CN104263755A - A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism - Google Patents
A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism Download PDFInfo
- Publication number
- CN104263755A CN104263755A CN201410314564.2A CN201410314564A CN104263755A CN 104263755 A CN104263755 A CN 104263755A CN 201410314564 A CN201410314564 A CN 201410314564A CN 104263755 A CN104263755 A CN 104263755A
- Authority
- CN
- China
- Prior art keywords
- antibody
- aid
- cell strain
- cdr
- dna damage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000000034 method Methods 0.000 title claims abstract description 30
- 230000007246 mechanism Effects 0.000 title claims abstract description 8
- 230000005971 DNA damage repair Effects 0.000 title claims abstract description 7
- 238000001727 in vivo Methods 0.000 title abstract 2
- 210000004027 cell Anatomy 0.000 claims abstract description 20
- 230000035772 mutation Effects 0.000 claims abstract description 12
- 102000012698 DDB1 Human genes 0.000 claims abstract description 10
- 101150077768 ddb1 gene Proteins 0.000 claims abstract description 9
- 108010077544 Chromatin Proteins 0.000 claims abstract description 8
- 210000003483 chromatin Anatomy 0.000 claims abstract description 8
- 101100170004 Dictyostelium discoideum repE gene Proteins 0.000 claims abstract description 7
- 101100170005 Drosophila melanogaster pic gene Proteins 0.000 claims abstract description 7
- 108010041216 Sirtuin 2 Proteins 0.000 claims abstract description 7
- 102000000477 Sirtuin 2 Human genes 0.000 claims abstract description 7
- 230000008569 process Effects 0.000 claims abstract description 7
- 230000007115 recruitment Effects 0.000 claims abstract description 7
- 238000012216 screening Methods 0.000 claims abstract description 5
- 230000008859 change Effects 0.000 claims abstract description 4
- 238000007634 remodeling Methods 0.000 claims abstract 2
- 101150068874 SIRT2 gene Proteins 0.000 claims description 2
- 230000002018 overexpression Effects 0.000 abstract 3
- 230000002068 genetic effect Effects 0.000 abstract 1
- 239000013612 plasmid Substances 0.000 description 12
- 108090000623 proteins and genes Proteins 0.000 description 10
- 241000700605 Viruses Species 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 5
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 4
- 210000003719 b-lymphocyte Anatomy 0.000 description 4
- 239000005090 green fluorescent protein Substances 0.000 description 4
- 210000004408 hybridoma Anatomy 0.000 description 4
- 230000000392 somatic effect Effects 0.000 description 4
- 239000000126 substance Substances 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 3
- 239000000427 antigen Substances 0.000 description 3
- 102000036639 antigens Human genes 0.000 description 3
- 108091007433 antigens Proteins 0.000 description 3
- 230000003834 intracellular effect Effects 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 238000003752 polymerase chain reaction Methods 0.000 description 3
- 238000012797 qualification Methods 0.000 description 3
- 238000001890 transfection Methods 0.000 description 3
- 239000013598 vector Substances 0.000 description 3
- 108010005054 Deoxyribonuclease BamHI Proteins 0.000 description 2
- DHMQDGOQFOQNFH-UHFFFAOYSA-N Glycine Chemical compound NCC(O)=O DHMQDGOQFOQNFH-UHFFFAOYSA-N 0.000 description 2
- 230000009824 affinity maturation Effects 0.000 description 2
- 150000001413 amino acids Chemical group 0.000 description 2
- 238000000975 co-precipitation Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 230000006801 homologous recombination Effects 0.000 description 2
- 238000002744 homologous recombination Methods 0.000 description 2
- 238000004806 packaging method and process Methods 0.000 description 2
- 238000012856 packing Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012827 research and development Methods 0.000 description 2
- 238000003860 storage Methods 0.000 description 2
- 239000004471 Glycine Substances 0.000 description 1
- 108010043121 Green Fluorescent Proteins Proteins 0.000 description 1
- 102000004144 Green Fluorescent Proteins Human genes 0.000 description 1
- 101100170007 Mus musculus Ddb1 gene Proteins 0.000 description 1
- 101000755751 Mus musculus Single-stranded DNA cytosine deaminase Proteins 0.000 description 1
- 101100365819 Mus musculus Sirt2 gene Proteins 0.000 description 1
- 206010028980 Neoplasm Diseases 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000012408 PCR amplification Methods 0.000 description 1
- 206010041047 Slow virus infection Diseases 0.000 description 1
- 230000001133 acceleration Effects 0.000 description 1
- 230000004913 activation Effects 0.000 description 1
- 238000003314 affinity selection Methods 0.000 description 1
- 230000003321 amplification Effects 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000010171 animal model Methods 0.000 description 1
- 229940125644 antibody drug Drugs 0.000 description 1
- 230000007503 antigenic stimulation Effects 0.000 description 1
- 238000013459 approach Methods 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 229910000389 calcium phosphate Inorganic materials 0.000 description 1
- 239000001506 calcium phosphate Substances 0.000 description 1
- 235000011010 calcium phosphates Nutrition 0.000 description 1
- 201000011510 cancer Diseases 0.000 description 1
- 238000004113 cell culture Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 239000012141 concentrate Substances 0.000 description 1
- 229940021171 curative drug Drugs 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000003912 environmental pollution Methods 0.000 description 1
- 239000013604 expression vector Substances 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000001900 immune effect Effects 0.000 description 1
- 230000016784 immunoglobulin production Effects 0.000 description 1
- 230000007233 immunological mechanism Effects 0.000 description 1
- 238000009169 immunotherapy Methods 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 238000011031 large-scale manufacturing process Methods 0.000 description 1
- 108020004999 messenger RNA Proteins 0.000 description 1
- 238000002703 mutagenesis Methods 0.000 description 1
- 231100000350 mutagenesis Toxicity 0.000 description 1
- 231100000310 mutation rate increase Toxicity 0.000 description 1
- 238000003199 nucleic acid amplification method Methods 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 238000005457 optimization Methods 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 230000002265 prevention Effects 0.000 description 1
- 230000028327 secretion Effects 0.000 description 1
- 238000001228 spectrum Methods 0.000 description 1
- 239000006228 supernatant Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 230000001225 therapeutic effect Effects 0.000 description 1
- QORWJWZARLRLPR-UHFFFAOYSA-H tricalcium bis(phosphate) Chemical compound [Ca+2].[Ca+2].[Ca+2].[O-]P([O-])([O-])=O.[O-]P([O-])([O-])=O QORWJWZARLRLPR-UHFFFAOYSA-H 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism is provided. The method includes following two parts: overexpression of an AID mutant, and increasing of recruitment of AID in an antibody genetic locus, thus increasing the mutation rate in an antibody CDR zone. The overexpression of the AID mutant relates to overexpression of the AID mutant in the monoclonal cell strain to increase the mutation rate in the antibody CDR zone and to allow the mutation rate to be 10<-3> per generation. In addition, increasing of recruitment of the AID in a CDR locus relates to chromatin conformation change triggering by depending on chromatin remodeling elements (such as SIRT2 and DDB1). Recruitment of the AID to the CDR zone depends on chromatin conformation changes and certain specific changes can increase the f recruitment of the AID in the CDR locus, and therefore the mutation rate in the antibody CDR zone is further increased and reaches 10<-2> per generation, and the method can be used for high-affinity rapid screening processes.
Description
Technical field
The invention belongs to biological technical field, be specially a kind of DNA damage repair mechanism that utilizes and the novel method of tachytely in body is carried out to monoclonal cell strain.
Background technology
Monoclonal antibody (monoclonal antibody, mAb), is called for short monoclonal antibody, is only to be produced by the hybridoma after the immunocyte and cancer cells that can manufacture this antibody merge.This hybridoma is made Single cell culture, can monoclonal be formed, i.e. mono-clonal.Utilize the method for cultivation or mouse peritoneal inoculation, just can obtain a large amount of, high density, very homogeneous antibody, its structure, amino-acid sequence, specificity etc. are all consistent.Monoclonal antibody can be directly used in the research of the diagnosis of human diseases, prevention, treatment and immunologic mechanism, for the immunodiagnosis of human diseases and immunotherapy open bright prospects.
Monoclonal antibody has following several advantage compared with polyclonal antibody.1. hybridoma realizes external immortalization and continues to go down to posterity, and only otherwise the transgenation of cell strain occurs, just constantly can produce the antibody of high specific, high homogeneity.2., due to the homogeneity antibody of " endless " may be obtained, make antibody become possibility as medicine.3. standardized production can be realized, for taking traget antibody as the immunological analysis method of feature.4., due to high specific and the single creature function of monoclonal antibody, can be used for the wide spectrums such as curative drug, radio-immuno-image, the medical diagnosis reagent even detection of environmental pollution.Although the preparation of monoclonal antibody has various optimization in detail, technological frame is relative maturity.
The techniqueflow of the design and development of humanization/total man's resource monoclonal antibody comprise target spot select with verify, prepare for target spot monoclonal antibody, prepared by antibody screening, antibody cloning, antibody humanization, antibody Affinity maturation, people's antibody, Research of Animal Model for Study and clinical trial etc.At present, antibody drug is researched and developed a lot of aspect and also be there is larger development space.Wherein, the lifting of the characteristic such as affinity of antibody and specificity is that antibody research and development are the most key, be also the most easily meet with technical bottleneck step.
The generation mechanism of antibody library capacity mainly comprises combination diversity, junctional diversity and somatic hypermutation, and high-affinity antibody produces under somatic hypermutation and antigen selection.B cell occurs to produce somatic hypermutation in the process of division growth after identification antigen, and sudden change mainly concentrates on the complementary determining region (CDR) determining antibody and antigen avidity in weight, variable region of light chain.Therefore, somatic hypermutation can produce the antibody of high-affinity, and the B cell with high-affinity antibody can be bred by preferential activation under lower concentration antigenic stimulation, form the B cell predominant cell group of high-affinity gradually, secretion produces high-affinity antibody further.
Antibody library utilizes molecule clone technology amplification repertoire antibody weight, chain variable region gene, then be connected with specific expression vector, be transformed in host cell the antibody giving expression to function, and screened the specific antibody of high-affinity by methods such as affinity selection.In Antibody library experience body and external developmental stage, wherein common with phage antibody library technique in body, external with rrna and mRNA Antibody library the most common.The important step that antibody library method and technology are generated in body by analog antibody, as diversity B cell colony, clonal selection, affinity maturation etc., accelerate speed prepared by antibody, reduce production cost, prepare high-affinity specific antibody on a large scale provide easy and efficient operating system for quick screening from the antibody library of large storage capacity.But antibody library method and technology still exist problem demanding prompt solution at present, such as, in guarantee antibody library diversity with while presenting efficiency, how to improve the problem such as storage capacity and antibody production.And the variable region of light chain of antibody is for the stability of antibody, avidity is extremely important, this bottleneck just causing existing external antibody evolution techniques impassable.
Summary of the invention
For the problems referred to above, the invention discloses a kind of we have developed internal antibody evolution technology based on cell strain of monoclonal antibody.The method utilizes the recruitment situation in AID mutant and control Qi CDR district that the Mutation probability of variable region can be made to reach 10
-3-10
-2in/generation, may be used for high-affinity antibody rapid screening technique.
For achieving the above object, enforcement of the present invention adopts following scheme.
First on NCBI, the standard sequence of mouse AID, DDB1 and SIRT2 gene is determined in inquiry, then designs corresponding amplimer according to nucleotide sequence.These three genes are cloned into slow virus skeleton carrier by the method for homologous recombination.38 amino acids of AID gene are converted to glycine (AID mutant) by directed mutagenesis method.
Further according to three plasmid slow virus systems approaches, packaging obtains viral supernatants, carry out transfection again to obtain transfection respectively and enter Plv-AID, Plv-DDB1 and Plv-SIRT2 simple substance grain, the clone that Plv-DDB1 and Plv-SIRT2 double-mass model and three plasmid corotation five are stable.
Further carry out reversion acquisition CDNA by using the RNA of OMEGA company to extract RNA in the clone of test kit extraction Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 simple substance grain and three plasmid corotation.The changing conditions of antibody mutation rate in the clone of Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 simple substance grain and three plasmid corotation is checked in the method further with PCR.Determine that in the clone of three plasmid corotation, antibody mutation evolution rate is the highest.
Further by karyomit(e) co-precipitation (ChIP) experiment, checking DDB1, SIRT2 albumen directly can affect AID raising on antibody gene VDJ, and (Fig. 3, in 4, display can reach 10 therefore to bring out the further lifting of intracellular antibody mutation rate
-2/ generation).
Utilize the mutant of AID gene and DDB1, SIRT2 albumen on the impact of chromatin conformation in the present invention, genomic dna sequence level achieves the acceleration that intracellular antibody is evolved, and is a kind of invention of novelty.To the research and development of therapeutic antibodies and large-scale production significant.
Embodiment
By AID gene clone with homologous recombination method to lentiviral vectors (PLV-GFP).It is about 600 that enzyme cuts qualification Plv-AID plasmid (as shown in fig. 1) endonuclease bamhi size, conforms to expection.
The same, by DDB1 and SIRT2 gene clone to lentiviral vectors PLV-GFP.Enzyme is cut qualification Plv-DDB1 and Plv-SIRT2 plasmid (as shown in fig. 1) endonuclease bamhi size and is respectively 3500 and about 1100, conforms to expection.
By packaging plasmid PMD2G and the PsPAX2 calcium phosphate method cotransfection 293T cell in Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 plasmid and three plasmid slow virus systems, be packaged into corresponding slow virus after 72 hours, packing cell presents intense fluorescence (as shown in Figure 2) (GFP fluorescence picture).
By above three kinds of slow virus infection monoclonal cell strain VEGFR-E3, after one week, carry out following experiment: use the E.Z.N.A that OMEGA company produces
tMtotal RNA Kit II (R6934-02) extracts RNA in the cell line cell of Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 simple substance grain and three plasmid corotation, obtain cDNA after reversion, with universal primer GCTAGTGAGCTCTTTGCCCAG and AAAAAAAAAAAAAAAAAAAAA polymerase chain reaction,PCR amplification (PCR) carried out to V1, V2, V3 district and check order; Result shows, and when this three kinds of genes of process LAN, antibody CDR region sequence mutation rate improves 3-12 doubly; Under three kinds of common process LAN conditions of gene, mutation rate more rises to 10
2doubly (as shown in Figure 3).
Carry out chromatin immune co-precipitation with AID antibody, measure the ability to the recruitment of CDR (CDR3) Chromatin domains in the VEGFR-E3 monoclonal cell strain that AID albumen infects at Plv-DDB1 and Plv-SIRT2.When result display process LAN DDB1 and SIRT2, the ability that AID recruits to antibody gene CDR (CDR3) region improves about 3 times (as shown in Figure 4).
Accompanying drawing illustrates:
Fig. 1 is that lentiviral vectors Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 enzyme cuts qualification figure.
Fig. 2 is expressing green fluorescent protein figure after Plv-AID mutant, Plv-DDB1 and Plv-SIRT2 plasmid transfection packing cell.
Fig. 3 is that after hybridoma monoclonal cell strain (VEGFR-E3) infects DDB1, SIRT2 and AID mutant slow virus, intracellular antibody CDR site mutation rate increases figure.
Fig. 4 is that ChIP experimental verification DDB1 and SIRT2 albumen can improve the enrichment figure of AID in antibody gene CDR district.
Claims (3)
1. utilize DNA damage repair mechanism to make cell strain of monoclonal antibody carry out a novel method for internal antibody tachytely, it is characterized in that: process LAN AID mutant and improve AID and raise the mutation rate that can improve antibody VDJ region in VDJ site, reach 10
-3-10
-2in/generation, may be used for high-affinity antibody rapid screening technique.
2. a kind of DNA damage repair mechanism that utilizes according to claim 1 makes cell strain of monoclonal antibody carry out the novel method of internal antibody tachytely, it is characterized in that: AID depends on the change of chromatin conformation to the recruitment in CDR region, some chromatin remodeling factors (as SIRT2 and DDB1) can improve AID raising in CDR site, and this change can improve the Mutation probability of antibody variable region further.
3. a kind of DNA damage repair mechanism that utilizes according to claim 1 makes cell strain of monoclonal antibody carry out the novel method of internal antibody tachytely, it is characterized in that: process LAN AID mutant, DDB1 and SIRT2 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314564.2A CN104263755B (en) | 2014-07-03 | 2014-07-03 | A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410314564.2A CN104263755B (en) | 2014-07-03 | 2014-07-03 | A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104263755A true CN104263755A (en) | 2015-01-07 |
| CN104263755B CN104263755B (en) | 2017-02-15 |
Family
ID=52155333
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410314564.2A Expired - Fee Related CN104263755B (en) | 2014-07-03 | 2014-07-03 | A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263755B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102482639A (en) * | 2009-04-03 | 2012-05-30 | 医学研究会 | Mutants of activation-induced cytidine deaminase (aid) and methods of use |
-
2014
- 2014-07-03 CN CN201410314564.2A patent/CN104263755B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102482639A (en) * | 2009-04-03 | 2012-05-30 | 医学研究会 | Mutants of activation-induced cytidine deaminase (aid) and methods of use |
Non-Patent Citations (2)
| Title |
|---|
| 于礼 等: ""基因工程抗体亲和力成熟研究进展"", 《中国医药生物技术》 * |
| 胡晓林 等: ""基因工程抗体亲和力成熟的策略"", 《免疫学杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104263755B (en) | 2017-02-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20200247908A1 (en) | Generation of binding molecules | |
| Leggat et al. | Vaccination induces HIV broadly neutralizing antibody precursors in humans | |
| Abbott et al. | Precursor frequency and affinity determine B cell competitive fitness in germinal centers, tested with germline-targeting HIV vaccine immunogens | |
| Mishra et al. | Insights into the structural basis of antibody affinity maturation from next-generation sequencing | |
| Wang et al. | Multiplexed CRISPR/CAS9‐mediated engineering of pre‐clinical mouse models bearing native human B cell receptors | |
| RU2016109443A (en) | MOUSE ADAM6 | |
| CN106220736A (en) | A kind of Chimeric antigen receptor, the cell expressing it and its production and use | |
| EP3770261B1 (en) | Nucleic acid molecule and application thereof in preparing human single-domain antibody | |
| Saunders et al. | Vaccine induction of CD4-mimicking HIV-1 broadly neutralizing antibody precursors in macaques | |
| Xie et al. | mRNA-LNP HIV-1 trimer boosters elicit precursors to broad neutralizing antibodies | |
| Teng et al. | SARS-CoV-2 spike-reactive naïve B cells and pre-existing memory B cells contribute to antibody responses in unexposed individuals after vaccination | |
| CN110438128A (en) | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene | |
| CN107987159B (en) | Method for improving antibody titer in serum by immunizing animal with high-dose DNA immunization technology | |
| CN107427581A (en) | The change method of T cell group | |
| CN107367611A (en) | The ELISA detection kit of epidermal growth factor acceptor third type mutant | |
| US20110224094A1 (en) | Method for identifying and selecting drug candidates for combinatorial drug products | |
| CN104263755A (en) | A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism | |
| CN105859878A (en) | Preparation method of anti-HPV infection antibody | |
| CN105849564A (en) | Proteins targeting orthologs | |
| CN105132376A (en) | Monoclonal antibody capable of specific identification of multiple antigen epitopes of HBsAg and application thereof | |
| CN108456682A (en) | A kind of screening technique of monoclonal antibody and its application | |
| WO2023232110A1 (en) | Anti-human cd24 antibody and use thereof | |
| CN102212135A (en) | Anti-vascular endothelial growth factor monoclonal antibody and application thereof | |
| CN117586396A (en) | TIGIT antibodies, methods of preparation and use thereof | |
| CN109679916A (en) | A kind of LFF1 cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180202 Address after: 611730 Sichuan city of Chengdu province PI Du Deyuan town (Jing Rong town) Yu Road No. 66 1 7 floor No. 83 Patentee after: CHENGDU JINUOMAIER BIO-TECH CO.,LTD. Address before: 1, No. 1480, 610041 north section of Tianfu Road, Chengdu high tech Zone, Sichuan Patentee before: CHENGDU ZHONGLIAN SHENGKE GENE TECHNOLOGY Co.,Ltd. |
|
| TR01 | Transfer of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170215 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |