CN104263821A - Species identification kit for old animal sample and preparation method of species identification kit - Google Patents
Species identification kit for old animal sample and preparation method of species identification kit Download PDFInfo
- Publication number
- CN104263821A CN104263821A CN201410465741.7A CN201410465741A CN104263821A CN 104263821 A CN104263821 A CN 104263821A CN 201410465741 A CN201410465741 A CN 201410465741A CN 104263821 A CN104263821 A CN 104263821A
- Authority
- CN
- China
- Prior art keywords
- dna
- reaction solution
- primer
- mix
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a species identification kit for an old animal sample and a preparation method of the species identification kit. The species identification kit comprises the following reagents: a Mastermix reaction solution, a P-mix-1 reaction solution, a P-mix-2 reaction solution and a DNA (deoxyribonucleic acid) molecular weight standard substance. The species identification kit provided by the invention solves the species identification problem of the old biological sample, can be directly applied to the detective work of criminal cases, and can maintain social stability and reveal the choice of ancient people for foods, hunting, livestock breeding and other important economic and cultural backgrounds by excavating animal archaeological information in archaeological remains. The species identification kit can also help customs combat wildlife smuggling activities and protect wildlife resources; in addition, the species identification kit can also be used for identifying the quality of traditional Chinese medicines in animals, thereby fighting against counterfeit and shoddy medicines.
Description
Technical field
The invention provides a kind of old animal specimen Species estimation test kit, the present invention additionally provides the preparation method of this old animal specimen Species estimation test kit simultaneously, belongs to the Species estimation technical field of biological material.
Background technology
In forensic qualification practice, the Species estimation of unknown sources biological material is an important qualification link.The qualification of old biological specimen, becomes a difficult problem for present stage forensic dna inspection, also constrains the value of many important material evidences.In archaeology analysis, customs's inspection and Chinese medicinal materials qualification process, also usually can run into the demand to old biological material Species estimation simultaneously.
The ubiquitous weak point of traditional Species estimation method have following some: one, some detection system lacks required internal reference.The encoding gene of mtDNA is surveyed in independent amplification, as lacked required internal reference when cytb gene, 12SrRNA gene, 5SrRNA gene etc. carry out species discrimination, if be thus detected as negative knot, can not judge that sample is as non-human, also be likely that sample is destroyed, or the reason such as DNA extraction is improper, in Species estimation process, likely obtain false-negative result.Two, the encoding gene of amplification order-checking mtDNA, testing process is loaded down with trivial details, order-checking somewhat expensive.Three, method used mostly based on fresh or preserve good tissue samples, amplified fragments generally at 300-1200bp, to most of old biological material and all archaeology sample standard deviations inapplicable.Four, many experiments reaction can cause that to consume template amount excessive, makes trace, the old biological specimen of high degraded cannot complete detection.Five, the sample that race relation is nearer is fubaritic.As ox and buffalo, goat and sheep.
At present, domestic You Shangbaijia unit has carried out forensic dna test item, annual inspection all kinds of case hundreds thousand of, has played key effect, achieve huge success in the detection of many particularly serious, difficult cases.But leave over many old biological specimens at the scene in sample, be not still effectively utilized, its reason is exactly not for the DNA identification method of old biological specimen.
Summary of the invention
The present invention discloses a kind of old animal specimen Species estimation test kit, for the feature of the DNA severely degrade of old biological specimen, the small segment side of the amplification system that design is target sequence with the cytb gene in Mitochondrial Genome Overview and the variable I district of height, and create parallel composite PCR method first, make Species estimation result by simple agarose gel electrophoresis, can judge sample according to DNA fragmentation length.Construct a set of simple and direct, high responsive mtDNA Species estimation system, promote the progress of forensic dna inspection technology, for criminal detective provides more information and evidence.
The present invention additionally provides the preparation method of old animal specimen Species estimation test kit simultaneously.
technical solution of the present invention is as follows:
Selecting mtDNA genome for detecting target, setting up the composite amplification system optimized.Wherein cytochrome b gene (cytochrome b gene, cytb gene) is as mtDNA encoding gene, and its coding sequence regions is evolved slowly, relatively conservative, thus has comparatively stability, as the internal reference fragment of reaction; With the region of variability in the high variable I district of mtDNA for target area, by comparing to the Mitochondrial Genome Overview sequence of the wildlifes such as the common domestic animal such as people in Genebank and pig, ox, sheep, horse, dog and deer, monkey, bear, tiger, design 2 is to glimmering primer, for the biological material of highly degraded, with the clip size (≤200bp) be applicable to, the single of different genera or mixing sample are detected, according to the difference of the expanding fragment length of different animals kind, in same reaction, identify one or the kind of multiple concrete animal.
By to the revision of primer and adjustment, set up parallel composite amplification system: in this individual system, be divided into two groups parallelly to increase: Cytb primer and mtDNA primer to be placed on one group and to form P-mix-1 and carry out composite amplification reaction by first group; Cytb primer and another are combined formation P-mix-2 to mtDNA primer by second group of compound system, and two groups of parallel carrying out are identified for old animal species.
a kind of old animal specimen Species estimation test kit provided by the invention, is made up of following material:
Test kit comprises following reagent:
(1) Master mix reaction solution
(2) P-mix-1 reaction solution
(3) P-mix-2 reaction solution
(4) DNA molecular amount standard substance;
2. above-mentioned
old animal specimen Species estimation test kitcomponent characteristics be: containing Master mix reaction solution 1ml in test kit, its component is: 0.1M Tris-HCl damping fluid, and pH is 8.2; 0.1% bovine serum albumin; 5mM Mgcl
2; 2mM dNTP; 2U/ μ L Taq DNA polymerase; P-mix-1 reaction solution 0.1ml, its component comprises: 25uM primer A:ACGAAACAGGATCCAACAAC, primer B:GGTGTAGTTGTCTGGGTCTCC, primer C:CCATCAACACCCAAAGCTG and primer D:CATTTAATGCACGACGTACAT; P-mix-2 reaction solution 0.1ml, its component comprises: 25uM primer A:ACGAAACAGGATCCAACAAC, primer B:GGTGTAGTTGTCTGGGTCTCC, primer E: CCCATGCATATAAGCACGTAC and primers F: GAGGCATGGTGATTAAGCTC.
3. the present invention additionally provides the preparation method of old animal specimen Species estimation test kit simultaneously, comprises the following steps:
(1) DNA extraction step is carried out to biological material:
The extracting method of DNA adopts first cracking tissue samples, uses silica gel method to extract the strategy of DNA subsequently.Concrete steps are as follows:
1.. get 0.1-1g animal tissues, add containing 0.5M EDTA, 0.5% SDS, the lysate of 0.4 g/L Proteinase K, 56 DEG C of water-baths 3 hours;
2.. by lysate 500 r/min containing DNA, centrifugal 8 min, get 2mL supernatant liquor and join in centrifugal ultrafiltration pipe, centrifugal 3 hours of 6800 r/min, are concentrated to 100 μ L by the lysate containing DNA.
3.. use silica gel method to extract DNA in the concentrated lysate of previous step.4 DEG C save backup.
(2) parallel composite amplification system
1. PCR reaction system 1 is prepared
Master mix reaction solution 8.5 μ L
P-mix-1 reaction solution 1 μ L
Sample DNA template 2.5 μ L
2. PCR reaction system 2 is prepared
Master mix reaction solution 8.5 μ L
P-mix-2 reaction solution 1 μ L
Sample DNA template 2.5 μ L
Suggestion adds the DNA content scope of sample at 10-20ng/ μ L, carries out diluting or concentrating according to sample size.
(3) above-mentioned PCR system be added in the PCR pipe of 200 μ L volumes, vortex shakes three times gently;
(4) above-mentioned PCR reaction system is put into the automatic amplification instrument of PCR and carry out DNA amplification reaction, response procedures is set to:
95 DEG C of denaturation 5 minutes, 94 DEG C of thermally denatures 30 seconds, 54 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 7 circulations, 94 DEG C of thermally denatures 30 seconds, 50 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 33 circulations; 72 DEG C extend 10 minutes, last 4 DEG C of insulations eventually.
(5) PCR primer electrophoretic analysis
The PCR primer of gained all will carry out electrophoresis detection, and concrete grammar is as follows: get after 5 μ LPCR amplified productions mix with 1 μ L6 × sample loading buffer, add in the well of 3% sepharose, and electrophoretic voltage constant voltage was 90V electrophoresis 50 minutes, and EB dyes.Use gel image analyser detects.
6. the qualification of sample kind is carried out according to electrophoresis result
Often kind of each PCR reaction of animal all detects two electrophoretic bands, wherein one is the amplified production fragment of the Cytb gene of same clip size, using the internal reference (see figure 1) of this band as reaction system, the display extraction quality of DNA profiling and the validity of pcr amplification.The difference in length (see Fig. 2-3) of the amplified production that another band then demonstrates, comparison DNA fragmentation length (seeing the following form).The species specificity of judgement sample is got final product according to the result combination of 2 parallel composite amplification systems.
Table 1.10 kind of common animals in two groups of compound systems through fragment length that pcr amplification obtains
test kit of the present invention Heterosis compared with prior art following some:
1. the present invention devises a parallel composite PCR method, by the combination of two groups of expanding fragment length differences, by simple agarose gel electrophoresis, can carry out Species estimation according to DNA fragmentation length to sample.This design had both solved many primers interference problem of composite amplification, solved again the close problem being difficult to differentiate of the close animal fragment length of species.This method of design for this research initiate, actual effect is simple and direct, efficient.
2. authentication method provided by the invention is for the feature of the DNA severely degrade of old biological specimen, the small segment side of the amplification system that design is target sequence with the cytb gene in the Mitochondrial Genome Overview of high copy number and the variable I district of height, less demanding to the quality and quantity of sample, can to comprise animal tooth, bone, hair, blood, organize equal samples to carry out DNA extraction, find in test that the DNA of 10pg can obtain clear and definite result, when the mtDNA amount extracted remains on more than 20pg, result is the most clear.Especially to the sample success ratio of old apparently higher than similar legal medical expert's species identification test kit or method.
3. add interior mark concept first, use Cytb as positive control, to get rid of false positive and false-negative possibility.If false positive refers to sample contamination, amplify band, if but Cytb expanding fragment length and standard do not meet, be then false positive; When false negative refers to the band length occurring providing without amplified band or non-test kit specification sheets, if the result of Cytb is feminine gender simultaneously, illustrate it is that sample problem cannot increase, the result of Cytb then illustrates other kinds in 10 kinds of animal ranges that sample is identified for non-test kit for positive band else if, to get rid of false negative result.
positively effect of the present invention is:solve the Species estimation problem of old biological specimen, not only can directly apply to the detection work of criminal case, maintain social stability, also can by the excavation to animal archaeology information in archaeology traces, disclose ancient times people to the selection of food, hunt and important economy and the culture background such as cattle breeding.Customs can also be helped to hit wildlife smuggling activity, and save the wild animals resource, may be used for the Chinese medicinal materials quality identifying animal in addition, hit fake and forged medicinal material.
Accompanying drawing explanation
Fig. 1 is that primer A and B increases the mtDNA electrophorogram of 7 kinds of animal specimen;
In figure,
~
number be the sample number of 7 kinds of animals, middle M is DNA Marker.M:PUC 19 DNA Marker, the size of instruction DNA fragmentation is 501bp, 404bp, 331bp, 242bp, 190bp, 147bp, 110bp from top to bottom successively.Each track is respectively P0: blank (negative control)
: horse;
: dog;
: recoon dog;
: pig;
: roe deer;
: deer;
: ermine.Fig. 1 can show that primer A and B can stablize the cytb gene of the mtDNA amplifying 7 kinds of different old animals, and produces the PCR primer that same clip size is about 170bp.Therefore can using the internal reference of primer A and B as old sample composite system.
Fig. 2 is that primer C and D increases the electrophorogram of 10 kinds of animal specimen mtDNA;
In figure, 1 ~ No. 10 is the sample number of 10 kinds of animals, and middle M is DNA Marker.The raw work in M:PUC 19 DNA Marker(Shanghai), the size of instruction DNA fragmentation is 501bp, 404bp, 331bp, 242bp, 190bp, 147bp, 110bp from top to bottom successively.1-10 track is respectively 1: ox; 2: donkey; 3: pig; 4: dog; 5: wolf; 6: roe deer; 7: bear; 8: tiger; 9: racoon dog; 10: ermine.Fig. 1 can show, primer C and D Successful amplification go out the mtDNA of 10 kinds of different animals, and produce the PCR primer of 80bp ~ 220bp different fragments size, indicates primer C and D and has good species specificity equally.
Fig. 3 is that primer E and F increases the mtDNA electrophorogram of 10 kinds of animal specimen;
In figure, 1 ~ No. 10 is the sample number of 10 kinds of animals, and middle M is DNA Marker.The raw work in M:PUC 19 DNA Marker(Shanghai), the size of instruction DNA fragmentation is 501bp, 404bp, 331bp, 242bp, 190bp, 147bp, 110bp from top to bottom successively.Each track is respectively P0: blank; 1: ox; 2: donkey; 3: pig; 4: dog; 5: wolf; 6: roe deer; 7: bear; 8: tiger; 9: racoon dog; 10: ermine.Fig. 2 can show, primer E and F Successful amplification go out the mtDNA of 10 kinds of different animals, and produce the PCR primer of 80bp ~ 220bp different fragments size, indicates primer E and F and has good species specificity equally.
Fig. 4 is that 10 kinds of old animals are increased the electrophorogram obtained in compound system.
In figure, 1 ~ No. 10 is the sample number of 10 kinds of animals, and middle M is DNA Marker.Each duct all produces 2 bands, and wherein primer A and B is as reaction internal reference, and various animal amplifies onesize product band.Another primer amplification produces the band with species specificity.
P0: blank 1: ox; 2: donkey; 3: pig; 4: dog; 5: wolf; 6: roe deer; 7: bear; 8: tiger; 9: racoon dog; 10: ermine.
Fig. 5 be 10 kinds of animals after primer C and D carries out pcr amplification, the homologous sequence comparison chart of amplified production sequencing result.
In figure, be followed successively by from top to bottom: bos: family ox; Equus: family donkey; Sus scrofa: family pig; Canis lupus familiaris: family dog; Canis lupus: wolf; Panthera tigris altaica: northeastern tiger; Capreolus: roe deer; Nyctereutes procyonoides: recoon dog; Ursus thibetanus: black bear; Mustela vison: mink; MT-5R: primer C; MT-4F: primer D; Consensus: the global alignment result of these 10 kinds of animal extension increasing sequences, wherein blue portion represents the sequence homology of upstream and downstream primer and 10 kinds of animals
Fig. 6 is 7 kinds of archeology animal specimen electrophorograms that pcr amplification obtains in two groups of compound systems.
In figure, 1. ~ 7. number be the sample number of 7 kinds of archeology animal specimen, middle M is DNA Marker.Left figure is archeology animal specimen compound system one, right figure is archeology animal specimen compound system two.P0: blank; 1.: horse; 2.: dog; 3.: racoon dog; 4.: pig; 5.: roe deer; 6.: deer; 7.: ermine.
The pcr amplification electrophoresis result that Fig. 7 Aged bone (doubtful tiger bone) is identified.
Embodiment
For the ease of understanding the present invention, especially exemplified by following examples.Its effect is understood to be explaination of the present invention but not to any type of restriction of the present invention.
embodiment 1
the preparation of old animal specimen Species estimation test kit and use 1 thereof
1. utilize the variable I region sequence of the genomic height of the mammalian mitochondria in Genebank to design two pairs of PCR primer, the sequence of described primer is:
Primer A:ACGAAACAGGATCCAACAAC
Primer B:GGTGTAGTTGTCTGGGTCTCC
Utilize the variable I region sequence of the genomic height of the mammalian mitochondria in Genebank to design two pairs of PCR primer, the sequence of described primer is:
Primer C:CCATCAACACCCAAAGCTG
Primer D:CATTTAATGCACGACGTACAT
Primer E:CCCATGCATATAAGCACGTAC
Primers F: GAGGCATGGTGATTAAGCTC
2. preparation comprises the test kit of following moiety: Master mix reaction solution 1 is managed (1ml/ pipe), P-mix-1 reaction solution and each 1 pipe (0.1ml/ pipe) of P-mix-2 reaction solution, DNA molecular amount standard substance 1 is managed (0.5ml/ pipe).
3. use procedure:
(1) sample DNA:
Choose ultrapure water as pcr amplification ' negative ' specimens, use the vein anticoagulated blood of ox after conventional cracking and digestion process, apply traditional phenol/chloroform method and extract STb gene, and with ultrapure water using STb gene concentration dilution to 20ng/ μ L as template DNA.
(2) PCR reaction system preparation: set up PCR reaction system, mixing following composition to cumulative volume is 12ul.
PCR reaction system 1:Master mix reaction solution 8.5 μ L
P-mix-1 reaction solution 1 μ L
Ox DNA profiling 2.5 μ L
PCR reaction system 2:Master mix reaction solution 8.5 μ L
P-mix-2 reaction solution 1 μ L
Ox DNA profiling 2.5 μ L
(3) above-mentioned PCR system be added in the PCR pipe of 200 μ L volumes, vortex shakes three times gently;
(4) above-mentioned PCR reaction system is put into the automatic amplification instrument of PCR and carry out DNA amplification reaction, response procedures is set to: 95 DEG C of denaturation 5 minutes, 94 DEG C of thermally denatures 30 seconds, 54 DEG C of annealing 30 seconds, and 72 DEG C extend 45 seconds; 7 circulations, 94 DEG C of thermally denatures 30 seconds, 50 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 33 circulations; 72 DEG C extend 10 minutes, last 4 DEG C of insulations eventually.
(5) PCR primer electrophoretic analysis
The PCR primer of gained all will carry out electrophoresis detection, and concrete grammar is as follows: get after 5 μ L pcr amplification products mix with 1 μ L6 × sample loading buffer, add in the well of 3% sepharose, and electrophoretic voltage constant voltage was 90V electrophoresis 50 minutes, and EB dyes.Use gel image analyser detects.
embodiment 2
the preparation of old animal specimen Species estimation test kit and use 2 thereof
1. utilize the variable I region sequence of the genomic height of the mammalian mitochondria in Genebank to design two pairs of PCR primer, the sequence of described primer is:
Primer A:ACGAAACAGGATCCAACAAC
Primer B:GGTGTAGTTGTCTGGGTCTCC
Utilize the variable I region sequence of the genomic height of the mammalian mitochondria in Genebank to design two pairs of PCR primer, the sequence of described primer is:
Primer C:CCATCAACACCCAAAGCTG
Primer D:CATTTAATGCACGACGTACAT
Primer E:CCCATGCATATAAGCACGTAC
Primers F: GAGGCATGGTGATTAAGCTC
2. preparation comprises the test kit of following moiety: Master mix reaction solution 1 is managed (1ml/ pipe), P-mix-1 reaction solution and each 1 pipe (0.1ml/ pipe) of P-mix-2 reaction solution, DNA molecular amount standard substance 1 is managed (0.125ml/ pipe).
3. collection of specimens, preservation and record:
(1) collection of specimens: sample is tooth, bone, hair, blood, the tissue samples of animal.
(2) preserve: can detect immediately, preserve one week for 4 DEG C ,-20 DEG C of preservation perives can reach 1 year.
(3) record: sample registration gathers date, specimen types and sample size.
4. use procedure:
(1) sample DNA extracts: suggestion uses QIAquick PCR Purification test kit.
Get animal specimen 0.2g, add containing 0.5M EDTA, 0.5% SDS, the lysate of 0.4 g/L Proteinase K, 56 DEG C of water-baths 3 hours; By lysate 7500 r/min containing DNA, centrifugal 8 min, get 2mL supernatant liquor and join in Centricon YM-10, centrifugal 3 hours of 6800 r/min, are concentrated to 100 μ L by the lysate containing DNA; Use test kit QIAquick PCR Purification Kit to extract previous step and concentrate DNA in lysate.Use Nanodrop 2000 to measure DNA content, the DNA content of above-mentioned sample is 1-10ng/ μ L.To the last collecting DNA solution uses Nanodrop 2000 to measure DNA content, regulates DNA solution concentration to 1ng/ μ l, 10 ng/ μ l and 50 ng/ μ l with ultrapure water.
(2) PCR reaction system preparation: 2 PCR reaction systems (PCR system 1 and 2) set up by each sample, and mixing following composition to cumulative volume is 12ul.Each PCR system is all set up and is arranged three parallel reactor pipes, adds the sample DNA template of three different concns respectively.
PCR reaction system 1:Master mix reaction solution 8.5 μ L
P-mix-1 reaction solution 1 μ L
The sample DNA template 2.5 μ L of different concns
PCR reaction system 2:Master mix reaction solution 8.5 μ L
P-mix-2 reaction solution 1 μ L
The sample DNA template 2.5 μ L of different concns
(3) above-mentioned PCR system be added in the PCR pipe of 200 μ L volumes, vortex shakes three times gently;
(4) above-mentioned PCR reaction system is put into the automatic amplification instrument of PCR and carry out DNA amplification reaction, response procedures is set to: 95 DEG C of denaturation 5 minutes, 94 DEG C of thermally denatures 30 seconds, 54 DEG C of annealing 30 seconds, and 72 DEG C extend 45 seconds; 7 circulations, 94 DEG C of thermally denatures 30 seconds, 50 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 33 circulations; 72 DEG C extend 10 minutes, last 4 DEG C of insulations eventually.
(5) PCR primer electrophoretic analysis
The PCR primer of gained all will carry out electrophoresis detection, and concrete grammar is as follows: get after 5 μ L pcr amplification products mix with 1 μ L6 × sample loading buffer, add in the well of 3% sepharose, and electrophoretic voltage constant voltage was 90V electrophoresis 50 minutes, and EB dyes.Use gel image analyser detects.
following test is provided to show accuracy of the present invention and susceptibility.
test example 1:
Apply this test kit and identification and analysis has been carried out to the difference preservation position of the animal of different genera, different preservation condition and the old sample of different shelf time, and comparison sample record or Morphological Identification result, to judge accuracy and the susceptibility of this test kit.
Old animal specimen specifying information is in table 2.
The Information Monitoring cartogram of table 2 sample
1. Ge Qubiaozhong animal tissues sample 0.2g, carries out DNA extraction to biological material, uses Nanodrop 2000 to measure the content of above-mentioned sample DNA for 10-20ng/ μ L.Then carry out PCR composite amplification, specific experiment step is shown in embodiment 1 and 2.Gel image analyser is used to detect after PCR primer electrophoresis.Compound system detected result is shown in Fig. 4.
2. the qualification of sample kind is carried out according to electrophoresis result
The composite amplification system of often kind of animal all detects two electrophoretic bands, and according to the difference in length of the amplified production demonstrated, the length of corresponding table 1 carries out the generic judgment of checked sample, and comparison sample record, all obtain conforming result.
3. pairs of ten kinds old animals fragment products order-checking of using primer C and primer D increase to obtain, (see figure 5) of being compared by the homologous sequence of sequencing result and ncbi database, sequencing result shows that the qualification result that use the present invention obtains is accurate.
test example 2:
Species estimation is carried out to archeology animal specimen.Archeology animal specimen provides by archaeology center, Jilin University borderland, and wherein only have horse to be sample bone, all the other are tooth samples, and above all sample standard deviation sealings are also preserved under shady and cool dry condition.The details of each sample listed below by table 3.
the Information Monitoring cartogram of table 3 old animal specimen
1. Ge Qubiaozhong animal tissues sample 0.2g, carries out DNA extraction to biological material, uses Nanodrop 2000 to measure the content of above-mentioned sample DNA for 10-20ng/ μ L.Then carry out PCR composite amplification, specific experiment step is shown in embodiment 1 and 2.Gel image analyser is used to detect after PCR primer electrophoresis.Compound system detected result is shown in Fig. 6.
2 carry out the qualification of sample kind according to electrophoresis result
The composite amplification system of often kind of animal all detects two electrophoretic bands, according to the difference in length of the amplified production demonstrated, the length of corresponding table 1 carries out the generic judgment of checked sample, and comparison sample archeology and Morphological Identification record, all obtain conforming result.
test example 3:
Whether the bone material of qualification censorship is tiger bone
1. pair bone that an example wine steeped (doubtful tiger bone) is identified.
Dental drill is used to get sample bone 0.2g, DNA extraction is carried out to biological material, NanoDrop 2000 is used to carry out quantitatively to the DNA profiling extracted, concentration is 90ng/ μ L, after diluting 5 times, obtaining DNA concentration is that the template solution of 18 ng/ μ L carries out PCR composite amplification, and specific experiment step is shown in embodiment 1.Gel image analyser is used to detect after PCR primer electrophoresis.Compound system detected result is shown in Fig. 7.
2. interpretation of result
Electrophoresis result obtains the band of the characteristic length of tiger: the fragment length that PCR system 1 obtains: 170,216; The fragment length that PCR system 2 obtains: 170.The pcr amplification length sequences of the various animals of synopsis 2, identifies that this sample bone should be tiger bone.
3. further sequential analysis is carried out to band, to verify the accuracy that old animal specimen Species estimation test kit is checked.
Get said extracted DNA appropriate, application pair of primers carries out pcr amplification to the conventional gene-cytochrome B portion gene of animal species qualification on plastosome, the long 170bp of amplified production, the BigDye Terminator v3.1 sequencing kit of application AB company carries out sequencing reaction, the order-checking of application ABI-310 type DNA analysis instrument, obtains the partial dna sequence of the cytochrome b gene of above-mentioned sample.
Searched in Genbank database by the DNA sequence dna obtained and share sequence, obtain the shared sequence of 37 100% altogether, 37 shared sequences are the sequence of tiger.Shared analytical results shows, the DNA sequence dna of the cytochrome b gene of the bone acquisition of institute's censorship is the characteristic sequence of tiger, proves that the bone of institute's censorship is tiger bone.Prove that old animal specimen Species estimation test kit qualification result of the present invention is accurate, feasible.
SEQ?no.1
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?1
<210>?1
<211>?20
<212>?DNA
<213> artificial sequence
<400>?1
ACG?AAA?CAG?GAT?CCA?ACA?AC?20
SEQ?no.2
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?4
<210>?1
<211>?21
<212>?DNA
<213> artificial sequence
<400>?1
GGT?GTA?GTT?GTC?TGG?GTC?TCC?21
SEQ?no.3
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?4
<210>?1
<211>?19
<212>?DNA
<213> artificial sequence
<400>?1
CCA?TCA?ACA?CCC?AAA?GCT?G?19
SEQ?no.4
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?4
<210>?1
<211>?21
<212>?DNA
<213> artificial sequence
<400>?1
CAT?TTA?ATG?CAC?GAC?GTA?CAT?21
SEQ?no.5
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?4
<210>?1
<211>?21
<212>?DNA
<213> artificial sequence
<400>?1
CCC?ATG?CAT?ATA?AGC?ACG?TAC?21
SEQ?no.6
<110> Jilin University
<120> old animal specimen Species estimation test kit
<140>
<160>?4
<210>?1
<211>?20
<212>?DNA
<213> artificial sequence
<400>?1
GAG?GCA?TGG?TGA?TTA?AGC?TC?20
Claims (2)
1. an old animal specimen Species estimation test kit, it is characterized in that being made up of following material:
(1) Master mix reaction solution 1ml;
(2) P-mix-1 reaction solution 0.1ml;
(3) P-mix-2 reaction solution 0.1ml;
(4) DNA molecular amount standard substance;
Wherein,
Master mix reaction solution component is: 0.1M Tris-HCl damping fluid, and pH is 8.2; 0.1% bovine serum albumin; 5mM Mgcl
2; 2mM dNTP; 2U/ μ L Taq DNA polymerase;
P-mix-1 reaction solution component comprises: the primer A:ACGAAACAGGATCCAACAAC of 25uM, primer B:GGTGTAGTTGTCTGGGTCTCC, primer C:CCATCAACACCCAAAGCTG and primer D:CATTTAATGCACGACGTACAT;
P-mix-2 reaction solution component comprises: the primer A:ACGAAACAGGATCCAACAAC of 25uM, primer B:GGTGTAGTTGTCTGGGTCTCC, primer E:CCCATGCATATAAGCACGTAC and primers F: GAGGCATGGTGATTAAGCTC;
DNA molecular amount standard substance is used for the reference of gel electrophoresis double center chain linear DNA molecular size range.
2. the preparation method of old animal specimen Species estimation test kit according to claim 1, comprises the following steps:
1) DNA extraction is carried out to biological material:
①Qu 0.1-1g animal tissues, adds containing 0.5M EDTA, 0.5% SDS, the lysate of 0.4 g/L Proteinase K, 56 DEG C of water-baths 3 hours;
2. by lysate 7500 r/min containing DNA, centrifugal 8 min, get 2mL supernatant liquor and join in centrifugal ultrafiltration pipe, centrifugal 3 hours of 6800 r/min, are concentrated to 100 μ L by the lysate containing DNA;
3. silica gel method is used to extract DNA in the concentrated lysate of previous step; 4 DEG C save backup;
2) parallel composite amplification system
1. PCR reaction system 1 is prepared
Master mix reaction solution 8.5 μ L
P-mix-1 reaction solution 1 μ L
Sample DNA template 2.5 μ L
2. PCR reaction system 2 is prepared
Master mix reaction solution 8.5 μ L
P-mix-2 reaction solution 1 μ L
Sample DNA template 2.5 μ L
Suggestion adds the DNA content scope of sample at 10-20ng/ μ L, carries out diluting or concentrating according to sample size;
3) above-mentioned PCR system be added in the PCR pipe of 200 μ L volumes, vortex shakes three times gently;
4) above-mentioned PCR reaction system is put into the automatic amplification instrument of PCR and carry out DNA amplification reaction: 95 DEG C of denaturation 5 minutes, 94 DEG C of thermally denatures 30 seconds, 54 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 7 circulations, 94 DEG C of thermally denatures 30 seconds, 50 DEG C of annealing 30 seconds, 72 DEG C extend 45 seconds; 33 circulations; 72 DEG C extend 10 minutes, last 4 DEG C of insulations eventually;
5) PCR primer electrophoretic analysis
Get after 5 μ LPCR amplified productions mix with 1 μ L6 × sample loading buffer, add in the well of 3% sepharose, electrophoretic voltage constant voltage was 90V electrophoresis 50 minutes, and EB dyes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410465741.7A CN104263821B (en) | 2014-09-15 | 2014-09-15 | Old animal specimen Species estimation test kit and preparation method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410465741.7A CN104263821B (en) | 2014-09-15 | 2014-09-15 | Old animal specimen Species estimation test kit and preparation method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104263821A true CN104263821A (en) | 2015-01-07 |
| CN104263821B CN104263821B (en) | 2016-03-23 |
Family
ID=52155395
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410465741.7A Expired - Fee Related CN104263821B (en) | 2014-09-15 | 2014-09-15 | Old animal specimen Species estimation test kit and preparation method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263821B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441537A (en) * | 2015-11-05 | 2016-03-30 | 陕西省动物研究所 | Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof |
| CN110079607A (en) * | 2019-04-04 | 2019-08-02 | 陕西师范大学 | A kind of primer sets, the method and application for detecting blood sample kind |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1144880C (en) * | 2001-12-06 | 2004-04-07 | 中南大学 | Biological variety genome DNA fingerprint atlas |
| CN103320511B (en) * | 2013-05-31 | 2015-07-01 | 张更谦 | Medicolegal identification method of species |
-
2014
- 2014-09-15 CN CN201410465741.7A patent/CN104263821B/en not_active Expired - Fee Related
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105441537A (en) * | 2015-11-05 | 2016-03-30 | 陕西省动物研究所 | Method for molecular identification of Qinling Mountain illegal trade animal species and primer thereof |
| CN110079607A (en) * | 2019-04-04 | 2019-08-02 | 陕西师范大学 | A kind of primer sets, the method and application for detecting blood sample kind |
| CN110079607B (en) * | 2019-04-04 | 2022-08-02 | 陕西师范大学 | Primer group, method for detecting blood sample species and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104263821B (en) | 2016-03-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104046700B (en) | The detection kit of a kind of Rapid identification donkey hide, horse skin and mule skin | |
| CN105274099A (en) | Primers, probe composition and kit for rapid identification of nine animal origin ingredients in food or feed, detection method for identification of nine animal origin ingredients in food or feed and application of primers, probe composition, kit and detection method | |
| CN106048034B (en) | Animal-derived component forms in based on PCR-RLFP-DHPLC technology scanning analysis food | |
| CN109266772A (en) | The detection method of three kinds of pathogen real-time fluorescence quantitative PCRs of Citrus Huanglongbing pathogen | |
| CN104830970A (en) | Molecular ID and identification method of cordyceps sinensis | |
| CN103224989B (en) | Method for quickly detecting duck-derived components in food | |
| CN106544444A (en) | The dry powdered LAMP quick detection kits of streptococcus fecalis and its using method | |
| CN106755382A (en) | One group of specific primer and probe of the real-time PCR detection for being used for duck source property | |
| CN101845508B (en) | PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA | |
| KR101869832B1 (en) | A Novel Enterococcus species specific primer, a method for isolating and identifying specific Enterococcus strain by using the same and a composition therefor | |
| CN104263821B (en) | Old animal specimen Species estimation test kit and preparation method | |
| Sun et al. | Database and primer selections affect nematode community composition under different vegetations of Changbai Mountain | |
| CN110029172B (en) | Double PCR detection kit for equine and donkey-derived components | |
| CN106119390A (en) | A kind of based on MGB probe identification donkey skin, Corium Equi and the test kit of mule skin and detection method thereof | |
| CN110894532A (en) | RAA constant temperature fluorescence detection method and reagent for bacterial septicemia (FBS) | |
| CN106755304A (en) | A kind of method for identifying beef | |
| CN101020903B (en) | Left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application | |
| CN106929575A (en) | A kind of miniature DNA bar code and its discrimination method and application for differentiating red sandalwood and dyestuff red sandalwood | |
| CN106191279A (en) | A kind of method of the duck meat that differentiates to adulterate in Carnis caprae seu ovis | |
| CN102827931B (en) | Detection primer for detecting listeria monocytogenes by PCR-pyrophosphate method, kit and detection method | |
| CN104611454A (en) | Primer group for simultaneously detecting species components of blue fox, racoon dog and dog and application of primer group | |
| CN105002166A (en) | Molecular standard sample of brown cockroaches and preparation method of molecular standard sample | |
| CN105132540B (en) | The double PCR identification method of suspension culture of Aquilaria sinensis, primer and probe | |
| CN104894227A (en) | Quick detection reagent box for goat milk mixed with cow milk or soybean milk | |
| CN108796090A (en) | The kit and detection method of sheep material in a kind of detection food |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160323 Termination date: 20160915 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |