CN108456682A - A kind of screening technique of monoclonal antibody and its application - Google Patents
A kind of screening technique of monoclonal antibody and its application Download PDFInfo
- Publication number
- CN108456682A CN108456682A CN201710085557.3A CN201710085557A CN108456682A CN 108456682 A CN108456682 A CN 108456682A CN 201710085557 A CN201710085557 A CN 201710085557A CN 108456682 A CN108456682 A CN 108456682A
- Authority
- CN
- China
- Prior art keywords
- light chain
- heavy chain
- antibody
- expression
- screening
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Abstract
The invention discloses a kind of screening techniques with monoclonal antibody of the purpose antigen with high-affinity, including：（1）Mixing screening, m heavy chain of antibody expression vector and n antibody light chain expression vector mixing carry out external antibody expression, and ELISA identifies to obtain positive combination；（2）Screening is split, if（1）The number of heavy chain and light chain is all higher than 1 in obtained positive combination, is first matched according to the principle of 1 heavy chain and a plurality of light chain and/or 1 light chain and a plurality of heavy chain, carries out external antibody expression, identify to obtain positive combination using ELISA；（3）Heavy chain and light chain during the positive is combined are split, and are matched according to the principle of 1 heavy chain and 1 light chain, and external antibody expression is carried out, and the combinations of pairs of ELISA tests positives is that can generate weight/light chain combination of functional monoclonal antibody.The screening technique of the present invention is simple and efficient, is practical, and the monoclonal antibody for screening acquisition has specificity and higher compatibility.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of screening technique of monoclonal antibody and its application.
Background technology
After antibody refers to antigenic stimulus body, caused by bone-marrow-derived lymphocyte or thick liquid cell, can occur with corresponding antigens it is special
The immunoglobulin that the opposite sex combines.Wherein, by single B cell clone generate height it is uniform, only identify a certain specific antigen table
The antibody of position, referred to as monoclonal antibody, abbreviation monoclonal antibody.It has many advantages, such as that high specificity, purity are high, homogeneity is good.The first generation
Monoclonal antibody was prepared by Kohler and Milstein in 1975, it is derived from the anti-sheep red blood cell (SRBC) of mouse B cell hybridoma
Monoclonal antibody.Nowadays, with the continuous development of monoclonal antibody technology of preparing and perfect, monoclonal antibody is in medicine, life
A variety of subjects such as object, immunology and field are widely used, while also for the research of biological molecule mechanism
Play prodigious impetus.In recent years, with the continuous deepening of research, more and more monoclonal antibody drugs are exploited
And it applied to treatment tumour, viral infection, cardiovascular disease and Other diseases, is especially shown in immunotherapy of tumors
Good foreground.
Although the acquisition of monoclonal antibody allows it is found that new field, its application clinically but experienced
Very long process, main cause are that the antibody that traditional hybridoma technology is produced is mouse, and mouse source monoclonal antibody is in disease
There are problems in treatment, such as：Mouse source monoclonal antibody in human body usually cannot effective activating complement and the relevant effect of Fc receptors
Answer system；It is easily identified by human immune system, generates human anti-mouse antibody reaction；And it is easy in human recycle system clear
It removes.With the continuous deepening of research, and such as chimeric antibody is produced, phage display technology is shown as the external display technique represented, single
Cell clone technology, the B cell immortality technology that Epstein-Barr virus mediates, protein spectrum analysis combine DNA high throughput sequencing technologies etc.
Monoclonal antibody technology of preparing, these technologies realize humanization on the basis of retaining the high-affinity to specific antigen epitope
Transformation, greatly reduces the immunogenicity of heterologous antibody, but there is also disadvantages for these technologies, for example monoclonal antibody yield is not
Stablize, is easy to lose.The antibody that external display technique is also required to longer period and generation identical as hybridoma antibody is both needed to
Subsequently to carry out humanization etc..
Two generation sequencing technologies (NGS) are that expense developed in recent years is low, flux is high, fireballing DNA sequencing skills
Art.Meanwhile this emerging technical field has been developed as excavating a kind of important means of functional antibodies, with its hair
Exhibition, antibody group research experienced to be changed from small throughput to the high-throughput epoch so that Antibody library is also led in antibody engineering
Domain makes substantial progress, and a two generations sequencing can be obtained the antibody CDR3 sequences of millions of B cells, by comparing
The frequency of CDR3 sequences in immune front and back host antibodies gene profile discloses specific anti-in antibody gene spectrum under specific immune state
The variation of body abundance selects the maximum CDR3 sequences of frequency variation and chooses full length sequence, the candidate sequence as specific antibody
Pairing expression in vitro carries out functional verification.This method is that people illustrate broader antibody spectral property, and unlimited species, can
To generate a large amount of candidate pairing from antibody gene spectrum in a short time, just it is likely to be obtained with height eventually by functional verification
The antibody of affinity.
The application of sequencing of two generations makes Antibody library be rapidly developed, and is widely used for research antibody gene spectrum group
At diversity, by high-flux sequence, we can obtain the sequence of numerous heavy chains and light chain, how in numerous sequences
It is always a problem to be quickly found out the heavy chain for having affinity with antigen and light chain pairing.Traditional method is that structure is heavy respectively
The expression vector of chain and light chain, the principle then combined according to single heavy chain and single light chain, carries out expression and functionality is tested
Card.Although having some superiority for the cell clone for obtaining high level expression using traditional screening system, it is but deposited
Time-consuming, heavy workload and the shortcomings of be difficult to be screened on a large scale, therefore find a kind of antibody screening mode of high throughput
It is particularly important.
Invention content
In view of the deficiencies of the prior art and actual demand, there is high-affinity with purpose antigen the present invention provides a kind of
It is anti-to rapidly find out the purpose that can create antagonism in a large amount of sequences that this method can be obtained from NGS for the screening technique of monoclonal antibody
The heavy chain and light chain combinations of pairs of former monoclonal antibody, to obtain a large amount of high yields, the recombinant antibodies albumen of high specific,
It is time saving and energy saving, working efficiency can be significantly improved.
The technical problem to be solved in the present invention is achieved by the following technical programs：
（1）Antibody library is built, and high-flux sequence is carried out to the antibody library；
（2）The antibody variable gene obtained for purpose antigen is composed；
（3）CDR3 sequences and corresponding heavy chain and light chain antibody nucleic acid sequence are chosen from antibody variable gene spectrum as candidate
Matched sequence；
（4）Heavy chain and light chain expression vector are built respectively, and suitable cell transfection technique and expression system are utilized after mixing pairing
Antibody expression is carried out, Activity determination is carried out to expression product, obtains positive combination；
（5）Heavy chain and light chain during the positive is combined are split, and are matched according to the principle of 1 heavy chain and 1 light chain, are utilized conjunction
Suitable cell transfection technique and expression system carry out antibody expression, and Activity determination is carried out to expression product, obtained positive combination
As there is with purpose antigen the monoclonal antibody of high-affinity.
As optimal technical scheme, step（1）Middle structure antibody library comprises the following steps：
（a）Take at least one purpose antigen that linked groups or the cell of host subject is immunized；
（b）Total RNA are detached from the tissue or cell taken；
（c）With oligo（dT）As primer, with step（b）In total serum IgE as template, reverse transcription synthesizes cDNA；
（d）With step（c）CDNA obtained is template, and the structure of antibody library is carried out based on PCR.
Preferably, the program of the PCR amplification in the banking process is：
1. 95 DEG C of heat preservation 2min；
② 95℃ 30sec, Tm 55℃ 30sec, 72℃ 30sec；15-35 cycle
③ 72℃ 7min；
4. 4 DEG C of preservations.
Preferably, library method step is built（a）Described in immune host can be mammal, amphibian animal, fish or bird
In any one or at least two combination.Wherein, the mammal is the mankind, mouse, primate, rabbit, goat, sheep
One kind in pig or at least two combination.
Preferably, banking process step（a）Described in peripheral blood of the cell from immune host, lymphoid organ, spleen,
In marrow or liver any one or at least two combination.Wherein, the cell include memory B cell, thick liquid cell or
In plasmablast any one or at least two combination.
As optimal technical scheme, step（1）Described in high-flux sequence method can be while synthesis while be sequenced, side connect
While sequencing while hybridize side sequencing, single-molecule DNA sequencing, poly synthase group be sequenced or nano-pore sequencing in any one or
Several combinations, preferred technical solution are sequenced for 2 × 300 systems of Illumina Miseq.Although antibody gene variable region sequences
It is longer, basically reach Illumina sequencing the upper limit, but with other high-flux sequence methods such as 454 method ratios of Roche
There is high accuracy compared with, 2 × 300 systems of Illumina Miseq, flux height and the advantages such as at low cost, with three generations's sequencing approach
Compare, although reading do not have advantage on long, Illumina systems flux be sequenced it is with the obvious advantage in cost.
As optimal technical scheme, step（2）Using immune group library bioinformatic analysis, obtain anti-for surveyed purpose
The variable region gene spectrum of former antibody.
As optimal technical scheme, step（3）CDR3 sequences and corresponding heavy chain are chosen from antibody variable gene spectrum
With light chain antibody nucleic acid sequence as candidate matched sequence, specific method is：
（a’）The result of the Read1 and Read2 of high-flux sequence are analyzed, the homologous clusters of candidate CDR3 are picked out.
（b’）The homologous clusters of the CDR3 are anchored, the antibody weight for including the homologous clusters of this CDR3 is selected in antibody variable gene spectrum
Chain or the nucleotide sequence of light chain variable region overall length are as pairing candidate sequence；
Preferably, step（b’）The heavy chain of antibody or light chain variable region overall length core selected comprising this homologous cluster of candidate CDR3
Nucleotide sequence includes the following steps：From antibody variable gene spectrum in selection comprising the homologous clusters of the CDR3 all Read1 and
Read2 carries out antibody database comparison, obtains the amino acid sequence of CDR region and the areas FR；Splice the survey of Read1 and Read2 simultaneously
Sequence determines the amino acid sequence of the CDR region and the areas FR of high frequency as a result, by all splicing sequence progress antibody database comparisons；Than
Compared with CDR the and FR region amino acid sequences obtained with two sources of merging, it is complete to obtain the corresponding antibody variable region of the homologous clusters of the CDR3
Long amino acid sequence is as candidate matched sequence.Corresponding variable region overall length nucleosides is selected in Read1 and Read2 splicing sequences
Acid sequence.
Preferably, it is described select the principle of candidate CDR3 for：High frequency series after CDR3 clusters, select it is immune after or outburst
Phase is than before immune or the corresponding V gene families of CDR3 sequences or CDR3 that convalescence frequency is obviously improved are after immune or the outbreak period
Than before immune or convalescence have in the sequence of notable difference any one or at least two combination.
As optimal technical scheme, step（4）Described in heavy chain and light chain expression vector construction method can be that digestion connects
It connects, one or more of the methods of homologous recombination.The further preferred technical solution of the present invention is homologous recombination method.This method
Reaction time is short, and step is simple, can realize that the same carrier overcomes conventional method to the clone of multiple genes and every time can only
Clone the defect of a segment.
As optimal technical scheme, step（4）The mixing matching method includes following screening step：
（a）The heavy chain expression vector that will be built carries out mixed in equal amounts per m items；
（b）The light chain expression vector that will be built carries out mixed in equal amounts per n items；
（c）Step（I）In heavy chain mixture respectively with step（II）In light chain mixture pairing；
Wherein m, n take the integer more than or equal to 1.
Preferably, step（4）Described in the combination of heavy chain and light chain can select following matching method as required
In one or several kinds of combinations, matching method has：Heavy chain mixture and light chain mixture match, heavy chain mixture with it is single light
Chain matches and light chain mixture is matched with single heavy chain.
Preferably, step（4）Described in heavy chain and light chain expression vector hybrid mode be, heavy chain expression vector and light chain
Expression vector is mixed according to certain mass ratio, and mixed proportion is accordingly adjusted according to the blended sliver number of heavy chain and light chain
It is whole.Currently preferred heavy chain and light chain ratio are 1：1.
It is further preferred that step（5）Middle heavy chain and light chain by positive combine is split, if in Antigen positive hybridomas combination
The number of heavy chain and light chain is all higher than 1, first matches according to the principle of 1 heavy chain and a plurality of light chain and/or 1 light chain and a plurality of heavy chain
It is right, antibody expression is carried out using suitable cell transfection technique and expression system, to expression product progress Activity determination, then will
To positive combination in heavy chain and light chain split, according to the principle pairing of 1 heavy chain and 1 light chain, using suitable
Cell transfection technique and expression system carry out antibody expression, and Activity determination is carried out to expression product, and obtained positive combination is
There is the monoclonal antibody of high-affinity with purpose antigen.
Preferably, step（4）-（5）The cell transfection technique that middle antibody expression is used can be DEAE- glucans method, phosphorus
Sour calcium method, cationic-liposome method, cationic polymer method, microinjection, particle bombardment and electroporation, it is further excellent
The technical solution of choosing is cationic polymer method.This method host range is wide, easy to operate, the cytotoxicity of transfection composite compared with
It is low, it is more advantageous to cellular localization, splendid transfection efficiency can be obtained.
Preferably, step（4）-（5）Described in expression system can be escherichia expression system, Yeast expression system
Any one in system, insect expression system and mammalian expression systems or several combinations.
Preferably, step（4）-（5）Described in the method for Activity determination can be arbitrary in ELISA, IF, PHA and RIA
One or several kinds combination, further preferred technical method are ELISA method.This method is easy to operate, and sensitivity is very high, can be with
Antibody is quantified in microgram even nanogram levels, and high specificity, has been widely used in the sieve of monoclonal antibody
Choosing and identification.
Compared with prior art, the present invention has the advantages that：The present invention provides a kind of efficient antibody screenings
Method, it is proposed that two step screening strategy of antibody first carries out nixing sieve choosing removal and the uncombined antibody combination of purpose antigen, then passes through
Fractionation screening is crossed, the heavy chain that can generate functional monoclonal antibody and light chain combinations of pairs are eventually found.This method breaks tradition
A heavy chain and the pairing expression of light chain way, combination is flexible and changeable, simple and efficient, time saving and energy saving, and cost
Cheap, sensitivity is high, lays a good foundation for the excavation of lot of antibodies.
Description of the drawings
Fig. 1 is the screening technique work for the monoclonal antibody that a kind of and purpose antigen that the present invention optimizes has high-affinity
Flow diagram；
Fig. 2 is the screening step schematic diagram for the monoclonal antibody that the present invention optimizes；
Heavy chain mixture matches ELISA testing results with light chain mixture in Fig. 3 case study on implementation 1 of the present invention；
Weight (light) chain mixture matches ELISA testing results with single light (weight) chain in Fig. 4 case study on implementation 1 of the present invention；
Single heavy chain and single light chain mixing ELISA testing results in Fig. 5 case study on implementation 1 of the present invention；
Positive weight (light) chain matches ELISA testing results with light (weight) chain in Fig. 6 case study on implementation 2 of the present invention；
Various combination ELISA testing results in Fig. 7 case study on implementation 2 of the present invention.
Specific implementation mode
In order to make technical scheme of the present invention and advantage be more clearly understood, with reference to embodiments, the present invention is carried out
It is further described, but the present invention is not limited in scope of embodiments.The experiment side of actual conditions is not specified in embodiment
Method is operated usually according to conventional conditions or according to the manufacturer's recommendations.
Embodiment 1 excavates HBV monoclonal antibodies using the antibody screening method of optimization
The peripheral blood of injection HBV vaccine volunteers is extracted, before blood sampling point is set as immune and after 7 days immune.Using density level bands
Spend centrifugal process separating periphery blood monocytic cell（PBMC）.Total serum IgE is detached from PBMC using Trizol methods, specific steps are shown in
Invitrogen Trizol Reagent.It is template to take 800ng RNA, and oligo (dT) carries out the first chain cDNA's as primer
Synthesis, 5 '/3 ' Kit specifications of concrete operations reference reagent box SMARTer RACE carry out.Specific primer sequence is as follows：
1 heavy chain of antibody of table（VH）, Kappa chains（VK）With Lambda chains（VL）Variable region primers extension increasing sequence table
| Primer | Sequence | Remarks |
| Forward Primer | AAGCAGTGGTATCAACGCAGAGTA | It quotes from 5 '/3 ' Kit of Clontech SMARTer RACE |
| Reverse Primer1 | GGAAGACCGATGGGCCCTTGGTGG | Heavy chain IgG reverse primers |
| Reverse Primer2 | GCAGGCACACAACAGAGGCAGTTCCAG | Kappa reverse primers |
| Reverse Primer3 | CACACCAGTGTGGCCTTGTTGGCTT | Lambda reverse primers |
2 PCR reaction systems of table
3 PCR reaction conditions of table
PCR product uses magnetic beads for purifying.
PCR product after purification carries out library according to NEBNext Ultra II DNA Library Prep Kit
Structure.After the completion of library construction, QC is carried out using Bioanalyzer High Sensitivity DNA chip, is utilized
Structure library is sequenced in 2 × 300 microarray datasets of Illumina Miseq.
Sequencing result is analyzed, the type and frequency of all CDR3 in heavy chain and light chain library is obtained.Due to the areas CDR3
The variation of amino acid is to cause the major reason of antibody diversity, its corresponding CDR3 sequence of different antibodies is also different, therefore can
Its abundance in antibody variable gene spectrum is assessed with the quantity according to the CDR3 sequences obtained.Then to heavy chain and light chain
CDR3 carries out clustering, and the principle of cluster is that CDR3 length amino acid sequences are identical, shares V genes and J genes and amino
Difference between acid is in particular range（General heavy chain similitude is set in 90% or more, light chain similitude be set in 80% with
On）.By the way that preceding and immune rear Data Synchronization Analysis is immunized, frequency changes more apparent CDR3 sequences and makees after selection clusters
For the candidate CDR3 sequences of pairing.
HBV volunteer is shown in Table 4,5 and 6 in immune front and back heavy chain and the variation of light chain CDR3 frequencies, the results show that with it is immune before
It compares, apparent rising occur in CDR3 sequences ranking and frequency after immune, indicate that it may be related to specific antigen.
Heavy chain CDR3 frequency analyses after 4 HBV volunteer of table is immune preceding and immune
| Heavy chain is numbered | Heavy chain CDR3 sequences | Frequency (%) before immune | Frequency (%) after immune |
| H1 | ARCRGDSNYGWYDP | 0.61% | 1.00% |
| H2 | ARDGKRTYSYDRGEDY | 0.63% | 1.15% |
| H3 | ARETAYKDSSGWYVYWYFDL | 0.64% | 1.34% |
| H4 | ARGAGGYDASAYWTNWFDP | 1.47% | 8.62% |
| H5 | ARIPMRRTGVNDDAFDM | 0.89% | 5.36% |
| H6 | ARQTAFKDSTGWYVYWFFDL | 0.11% | 1.34% |
Kappa chain CDR3 frequency analyses after 5 HBV volunteer of table is immune preceding and immune
| Kappa chains are numbered | Kappa chain CDR3 sequences | Frequency (%) before immune | Frequency (%) after immune |
| K1 | HQRSDWPPFT | 0.79% | 1.36% |
| K2 | QQFNQYPIT | 0.08% | 1.95% |
| K3 | QQHYIIPWT | 0.62% | 2.66% |
| K4 | QQLSSYPLT | 0.04% | 0.86% |
| K5 | QQSYSTPYT | 0.56% | 2.07% |
| K6 | QQTNNWPPA | 0.19% | 2.19% |
| K7 | QQYGSSPWT | 0.23% | 1.46% |
| K8 | QQYNNWPLWT | 1.06% | 2.77% |
| K9 | QQYNSYPIT | 2.09% | 7.99% |
| K10 | QHFNSYPRGFT | 0.01% | 1.7% |
| K11 | QHFKSYPRGFT | 0.01% | 0.74% |
Lambda chain CDR3 frequency analyses after 6 HBV volunteer of table is immune preceding and immune
| Lambda chains are numbered | Lambda chain CDR3 sequences | Frequency (%) before immune | Frequency (%) after immune |
| L1 | CSYAGSSTYV | 0.37% | 1.61% |
| L2 | GTWDRSLSAGV | 1.23% | 3.02% |
| L3 | ISYAGNSRGV | 0.99% | 1.73% |
| L4 | QTWGPGIQV | 0.48% | 1.79% |
| L5 | QVWDSSSDHVV | 0.28% | 1.91% |
| L6 | SSYAGTNTLV | 1.63% | 13.97% |
| L7 | AAWDDSLNGWV | 0.02% | 1.70% |
Candidate's CDR3 sequences are anchored, by all Read2 comprising the homologous clusters of the CDR3 and corresponding Read1 respectively in antibody number
According to being compared in library, the CDR region for including is obtained（CDR1,CDR2,CDR3）With the areas FR（FR1, FR2, FR3 and FR4）Amino
Acid sequence.Parallelly, splice R1 and R2 sequencing results, each domain amino acid is determined with spliced sequence operation IgBlast
And nucleotide sequence, and obtain variable region full length sequence.The full length sequence that will be singled out carries out gene chemical synthesis, according to homologous recombination
Principle carry out expression vector structure.
Heavy chain of antibody and light chain expression vector that structure is completed are combined pairing, the specific steps are：Every 3 heavy chain tables
Mixed in equal amounts is carried out up to carrier, the single heavy chain expression vector usage amount in each heavy chain combinations is 200ng, and carrier total amount is
600ng, every 3 light chain expression vectors carry out mixed in equal amounts, and the single light chain expression vector usage amount in each light chain combination is
200ng, carrier total amount are 600ng, and heavy chain mixture is matched and is uniformly mixed with every group of light chain mixture respectively.
Above-mentioned pairing mixture is transfected into 293T cells, carries out vivoexpression, specific implementation step is：Day before transfection pancreas
Enzymic digestion 293T cells, and count；It then seeds cells into 48 orifice plates, is about 6X10 per hole inoculating cell number4, 37 DEG C,
5% CO2 incubators can be transfected after 12h is cultivated when cell confluency degree reaches 70%-80%.After the completion of transfection 72h into
The collection of row cell conditioned medium, and carry out ELISA detections.
A wheel mixing screening is carried out, carries out antibody function analysis using ELISA method, specific implementation step is as follows：First will
Anti- human IgG (Fc) and detection antigen（HBsAg）Respectively 10 ug/mL, 96 holes are diluted to 9.6 carbonic acid coating buffers of pH
ELISA Plate 100 μ L of coating per hole, are stayed overnight by 4 DEG C；Or 37 DEG C, 2 hours；Then with 4% skimmed milk power-PBS closings, 300 μ
The holes L/, 37 DEG C are handled 1 ~ 2 hour.Liquid in enzyme mark hole is abandoned, 48 hours culture supernatants of transfection are added after washing three times with PBST
100 holes μ l/, 37 DEG C are handled 1 hour, set culture medium and PBS control.Liquid in enzyme mark hole is abandoned, is washed three times with PBST,
It is separately added into HRP goat anti-human iggs（Fc）, 1:10000；With HRP goat anti-human iggs, 1:10000；100 holes μ L/, 37 DEG C of processing 1
hr.Liquid in enzyme mark hole is abandoned, is washed five times with PBST, OPD developing solutions are added, 50 holes μ L/ are protected from light colour developing；Microplate reader is read
OD450 wavelength absorption values.ELISA results are shown in Fig. 3.
6 groups of mixtures of above-mentioned pairing are having two groups of mixture testing results to be positive after a wheel screening, i.e. group
It closes（H1+H2+H3）/（K10+K11+L7）And（H4+H5+H6）/（K10+K11+L7）.Then, it is mixed to carry out pairing again for we
Merge and carry out functional detection, wherein pair principle is：Single heavy chain and 3 light chain mixtures carry out pairing and single light chain
It is matched with 3 heavy chain mixtures.External antibody expression and functional detecting step after the completion of pairing are same as above, ELISA knots
Fruit sees Fig. 4.
According to Fig. 4 results it is found that thering are 6 groups of pairing testing results to be positive, they are H3/（K10+K11+L7）、（H1+H2+
H3）/K10、（H1+H2+H3）/K11、H6/（K10+K11+L7）、（H4+H5+H6）/ K10 and（H4+H5+H6）/K11.Then,
It carries out wheel eventually and splits screening, by the weight in 3 positive combinations（Gently）Chain and each in combining are light（Weight）Chain individually mixes
Pairing.External antibody expression and functional detecting step after the completion of pairing are same as above, and ELISA results are shown in Fig. 5.It is sieved by epicycle
Choosing, we obtain to generate functional monoclonal antibody heavy chain and light chain combinations of pairs H3/K10, H3/K11, H6/K10 and
H6/K11。
If being detected with a light chain pair principle according to a traditional heavy chain, wants to reach and filter out monoclonal antibody
The screening number of combinations that purpose is attempted is 108, and according to the method for the present invention, the number for screening number of combinations is reduced to 38
It is secondary, greatly reduce workload.We also demonstrate simultaneously, are negative combination for a wheel ELISA results, therein arbitrary
Heavy chain and light chain carry out one-to-one pairing and are all beyond expression out functional antibodies, see Fig. 5.Therefore, in routine experiment, for
The combination that one wheel screening is negative can directly be given up, it is not necessary to enter follow-up screening process.
Embodiment 2 verifies the sensitivity of antibody screening method using known zika virus positive antibody
In embodiment 1, heavy chain expression vector and light chain expression vector are all every 3 and are mixed, and this hybrid mode is applicable in
In the less situation of sequence.The it is proposed of the implementation case is directed to when the sequence that the standard selected according to sequence obtains is more,
Mixing screening can be carried out by increasing the blended sliver number of heavy chain and light chain expression vector, while this hair is proved using reverse thinking
The sensitivity of bright method.Specific implementation method is as follows：
7 heavy chain expression vectors and 7 are selected in many heavy chains and light chain expression vector from zika virus the infected's sample
Light chain expression vector.Among these, an only heavy chain expression vector（It is named as Hp1）With a light chain expression vector（Name
For Lp1）Functional antibodies can be given expression to, the heavy chain in positive combination（Light chain）With other light chains（Heavy chain）Pairing expression
It is feminine gender（Fig. 6）.Remaining heavy chain expression vector is respectively designated as Hn1-Hn6, light chain expression vector is respectively designated as
Ln1-Ln6.Heavy chain and light chain are mixed according to 7 mode of table, vivoexpression and antibody are carried out according to the method in embodiment 1
Functional verification, ELISA results are shown in Fig. 7.
7 zika virus heavy chain of table and light chain combination
| Combination | Heavy chain | Light chain |
| 1 | Hp1 | Lp1/Ln1/ Ln2/ Ln3/ Ln4/ Ln5/ Ln6 |
| 2 | Hp1 | Lp1/Ln1/ Ln2/ Ln3/ Ln4/ Ln5 |
| 3 | Hp1 | Lp1/Ln1/ Ln2/ Ln3/ Ln4 |
| 4 | Hp1 | Lp1/Ln1/ Ln2/ Ln3 |
| 5 | Hp1 | Lp1/Ln1/ Ln2 |
| 6 | Hp1 | Lp1/Ln1 |
| 7 | Hp1 | Lp1 |
| 8 | Hp1/Hn1/ Hn2/ Hn3/ Hn4/ Hn5/ Hn6 | Lp1 |
| 9 | Hp1/Hn1/ Hn2/ Hn3/ Hn4/ Hn5 | Lp1 |
| 10 | Hp1/Hn1/ Hn2/ Hn3/ Hn4 | Lp1 |
| 11 | Hp1/Hn1/ Hn2/ Hn3 | Lp1 |
| 12 | Hp1/Hn1/ Hn2 | Lp1 |
| 13 | Hp1/Hn1 | Lp1 |
| 14 | Hp1/Hn1 | Lp1/Ln1 |
| 15 | Hp1/Hn1/ Hn2 | Lp1/Ln1/ Ln2 |
| 16 | Hp1/Hn1/ Hn2/ Hn3 | Lp1/Ln1/ Ln2/ Ln3 |
| 17 | Hp1/Hn1/ Hn2/ Hn3/ Hn4 | Lp1/Ln1/ Ln2/ Ln3/ Ln4 |
| 18 | Hp1/Hn1/ Hn2/ Hn3/ Hn4/ Hn5 | Lp1/Ln1/ Ln2/ Ln3/ Ln4/ Ln5 |
| 19 | Hp1/Hn1/ Hn2/ Hn3/ Hn4/ Hn5/ Hn6 | Lp1/Ln1/ Ln2/ Ln3/ Ln4/ Ln5/ Ln6 |
ELISA results such as Fig. 7 is shown, is even mixed simultaneously with 6 negative heavy chains and 6 negative light chains（See combination 19）, inspection
It surveys result and is still positive, this is enough the sensitivity for finding out the method for the present invention.Therefore select sequence it is more when, increasing can be passed through
The method of blended sliver number is added to achieve the purpose that quick screening function monoclonal antibody.
Applicant states that the present invention illustrates the method detailed of the present invention, but the present invention not office by above-described embodiment
It is limited to above-mentioned method detailed, that is, does not mean that the present invention has to rely on above-mentioned method detailed and could implement.Technical field
Technical staff it will be clearly understood that any improvement in the present invention, equivalence replacement and auxiliary element to each raw material of product of the present invention
Addition, the selection etc. of concrete mode, all fall within protection scope of the present invention and the open scope.
Claims (10)
1. a kind of screening technique with monoclonal antibody of the purpose antigen with high-affinity, which is characterized in that including walking as follows
Suddenly：
（1）Antibody library is built, and high-flux sequence is carried out to the antibody library；
（2）The antibody variable gene obtained for purpose antigen is composed；
（3）CDR3 sequences and corresponding heavy chain and light chain antibody nucleic acid sequence are chosen from antibody variable gene spectrum as candidate
Matched sequence；
（4）Heavy chain and light chain expression vector are built respectively, and suitable cell transfection technique and expression system are utilized after mixing pairing
Antibody expression is carried out, Activity determination is carried out to expression product, obtains positive combination；
（5）Heavy chain and light chain during the positive is combined are split, and are matched according to the principle of 1 heavy chain and 1 light chain, are utilized conjunction
Suitable cell transfection technique and expression system carry out antibody expression, and Activity determination is carried out to expression product, obtained positive combination
As there is with purpose antigen the monoclonal antibody of high-affinity.
2. screening technique according to claim 1, which is characterized in that step（4）In mixing matching method include it is as follows
Step：
（a）The heavy chain expression vector that will be built carries out mixed in equal amounts per m items；
（b）The light chain expression vector that will be built carries out mixed in equal amounts per n items；
（c）Step（a）In heavy chain mixture respectively with step（b）In light chain mixture pairing；
Wherein m, n take the integer more than or equal to 1.
3. screening technique according to claim 1 or 2, which is characterized in that step（5）Middle heavy chain by positive combine and
After light chain is split, if the number of heavy chain and light chain is all higher than 1 in Antigen positive hybridomas combination, first according to 1 heavy chain and a plurality of light chain
And/or the principle of 1 light chain and a plurality of heavy chain is matched, and antibody table is carried out using suitable cell transfection technique and expression system
Reach, Activity determination carried out to expression product, then by obtained positive combination heavy chain and light chain split, according to 1 weight
The principle of chain and 1 light chain is matched, and antibody expression is carried out using suitable cell transfection technique and expression system, to expression product
Activity determination is carried out, obtained positive combination is the monoclonal antibody for having high-affinity with purpose antigen.
4. according to any screening techniques of claim 1-3, which is characterized in that step（4）-（5）Described in cell turn
Dyeing technique is by DEAE- glucans method, calcium phosphate method, cationic-liposome method, cationic polymer method, microinjection, base
It is realized because of any one or a few method in marksmanship and electroporation.
5. according to any screening techniques of claim 1-3, which is characterized in that step（4）-（5）Described in expression system
System is arbitrary in escherichia expression system, yeast expression system, insect expression system and mammalian expression systems
It is one or more of.
6. according to any screening techniques of claim 1-3, which is characterized in that step（4）-（5）Described in activity inspection
Any one or a few in ELISA, IF, PHA and RIA of survey method.
7. according to any screening techniques of claim 1-3, which is characterized in that step（4）Described in vector construction side
Any one or a few in digestion connection, homologous recombination of method.
8. according to any screening techniques of claim 1-3, which is characterized in that step（4）Described in hybrid mode be
Heavy chain expression vector is mixed with light chain expression vector with certain mass ratio, and mixed ratio can be according to heavy chain and light chain
Item number adjust accordingly.
9. according to any screening techniques of claim 1-3, which is characterized in that step（3）Described in select CDR3 sequences
Principle be：The high frequency series after CDR3 clusters, immune rear or outbreak period ratio and the immune preceding or convalescence frequency of occurrences is selected to have
There are bright in immune rear or outbreak period relatively immune preceding or convalescence for the corresponding V gene families of CDR3 sequences or CDR3 being obviously improved
Any one or a few in the different sequence of significant difference.
10. according to the screening technique of any monoclonal antibodies of claim 1-9 in biology, immunology, medicine and phase
Application in the field of pass.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710085557.3A CN108456682A (en) | 2017-02-17 | 2017-02-17 | A kind of screening technique of monoclonal antibody and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710085557.3A CN108456682A (en) | 2017-02-17 | 2017-02-17 | A kind of screening technique of monoclonal antibody and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108456682A true CN108456682A (en) | 2018-08-28 |
Family
ID=63221884
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710085557.3A Pending CN108456682A (en) | 2017-02-17 | 2017-02-17 | A kind of screening technique of monoclonal antibody and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108456682A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452296A (en) * | 2019-07-16 | 2019-11-15 | 福州精锐生物技术有限公司 | A kind of rabbit monoclonal antibodies preparation method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040067496A1 (en) * | 2002-10-07 | 2004-04-08 | Robert Pytela | System for production and screening of monoclonal antibodies |
| CN102265152A (en) * | 2008-10-06 | 2011-11-30 | 西福根有限公司 | Method for identifying and selecting drug candidates for combinatorial drug products |
| CN103003697A (en) * | 2010-05-17 | 2013-03-27 | 得克萨斯系统大学董事会 | Rapid isolation of monoclonal antibodies from animals |
| CN103603057A (en) * | 2013-07-03 | 2014-02-26 | 深圳大学 | Antibody screening method based on heavy chain library/light chain library of infectable virus particle type antibody and preparation method of heavy chain library/light chain library |
| CN106047857A (en) * | 2016-06-01 | 2016-10-26 | 苏州金唯智生物科技有限公司 | Method for mining antibody with specific function |
| CN106065031A (en) * | 2016-01-14 | 2016-11-02 | 苏州金唯智生物科技有限公司 | Antibody based on hybridoma technology and high-flux sequence finds method |
-
2017
- 2017-02-17 CN CN201710085557.3A patent/CN108456682A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040067496A1 (en) * | 2002-10-07 | 2004-04-08 | Robert Pytela | System for production and screening of monoclonal antibodies |
| CN102265152A (en) * | 2008-10-06 | 2011-11-30 | 西福根有限公司 | Method for identifying and selecting drug candidates for combinatorial drug products |
| CN103003697A (en) * | 2010-05-17 | 2013-03-27 | 得克萨斯系统大学董事会 | Rapid isolation of monoclonal antibodies from animals |
| CN103603057A (en) * | 2013-07-03 | 2014-02-26 | 深圳大学 | Antibody screening method based on heavy chain library/light chain library of infectable virus particle type antibody and preparation method of heavy chain library/light chain library |
| CN106065031A (en) * | 2016-01-14 | 2016-11-02 | 苏州金唯智生物科技有限公司 | Antibody based on hybridoma technology and high-flux sequence finds method |
| CN106047857A (en) * | 2016-06-01 | 2016-10-26 | 苏州金唯智生物科技有限公司 | Method for mining antibody with specific function |
Non-Patent Citations (1)
| Title |
|---|
| 闫果林: "汉滩病毒结构蛋白线性B细胞表位的筛选和鉴定", 《中国博士学位论文全文数据库 医药卫生科技辑》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110452296A (en) * | 2019-07-16 | 2019-11-15 | 福州精锐生物技术有限公司 | A kind of rabbit monoclonal antibodies preparation method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2636239T3 (en) | Generation of binding molecules | |
| US10175249B2 (en) | Proteomic identification of antibodies | |
| CN107760690B (en) | A kind of preparation method and application of high throughput human antibody | |
| EP2021463B1 (en) | Culture method for obtaining a clonal population of antigen-specific b cells | |
| UA124799C2 (en) | Immune modulation and treatment of solid tumors with antibodies that specifically bind cd38 | |
| CN102245767B (en) | Immunoassay method for human CXCL1 protein | |
| CN106047857A (en) | Method for mining antibody with specific function | |
| CN106939047A (en) | A kind of PD-L1 antibody and preparation method thereof | |
| CN101970482A (en) | Identification of antigen- or ligand-specific binding proteins | |
| CN104020289A (en) | Method for screening monoclonal antibodies on different binding sites of antigen | |
| CN114414808A (en) | Method for detecting synergistic biological activity of TIGIT antibody and PVRIG antibody | |
| CN107367611B (en) | The ELISA detection kit of epidermal growth factor acceptor third type mutant | |
| CN113699156B (en) | PD-1 nucleic acid aptamer, screening method and application thereof | |
| CN108456682A (en) | A kind of screening technique of monoclonal antibody and its application | |
| CN113150122B (en) | Preparation method of high-throughput whole rabbit source monoclonal antibody | |
| CN102863529A (en) | VEGF (vascular endothelial growth factor) monoclonal antibody and fracture healing evaluation antibody chip with same | |
| CN114539403B (en) | Rabbit recombinant monoclonal antibody targeting human BCMA protein and application thereof | |
| CN101891813A (en) | Leukemia drug resistant epicyte protein and purpose thereof as drug resistant target protein | |
| CN115785277B (en) | Preparation and application of anti-IL4i1 nano antibody | |
| CN114044819A (en) | High-throughput preparation method of full-ovine monoclonal antibody | |
| CN104263755B (en) | A method of subjecting a monoclonal antibody cell strain to in-vivo tachytelic evolution by utilization of a DNA damage repair mechanism | |
| Georgiou et al. | Rapid isolation of monoclonal antibodies from animals | |
| CN117925621A (en) | Method for knocking out TIGIT gene of CAR-T cell by CRISPR/Cas9 gene editing technology and application | |
| Lee et al. | Increasing hybridoma viability and antibody repertoire after the cell fusion by the use of human plasma as an alternative supplement | |
| CN117586396A (en) | TIGIT antibodies, methods of preparation and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20180828 |