.
The present invention detects the method for nucleic acid molecule, and the nucleic acid detected picture is cell or tissue comprises thymus nucleic acid DNA and RNA (ribonucleic acid) molecule.
The present invention detects the method for nucleic acid molecule, the single strand dna of described closed loop is the single strand dna of a ring-type, this molecule can be divided into three master operation column regions: the binding sequence mutually matched with determined nucleic acid molecule containing one section of energy, one section of amplimer 3 end of modifying with acrylamide is more than 15 mutual matched sequences of base, and one section of sequence that can be detected.
The present invention detects the method for nucleic acid molecule, one section of sequence in the single strand dna of described single stranded circle and determined nucleic acid molecule have part or all of sequence to be reverse complemental relation, for determined nucleic acid in conjunction with this single-stranded cyclic DNA, and unconjugated single-stranded cyclic DNA can be removed in follow-up cleaning process.
The present invention detects the method for nucleic acid molecule, described acrylamide primer can in rolling circle amplification system with this single stranded circle DNA for template carries out rolling circle amplification.
The present invention detects the method for nucleic acid molecule, and one section of sequence that can be detected in described circular single-stranded DNA refers to that this sequence can be labeled the method detection of probe or micrometering sequence.
Label probe of the present invention refers to fluorescence molecule, the quantum dot that directly or indirectly can be detected by instrument.
Circular single-stranded DNA of the present invention can be for an one or more site of determined nucleic acid molecule, namely multiple single-stranded cyclic DNA detects same testing molecule, also can be that multiple circular single-stranded DNA detects multiple determined nucleic acid molecule, namely detect multiple different nucleic acid molecule simultaneously.
Beneficial effect of the present invention is: the present invention is before carrying out original position rolling circle amplification, first the single stranded DNA detection ring expanded for signal is carried out cyclisation, then with this ring and cell to be measured, organize and hybridize, be through acrylamide to the primer for this cyclic DNA that increases to modify simultaneously, therefore can not be lost at follow-up experimentation by the product that acrylamide gel immobilized primer amplifies, therefore this novel method is quick, accurately, and cheap in-situ nucleic acid quantitative and qualitative analysis technology; Achieve the digitizing quantitative analysis to nucleic acid molecule, the reagent simultaneously and instrument are conventional, without the need to special purchase, and simple and convenient practicality.
Embodiment
Below in conjunction with embodiment, the present invention is described further, the following stated, only to preferred embodiment of the present invention, not do other forms of restriction to the present invention, any those skilled in the art may utilize the technology contents of above-mentioned announcement to be changed to the Equivalent embodiments of equal change.Everyly do not depart from the present invention program's content, according to technical spirit of the present invention to any simple modification made for any of the above embodiments or equivalent variations, all drop in protection scope of the present invention.
Example 1 is based on the expression of the methods combining fluorogenic probe hybridzation detection myeloid tissue BDNF of acrylamide gel chip detection nucleic acid molecule
Design following sequence and probe:
Probe1：5’cy3-CTATAGTGTCACC3’；
Acr-primer：5’Acr-TTTTTTTTTTTTTCATACGATTTAGGTGACGTA3’；
Bdnf1：p-CTATAGTGTCACCTCATGTGAGAAGTTCGGCTTTGCTCAGTACGTCACCTAAATCGTATG；
Bdnf2：p-CTATAGTGTCACCGACCGCTGGGGAACTTGTTGCTTTTCTGTACGTCACCTAAATCGTATG；
Bdnf3：p-CTATAGTGTCACCGGGAGTTTCAGAGTACCCCCATAAAAATTACGTCACCTAAATCGTATG；
Lig：GGTGACACTATAGCATACGATTTAGttttt。
Concrete operation step is as follows:
1) RNA in-situ hybridization method obtains tissue slice routinely; 2) in taqDNA ligase enzyme and reaction system thereof, add Bdnf1, Bdnf2, Bdnf3 and Lig, Bdnf1, Bdnf2 and Bdnf3 can be that template carries out ligation with Lig, form Bdnf1, Bdnf2 and Bdnf3 of single-stranded cyclic DNA form; After the effect of DNA excision enzyme, remove the Lig of non-cyclisation Bdnf1, Bdnf2, Bdnf3 and single stranded form existence, just can obtain Bdnf1, Bdnf2 and Bdnf3 of pure single-stranded cyclic DNA form; 3) in FISH hybridization buffer (can commercialization obtain), add Bdnf1, Bdnf2 and Bdnf3 of the single-stranded cyclic DNA form of the 2nd step gained, and feed together with the section of the 1st step gained, Bdnf1, Bdnf2 and Bdnf3 of cyclisation are combined with the target BDNFmRNA in cell; 4) Bdnf1, Bdnf2 and the Bdnf3 of not hybridizing is washed; 5) DNA chip that acrylamide is modified is prepared; 6) configure 3% acrylamide soln, the section that the 4th step obtains is fixed in the DNA chip of the 5th step; 7) add isothermal amplification system, carry out at 37 degree amplification of spending the night; 8) dissolve Probe1 in hybridization solution, and carry out hybridized overnight with the chip of the 7th step gained; 9) clean non-hybridization probe, and on Laser Scanning Confocal Microscope observation signal; Calculating fluorescent signal is counted, the expression amount of known Bdnf.
Example 2 connects based on the methods combining of acrylamide gel chip detection nucleic acid molecule the expression that micrometering sequence detects myeloid tissue BDNF and NNAT
Design following sequence and probe:
Acr-primer：5’Acr-TTTTTTTTTTTTTCATACGATTTAGGTGACGTA3’；
Bdnf3：p-ATCGTATGCTATAGTGTCACCTCATGTGAGAAGTTCGGCTTTGCTCAGTACGTCACCTAA；
Bdnf4：p-ATCGTATGCTATAGTGTCACCGACCGCTGGGGAACTTGTTGCTTTTCTGTACGTCACCTAA；
Bdnf5：p-ATCGTATGCTATAGTGTCACCGGGAGTTTCAGAGTACCCCCATAAAAATTACGTCACCTAA；
Nnat1：p-ATCGTATGCTATCCTATCACCGCTGCCACTGCGGCCATGGTTCCGAAATACGTCACCTAA；
Nnat2：p-ATCGTATGCTATCCTATCACCTTGGCAAGTGCTCCTCTGACGAGGGAACATACGTCACCTAA；
Nnat3：p-ATCGTATGCTATCCTATCACCGGCTGAGATGGTACTGTTCCGACTTGGTCTACGTCACCTAA；
Lig2：ATAGCATACGATTTAGGTGACGTAttttt
Seq-Primer：ATCGTATGCTAT；
P1：cy3-p-AGTGTCACC；
P2：cy3-p-CCTATCACC。
Operation steps is identical with embodiment 1, and difference is that the reaction system of step 2 adds Bdnf3, and Bdnf4, Bdnf5, Nnat1, Nnat2, Nnat3 and Lig2 carry out ligation.8th step utilizes the micro-sequencing of connection to detect: in ligase enzyme reaction system, add Seq-primer, P1 and P2, detect P1 signal and represent Bdnf, P2 signal represents Nnat and expresses.
Claims (9)
1. the method based on acrylamide gel chip detection nucleic acid molecule, it is characterized in that: after tissue or cell nucleic acid hybridization in situ method are routinely fixed, cut into slices, single strand dna containing closed loop is hybridized through basepairing rule and core molecule to be detected, the amplimer that is modified through acrylamide is combined with another site of the single stranded DNA of closed loop simultaneously; The section of the single stranded DNA and amplimer that are combined with closed loop pastes on the slide of acrylamide modification, adds acrylamide soln, allow it solidify above section; Add rolling circle amplification system, allow the primer be attached in the closed loop of section carry out rolling circle amplification along closed loop molecule; Undertaken detecting by probe molecule after having increased, calculate, locate determined nucleic acid molecular amounts and express position.
2. the method for detection nucleic acid molecule according to claim 1, is characterized in that: the nucleic acid that the method detects picture is cell or tissue comprises thymus nucleic acid DNA and RNA (ribonucleic acid) molecule.
3. the method for detection nucleic acid molecule according to claim 1, it is characterized in that: the single strand dna of described closed loop is the single strand dna of a ring-type, this molecule can be divided into three master operation column regions: the binding sequence mutually matched with determined nucleic acid molecule containing one section of energy, one section of amplimer 3 end of modifying with acrylamide is more than 15 mutual matched sequences of base, and one section of sequence that can be detected.
4. the method for detection nucleic acid molecule according to claim 1, is characterized in that: one section of sequence in the single strand dna of described single stranded circle and determined nucleic acid molecule have part or all of sequence to be reverse complemental relation.
5. the method for detection nucleic acid molecule according to claim 1, is characterized in that: described acrylamide primer can in rolling circle amplification system with this single stranded circle DNA for template carries out rolling circle amplification.
6. the method for detection nucleic acid molecule according to claim 1, is characterized in that: one section of sequence that can be detected in described circular single-stranded DNA refers to that this sequence can be labeled the method detection of probe or micrometering sequence.
7. the method for detection nucleic acid molecule according to claim 1, is characterized in that: described label probe refers to the fluorescence molecule or quantum dot that directly or indirectly can be detected by instrument.
8. the method for detection nucleic acid molecule according to claim 1, is characterized in that: described circular single-stranded DNA detects an one or more site of determined nucleic acid molecule, and namely multiple single-stranded cyclic DNA detects same testing molecule.
9. the method for detection nucleic acid molecule according to claim 1, is characterized in that: described multiple circular single-stranded DNAs detect multiple determined nucleic acid molecule, namely detects multiple different nucleic acid molecule simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410500118.0A CN104263830A (en) | 2014-09-25 | 2014-09-25 | Method for detecting nucleic acid molecules based on acrylamide gel chip |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410500118.0A CN104263830A (en) | 2014-09-25 | 2014-09-25 | Method for detecting nucleic acid molecules based on acrylamide gel chip |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104263830A true CN104263830A (en) | 2015-01-07 |
Family
ID=52155404
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410500118.0A Pending CN104263830A (en) | 2014-09-25 | 2014-09-25 | Method for detecting nucleic acid molecules based on acrylamide gel chip |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263830A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624478A (en) * | 2018-07-12 | 2018-10-09 | 西安交通大学 | A kind of digital pcr chip and its application method based on hydrogel |
| CN112210589A (en) * | 2019-07-09 | 2021-01-12 | 苏州宇测生物科技有限公司 | Quantitative detection method for nucleic acid molecules |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1944676A (en) * | 2006-10-20 | 2007-04-11 | 东南大学 | Full genome rolling circle amplification and its product fixing method |
| CN101230398A (en) * | 2008-02-27 | 2008-07-30 | 东南大学 | Method for preparing three-dimensional gel micro array chip without excitant |
| CN102604934A (en) * | 2012-03-31 | 2012-07-25 | 盛司潼 | Method for amplifying and sequencing nucleic acid based on solid phase carrier |
-
2014
- 2014-09-25 CN CN201410500118.0A patent/CN104263830A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1944676A (en) * | 2006-10-20 | 2007-04-11 | 东南大学 | Full genome rolling circle amplification and its product fixing method |
| CN101230398A (en) * | 2008-02-27 | 2008-07-30 | 东南大学 | Method for preparing three-dimensional gel micro array chip without excitant |
| CN102604934A (en) * | 2012-03-31 | 2012-07-25 | 盛司潼 | Method for amplifying and sequencing nucleic acid based on solid phase carrier |
Non-Patent Citations (6)
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108624478A (en) * | 2018-07-12 | 2018-10-09 | 西安交通大学 | A kind of digital pcr chip and its application method based on hydrogel |
| CN112210589A (en) * | 2019-07-09 | 2021-01-12 | 苏州宇测生物科技有限公司 | Quantitative detection method for nucleic acid molecules |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tian et al. | A review: microRNA detection methods | |
| CN103305612B (en) | Lead ion detection kit based on constant-temperature cascade nucleic acid amplification and detection method of lead ion detection kit | |
| Singer et al. | Electronic barcoding of a viral gene at the single-molecule level | |
| Xiao et al. | An electrochemical sensor for single nucleotide polymorphism detection in serum based on a triple-stem DNA probe | |
| CN101003836B (en) | Primer design method, target nucleic acid detection method, single base mutation detection method and detection kit | |
| JP2018110597A (en) | Multivariate diagnostic assays and methods for using the same | |
| Gilboa et al. | Single-molecule analysis of nucleic acid biomarkers–A review | |
| CN106893781A (en) | A kind of unimolecule methods of genotyping and its application based on DNA paper foldings probe specificity mark | |
| US11359193B2 (en) | Preparation method for in-situ hybridization probe | |
| CN102154498A (en) | Nucleic acid detecting method | |
| WO2019144582A1 (en) | Probe and method for high-throughput sequencing targeted capture target region used for detecting gene mutations as well as known and unknown gene fusion types | |
| Hu et al. | A sensitive colorimetric assay system for nucleic acid detection based on isothermal signal amplification technology | |
| Cai et al. | A signal-on fluorescent aptasensor based on single-stranded DNA-sensitized luminescence of terbium (III) for label-free detection of breast cancer cells | |
| CN107227361A (en) | Primer, probe and detection kit for detecting CYP2C19 gene pleiomorphisms | |
| CN106399577B (en) | A kind of real-time fluorescence PCR detection method for the double target nucleic acids of interest present detections of single channel | |
| Liu et al. | Research progress in molecular biology related quantitative methods of MicroRNA | |
| CN102146479A (en) | Primers and probes for detecting genes associated with schizophrenia, bipolar affective disorders and major depression and kits and preparation methods thereof | |
| CN107227349A (en) | A kind of probe groups, kit and the method for quick detection BCR/ABL Gene Fusions | |
| CN106755454A (en) | A kind of molecular label nucleic acid detection method | |
| CN104263830A (en) | Method for detecting nucleic acid molecules based on acrylamide gel chip | |
| Zhang et al. | Enzyme-free isothermal target-recycled amplification combined with PAGE for direct detection of microRNA-21 | |
| CN107164521A (en) | A kind of CYP2C19*2 genotype detections kit and its detection method | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| CN106319079A (en) | Method for detecting 22q11.2 copy number deletion | |
| CN102978280A (en) | Method for detecting copy number variation based on PCR-LDR technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150107 |