CN104263749A - An expression method of scorpion-source antibacterial peptide IsCT in pichia pastoris and applications of the method in clinical treatment of infectious traumas - Google Patents
An expression method of scorpion-source antibacterial peptide IsCT in pichia pastoris and applications of the method in clinical treatment of infectious traumas Download PDFInfo
- Publication number
- CN104263749A CN104263749A CN201410031070.3A CN201410031070A CN104263749A CN 104263749 A CN104263749 A CN 104263749A CN 201410031070 A CN201410031070 A CN 201410031070A CN 104263749 A CN104263749 A CN 104263749A
- Authority
- CN
- China
- Prior art keywords
- isct
- derivative
- recombinant
- expression
- scorpion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an expression method of scorpion-source antibacterial peptide IsCT in pichia pastoris and applications of the method in clinical treatment of infectious traumas. The method includes steps of: obtaining an IsCT-containing target fragment; constructing a multicopy IsCT derivative recombinant plasmid; constructing an IsCT derivative recombinant plasmid secreting and expressing pichia pastoris; constructing recombinant pichia pastoris and screening, and performing shaking bottle fermentation induced expression of the recombinant bacterium. According to the method and the applications, by integrating a plurality of elements, and by adopting a pichia pastoris expression system and a secretory expression vector pPICZ[alpha]A and Mut<+> type host bacteria X-33, secretory expression of a scorpion-source antibacterial peptide IsCT derivative is performed, and in-vitro secretory expression products are subjected to bacteriostatic activity detection, thus providing theoretical foundations and technical supports for treatment of trauma infectious diseases clinically.
Description
Technical field
The invention belongs to antibacterial peptide field, specifically the expression method of a kind of scorpion derived antimicrobial peptide IsCT in pichia spp and treat the application of infectious trauma clinically.
Background technology
Antibiotic discovery is one of most important discovery in chemotherapeutic agent history, and it significantly reduces the mortality ratio of infectious diseases.But antibiotic a large amount of use, especially unreasonable use result in day by day serious anti-biotic resistance phenomenon.Resistant organism, especially drug tolerance bacterium, has become the significant problem threatening public safety, result also in the demand of novel anti-infection medicine more and more urgent.Since discovery cecropin, the research of antibacterial peptide receives much concern, and the antibacterial peptide differentiated at present, more than 2 000 kinds, almost derives from the biology from microorganism to Mammals all kinds.The angle of antibacterial peptide research is also expanded greatly, from the mechanism of action, generation mechanism to other functions of excavation antibacterial peptide, as immunomodulatory, ion-select electrode, anti-oxidant function etc., then to clinical application research.Antibacterial peptide is by genes encoding, Ribosome biogenesis, and being that the class that host innate immune defense system produces resists the small molecules cationic peptide class biologically active substance of extraneous pathogenic infection, is the important effect molecule of innate immunity.
1.IsCT is a kind of natural alpha-helix antibacterial peptide, derive from the black pawl scorpion of Madagascar (Opisthacanthus madagascariensis), be polypeptide the shortest in antibacterial peptide, be only made up of 13 amino-acid residues (ILGKIWEGIKSLF), there is no halfcystine.IsCT has activity to Mammals and bacterial cell.Based on [the L in the IsCT derivative of this gene design
6, K
11]-IsCT(ILGKILKGIKKLF) and in the same with IsCT, to E. coli, P. aeruginosa, S. trphimurium, S. epidermidis, S. aureus has identical bacteriostatic activity, simultaneously as [L
6, K
11] hemolytic activity of-IsCT concentration when reaching 100 μMs be only 20%, therefore in feed, medicine, has higher using value.
2. antibacterial peptide is the effector molecule of biological innate immune, content is very micro-in vivo, from natural resource, extraction cost is high, yield is low, operation is loaded down with trivial details, so can not by meeting business-like production from the mode of a large amount of antibacterial peptide of extracting directly in organism, two kinds of main at present modes be direct improvement on synthesis and genetic engineering means.And chemosynthesis is expensive, be also difficult to be applied to clinical; Therefore utilize genetic engineering technique to produce antibacterial peptide to have great importance.The recombinant expressed research of antibacterial peptide starts from mid-nineties 90 in 20th century 80, has obtained considerable achievement in research so far, has possessed certain theory and technology basis.
Because antibacterial peptide molecular weight is little, and may be toxic to Host Strains, the therefore report of antibacterial peptide single expression few and expression amount is not high in intestinal bacteria.
Pichia pastoris phaff (
pichia pastoris) be grew up in recent years comparatively perfect, be widely used for expressing the methanotrophic yeast expression system of foreign protein, a lot of different types of albumen by Pichia anomala expression at present.Therefore selection pichia spp is as the host expressing IsCT derivative.In pichia spp, Restruction albumen has and is better than other eukaryotes and procaryotic feature: be 1. convenient to genetically engineered operation, have strong alcohol oxidase (AOX1) gene promoter, strictly can regulate and control the expression of foreign gene; 2. as eukaryotic expression system, the processing after can translating the albumen of expressing and modification; Thus make the albumen given expression to have biological activity; 3. nutritional requirement is low, growth is fast, substratum is cheap, is convenient to suitability for industrialized production; 4. can cultivate by high density fermentation, expression amount is high; 5. the albumen of expressing in pichia spp both can be present in cell, can be secreted into again outside born of the same parents, and the albumen of self secretion is considerably less, is conducive to purifying; 6. degree of glycosylation is low, and compared with yeast saccharomyces cerevisiae, pichia spp does not produce excessive glycosylation; 7. the expression amount of desirable proteins is increased by recombination multi-copy integration.
Summary of the invention
The object of the present invention is to provide the expression method of a kind of scorpion derived antimicrobial peptide IsCT in pichia spp and treat the application of infectious trauma clinically.
For achieving the above object, the invention provides following technical scheme:
The expression method of scorpion derived antimicrobial peptide IsCT in pichia spp, comprises the following steps:
(1) containing the acquisition of IsCT object fragment
With signal α peptide for template design primer, upstream primer: 5 ' GCGTTCGAAACGATGAGATTTCCTTCAATTTTTAC 3 ', downstream primer: 5 ' CCGGAATTCTTAAAACAACTTCTTAATACCCTTCAAAATCTTACCCAAAATTCTTT TAGCTTCAGCCTCTCTTTTC 3 ', wherein TTCGAA is the restriction enzyme site of BstB I; GAATTC is the restriction enzyme site of EcoR I, and goal gene design is on downstream primer, and with plasmid pPICZ α A for template, pcr amplification obtains the fragment containing goal gene and signal α peptide; PCR primer is carried out 1.5% agarose gel electrophoresis detection and cuts glue reclaiming purifying;
(2) structure of multiple copied IsCT derivative recombinant plasmid
Double digestion product, with after Bgl II and BamH I double digestion, is carried out 1% agarose gel electrophoresis separation, reclaims expression cassette section and purifying after cutting glue by single copy recombinant plasmid pPICZ alpha A-IsCT; Use BamH I linearization plasmid pPICZ α A-IsCT simultaneously, and after dephosphorylation, connect with T4 ligase enzyme, obtain two copy plasmid pPICZ α A-(IsCT) 2, repeat this process, obtain the IsCT derivative of more multiple copied number;
(3) structure of pichia spp secreting, expressing IsCT derivative recombinant plasmid
Plasmid pPICZ α A and the fragment containing goal gene use BstB I and EcoR I double digestion, construction recombination plasmid pPICZ α A-IsCT simultaneously; Then CaCl is used
2method proceeds to E. coli competent cell, coated plate on Zeocin+ LBL flat board, incubated overnight; Extract positive transformant plasmid and carry out BstB I and the qualification of EcoR I double digestion;
(4) structure of recombinant yeast pichia pastoris and screening
With Mss I linearizing recombinant plasmid pPICZ alpha A-IsCT, adopt electricity to transform Host Strains P. pastoris X33 coated plate on Zeocin+ YPDS flat board, cultivate 2-3d for 28-32 DEG C, random choose transformant carries out bacterium colony PCR qualification;
(5) the shake flask fermentation abduction delivering of recombinant bacterium
Be inoculated in 10mL BMGY substratum by screening the recombinant conversion sub-X33/pPICZ α A-IsCT obtained, 30 DEG C, 16-20h to OD600=2-6 is cultivated in 200r/mim concussion; Collected by centrifugation thalline, again X33/pPICZ α A-IsCT is suspended in 25mL BMMY substratum, and make initial OD600=1, continue concussion to cultivate, in BMMY substratum, the methyl alcohol of 1% is added every 24h, obtain recombinant bacterium, be scorpion derived antimicrobial peptide IsCT derivative, and analyze the growth curve of recombinant bacterium and the anti-microbial activity of IsCT derivative.
As further scheme: the PCR reaction system for pcr amplification in step (1) is: primer each 10pmol/L, Premix prime STAR 25 μ L, template 1 μ L, adding sterilized water to cumulative volume is 50 μ L; Reaction conditions is: 98 DEG C of 5min; 98 DEG C of 10s, 55 DEG C of 10s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 10min; PCR primer is carried out 1.5% agarose gel electrophoresis detection and cuts glue reclaiming purifying.
Scorpion derived antimicrobial peptide IsCT derivative prepared by the described expression method of scorpion derived antimicrobial peptide IsCT in pichia spp infects the application of class disease in treatment wound class.
Compared with prior art, the invention has the beneficial effects as follows: the comprehensive multinomial factor of the present invention, adopt pichia pastoris phaff expression system, select secreted expression carrier pPICZ α A and Mut
+type Host Strains X-33, carries out secreting, expressing scorpion derived antimicrobial peptide IsCT derivative, and carries out bacteriostatic activity detection to secreted in vitro expression product, treats wound class infection class disease clinically provide fundamental basis and technical support for it.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of recombinant plasmid pPICZ alpha A-IsCT;
Fig. 2 is single copy recombinant plasmid double digestion gel electrophoresis figure;
In Fig. 2: M:DNA Marker;
1: recombinant plasmid is through BstB I and EcoR I double digestion;
Fig. 3 is two copy recombinant plasmid list double digestion gel electrophoresis figures;
Fig. 4 is three copy recombinant plasmid list double digestion electrophorograms;
In Fig. 3 and Fig. 4: M:DNA Marker;
1: two copy (Fig. 3) and three copy (Fig. 4) recombinant plasmids are through BgI II and BamH I double digestion double digestion;
2,3: two copies (Fig. 3) and three copy (Fig. 4) recombinant plasmid single endonuclease digestions;
Fig. 5 is the Inhibition test result figure to S. aureus ATCC 25923 after single copy recombinant yeast pichia pastoris fermentation 120h;
Fig. 6 is the Inhibition test result figure to E. coli ATCC 8739 after single copy recombinant yeast pichia pastoris fermentation 120h;
Fig. 7 is expression product SDS-PAGE analysis chart;
In Fig. 7: M: pre-dyed albumen Marker;
343:IsCT derivative standard substance;
11,12: single copy recombinant bacterial strain fermented supernatant fluid;
21,22,23: two copy recombinant bacterial strain fermented supernatant fluids.
Embodiment
Below in conjunction with the accompanying drawing in the embodiment of the present invention, be clearly and completely described the technical scheme in the embodiment of the present invention, obviously, described embodiment is only the present invention's part embodiment, instead of whole embodiments.Based on the embodiment in the present invention, those of ordinary skill in the art, not making the every other embodiment obtained under creative work prerequisite, belong to the scope of protection of the invention.
1 materials and methods
1.1 experiment material
1.1.1 plasmid and bacterial strain
Plasmid: pPICZ α A; Bacterial strain: E.coli Top10, Pichia pastoris X33, E. coli ATCC 8739, S. aureus ATCC 25923 preserves by this laboratory
1.1.2 reagent
Archaeal dna polymerase Premix prime STAR, T
4dNA ligase, DNA marker and restriction enzyme are purchased from the precious biological company limited in Dalian; In experiment, used kit is purchased from OMEGA, Biomega and QIAGEN company; Without amino acid yeast basic nitrogen source YNB and peptone all purchased from Difco company; Yeast extract is purchased from Oxford company; Primer is synthesized by Shanghai JaRa company; Other reagent are domestic analytical pure.
1.2 experimental technique
1.2.1 containing the acquisition of IsCT object fragment
With signal α peptide for template design primer, upstream primer: 5 ' GCG
tTCGAA aCGATGAGATTTCCTTCAATTTTTAC 3 ', downstream primer: 5 ' CCG
gAATTC tTAAAACAACTTCTTAATACCCTTCAAAATCTTACCCAAAATTCTTTTAGCTTCAG CCTCTCTTTTC 3 ', (wherein underscore
tTCGAA for the restriction enzyme site of BstB I;
gAATTC restriction enzyme site for EcoR I), goal gene design is on downstream primer, and with plasmid pPICZ α A for template, pcr amplification obtains the fragment containing goal gene and signal α peptide.PCR reaction system is: primer each 10pmol/L, Premix prime STAR 25 μ L, template 1 μ L, adding sterilized water to cumulative volume is 50 μ L.Reaction conditions is: 98 DEG C of 5min; 98 DEG C of 10s, 55 DEG C of 10s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 10min.PCR primer is carried out 1.5% agarose gel electrophoresis detection and cuts glue reclaiming purifying.
1.2.2 the structure of multiple copied IsCT derivative recombinant plasmid
Double digestion product, with after Bgl II and BamH I double digestion, is carried out 1% agarose gel electrophoresis separation by single copy recombinant plasmid pPICZ alpha A-IsCT, cuts glue and reclaims expression cassette section and purifying.Use BamH I linearization plasmid pPICZ α A-IsCT simultaneously, and after dephosphorylation, connect with T4 ligase enzyme, obtain two copy plasmid pPICZ α A-(IsCT) 2, repeat this process, obtain the IsCT derivative of more multiple copied number.
1.2.3 the structure of pichia spp secreting, expressing IsCT derivative recombinant plasmid
Plasmid pPICZ α A and the fragment containing goal gene use BstB I and EcoR I double digestion, construction recombination plasmid pPICZ α A-IsCT(Fig. 1 simultaneously).Then CaCl is used
2method proceeds to E. coli competent cell, coated plate on Zeocin+ LBL (25mg/L) flat board, incubated overnight.Extract positive transformant plasmid and carry out BstB I and the qualification of EcoR I double digestion.
1.2.4 the structure of recombinant yeast pichia pastoris and screening
With Mss I linearizing recombinant plasmid pPICZ alpha A-IsCT, adopt electricity to transform Host Strains P. pastoris X33 coated plate on Zeocin+ YPDS (100mg/L) flat board, cultivate 2-3d for 30 DEG C, random choose transformant carries out bacterium colony PCR qualification.
1.2.5 the shake flask fermentation abduction delivering of recombinant bacterium
Be inoculated in 10mL BMGY substratum by screening the recombinant conversion sub-X33/pPICZ α A-IsCT obtained, 30 DEG C, 16-20h to OD600=2-6 is cultivated in 200r/mim concussion.Collected by centrifugation thalline, again X33/pPICZ α A-IsCT is suspended in 25mL BMMY substratum, and makes initial OD600=1, continue concussion and cultivate, in BMMY substratum, add the methyl alcohol of 1% every 24h, and analyze the growth curve of recombinant bacterium and the anti-microbial activity of IsCT derivative.Experiment is using P. pastoris X33/ pPICZ α A as negative control.
1.2.6 IsCT activity measurement
Get fermented liquid 10mL, the centrifugal 5min of 5000rpm, gets supernatant liquor, be labeled as stoste, measure stoste pH, regulate pH to 6.5-7.0 with sodium hydroxide, get and regulate the stoste after pH, doubling dilution to 2 successively ×, 4 ×, 8 ×, 16 ×, comprise stoste altogether the sample of 5 different concns.Nutrient agar after high-temperature sterilization, treats that its temperature drops to about 45 DEG C, adds 1-2 and drips TTC reagent (optional), in the access of 1:1000 ratio for examination intestinal bacteria, and mixing.Pour into after mixing in sterile petri dish, every ware 25mL, treat that it solidifies (streptococcus aureus is the same).Punch on substratum with ganoid aseptic stainless steel tube, aerial substratum syringe needle is chosen, and with flame back cover, make substratum can fully and plate merge and (prevent Drug leakage, affect result), each is dull and stereotyped makes a call to 5 holes, add respectively test sample stoste, 2 ×, 4 ×, 8 ×, 16 ×, every hole adds to liquid level and flushes with liquid nutrient medium (about 75 μ L), makes marks in flat plate bottom.
Plating medium is placed in 37 DEG C of incubators and cultivates 15-24h, observe fungistatic effect, measure antibacterial circle diameter (deducting aperture) and record result.
1.2.7 expression product SDS-PAGE electrophoretic analysis
The fermented liquid getting fermentation 120h is centrifugal, gets supernatant, concentrates 10 times, afterwards concentrated solution is carried out SDS-PAGE electrophoresis at 60 DEG C, and by the IsCT standard substance of chemosynthesis in contrast, analyzing proteins expression.
2. interpretation of result
The structure of 2.1 IsCT derivative recombinant plasmids
With plasmid pPIC α A for template amplification IsCT derivative gene, product is cut glue and is reclaimed product after 1.5% agarose gel electrophoresis qualification, by method " 1.2.2 " construction recombination plasmid pPICZ α A-IsCT, double digestion qualification result meets expection (Fig. 2), serve the order-checking of Hai Meiji biological medicine company limited, sequencing result is correct.The structural representation of recombinant plasmid pPICZ alpha A-IsCT as shown in Figure 1.Two copies built by method 1.2.2, three copy recombinant plasmids meet expection (Fig. 3,4) through single double digestion qualification result.
2.2.2 single copy recombinant yeast pichia pastoris fermented liquid supernatant is to the mensuration of E. coli ATCC 8739, S. aureus ATCC 25923 minimal inhibitory concentration
By method 1.2.6, single copy fermented liquid is diluted for different concentration, survey the inhibition zone of different dilution fermented liquid to E. coli ATCC 8739, S. aureus ATCC 25923.As Fig. 5 shows, wherein in the Inhibition test to S. aureus ATCC 25923, after fermented liquid dilutes 4 times, bacteriostatic activity is still had to S. aureus ATCC 25923, after dilution 8, do not have bacteriostatic activity, therefore can define the minimum inhibitory concentration of S. aureus ATCC 25923 is 0.25 times of IsCT derivative fermented liquid concentration.In the Inhibition test to E. coli ATCC 8739, after fermented liquid dilutes 2 times, bacteriostatic activity is still had to E. coli ATCC 8739, after diluting 4 times, do not have bacteriostatic activity, therefore can define the minimum inhibitory concentration of E. coli ATCC 8739 is 0.5 times of IsCT derivative fermented liquid concentration.
2.2.3 the SDS-PAGE of expression product analyzes
Carry out SDS-PAGE analysis after single copy and two copy fermented liquid supernatant being concentrated, as shown in Figure 5, IsCT albumen is greatly about 2kD, more bigger than standard substance for result, may modify relevant with the glycosylation etc. after protein translation.
3. discuss
In order to table antibacterial peptide IsCT derivative efficient in pichia spp, this research is according to the aminoacid sequence of IsCT derivative, select the inclined preferendum codon of pichia spp, the DNA fragmentation design containing goal gene on downstream primer, to be increased the goal gene sequence obtained containing signal α peptide by the method for PCR.
Because pichia spp does not have natural plasmid, used expression vector is conformability carrier, and the expression vector containing goal gene is integrated on yeast chromosomal by the mode of homologous recombination, thus obtains the engineering strain of goal gene stable integration.Adopt restriction endonuclease to make expression vector linearizing, expression cassette and host genome generation single cross are changed and are integrated in karyomit(e), thus improve the success ratio of integration.Because pPICZ α A carrier to have the restriction enzyme site of isocaudarner in expression cassette both sides, isocaudarner double digestion can be utilized, after dephosphorylation, connect the IsCT derivative building multiple copied and improve expression amount.
Alcohol oxidase (AOX1) promotor and signal α peptide are conducive to stable under the control of methyl alcohol, the efficient secreting, expressing of foreign gene.The methods such as strong promoter, signal peptide and optimization of fermentation conditions can be selected to realize the increase of the secreting, expressing amount of IsCT mutant simultaneously.
Colon bacillus, streptococcus aureus are the main pathogenic fungi of trauma infection contamination clinically.Infect caused by escherichia coli in clinical position and rise to some extent, between abuse of antibiotics and bacterium, the R factor is transmitted mutually, and Resistant strain obviously increases, and brings difficulty to clinical treatment.Caused by Staphylococcus aureus infects and is not only in a bad way, and often to multiple antibiotic resistance, brings extreme difficulties to treatment.China's Hospital Infection network data shows, S. aureus L-forms ranked first position in the gram positive organism of hospital infection.And along with widely using of antibacterials, the resistant rate of S. aureus L-forms and multiple antibiotic resistant strain constantly increase and change.And compared with normal antibiotics, the antibacterial range of antibacterial peptide is wider, except antibacterium, some antibacterial peptides can also act on fungi, protozoon, tunicary virus and cancer cells (may be relevant with the change of its cytoskeleton to the selectively acting of cancer cells), simultaneously can healing acceleration process.This indication antibacterial peptide treatment and preventing cancer and antiviral, anti-infective etc. in have good application prospect.What is more important, this material obtained from organism of antibacterial peptide by chance has unique Antibacterial Mechanism, unlike microbiotic play rent by blocking the biosynthesizing of biomacromolecule like that, can not produce and see resistance, thus pole is hopeful to develop becomes the novel broad-spectrum high efficacy antibacterials of a class.No matter and this research is to colon bacillus or streptococcus aureus by pichia pastoris X-33 engineering bacterium expression IsCT derivative out, all showing good restraining effect, becoming possibility for substituting this type of anti-trauma infection contamination medicine clinically.
4. affect several factors that foreign gene is expressed in pichia spp
Existing more than 200 kind of foreign protein obtains expression in pichia spp so far, but also has many protein expressions undesirable, even can not express.It is generally acknowledged that to affect foreign gene a lot of in the factor of this system expression, as the selection of promotor, the characteristic of goal gene, the non-translational region (UTR) of mRNA, the use of goal gene codon, the selection of carrier, the selection etc. of Host Strains.
4.4.1 the characteristic of foreign gene
The intrinsiccharacteristic of foreign gene is that decision table reaches the important factor in order lost, the gene of AT too high levels is expressed and is caused premature transcription termination sometimes in pichia spp, the AOX1 transcription termination sequence of pichia spp is exactly that one " AT " is rich in district, and sequence A TTATTTTATAAA is exactly a premature transcription termination signal.
4.4.2 temperature
Temperature is the result of various factors general performance on the growth of thalline and the impact of fermentation.Temperature has impact to the activity of pichia spp tunning, the physical properties (the decomposition uptake rate etc. of dissolved oxygen content, matrix) of fermented liquid and biosynthesizing direction etc.From zymetology aerodynamic point, temperature raises, and speed of reaction strengthens, and growth metabolism is accelerated, and production phase in advance.But temperature is too high, can make enzyme Yi Yinre again and lose activity, temperature is higher, and the inactivation of enzyme is also faster, and show that thalline is easy to old and feeble, fermentation period shortens, and affects the output of product.It is reported, the culture temperature of pichia spp is 28 DEG C ~ 30 DEG C, and 28 DEG C is the optimum temperuture of yeast bulk-growth, and 30 DEG C is the optimum temperuture of exogenous protein expression.More than 32 DEG C between inductive phase, unfavorable to protein expression, even can cause necrocytosis.
4.4.3 pH value
No matter the pH of substratum is considerable to thalli growth or to the secreting, expressing of albumen.The impact of pH on microbial growth and Product formation of fermention medium has the following aspects: 1. affect enzymic activity, when pH value suppresses some enzyme in thalline active, can hinder the metabolism of thalline; 2. affect the charged state of Institute of Micro-biology's band cytolemma, change membrane passage, affect the excretion of microorganism to the absorption and metabolism product of nutritive substance; 3. affect dissociating of some component and mesostate in substratum, thus affect the utilization of microorganism to these materials; 4.pH value is different, often causes the difference of bacterial metabolism process, the quality of meta-bolites and ratio are changed.Pichia spp all can grow in the scope of pH value 3.0-7.0, but when pH lower than 2.2 time thalline stop growing, when control pH constant (5.0), expression amount is the highest.In pichia spp process of high-density fermentation, the regulation and control of pH carry out Balancing carry out by adding ammoniacal liquor and hydrochloric acid online.Wherein, ammoniacal liquor is the conditioning agent of soda acid, again for pichia spp fermentation provides nitrogenous source.Especially in genetically engineered secreting, expressing process, some albumen is more responsive to pH value, is easily subject to the hydrolysis of proteolytic ferment, therefore, the pH value that essential selection is suitable, not only can high efficiency expressing destination protein but also can the hydrolysis of protease inhibition, kept the stability of target protein.Although the pH scope of pichia spp growth is wider, specific to different recombinant bacterial strains, the most suitable growth pH value of just having nothing in common with each other.
4.4.4 dissolved oxygen
In fermented substrate, dissolved oxygen content (DO) is very important for growth of aerobic microorganisms, during the fermentation, ensures the supply of oxygen, meets and produces bacterium to the demand of oxygen, is the important factor improving fermentation yield.In process of high-density fermentation, have report to think if cultivated with fermentor tank, the expression level of foreign protein exceeds 10-100 doubly than common shaking flask, and major cause is that the ventilation of common shake flask fermentation is undesirable, have impact on high-density growth and the expression of thalline.Pichia spp is aerobic microbiological, the participation of its growth metabolism process need oxygen, the impact that dissolved oxygen concentration generates the growth of thalline and product is very large, and the excessive concentration of dissolved oxygen or the too low metabolism that all can affect yeast, make the growth in later stage become very slow.Thalline is in a large amount of amplification procedure, and oxygen consumption carries out oxygenolysis metabolism, makes the growth in later stage become very slow.Thalline is in a large amount of amplification procedure, and oxygen consumption carries out oxygenolysis metabolism, the timely supply of saturated oxygen and extremely important.Along with the prolongation of fermentation time, cell density increases sharply, and oxyty declines thereupon, and Growth of Cells slows down.In the high density fermentation later stage, due to the amplification of cell density, oxygen-consumption is very big, and every physical parameter of fermentor tank all can not meet the supply to oxygen, and result inhibits the growth and breeding of bacterium.Therefore keep certain dissolved oxygen concentration, the restraining effect of substrate and harmful waste can be reduced, realize high density fermentation.Research shows, in pichia spp process of high-density fermentation, if dissolved oxygen is lower than 20%, thalli growth and metabolism will be made to be affected.If but dissolved oxygen too high (more than 60%), will oxygen intoxication be there is in cell.Visible, dissolved oxygen is too high or too low all to be had a significant impact the expression of foreign protein.Therefore, scope dissolved oxygen being remained on be conducive to foreign protein high expression is very important for high density fermentation.
To those skilled in the art, obviously the invention is not restricted to the details of above-mentioned one exemplary embodiment, and when not deviating from spirit of the present invention or essential characteristic, the present invention can be realized in other specific forms.Therefore, no matter from which point, all should embodiment be regarded as exemplary, and be nonrestrictive, scope of the present invention is limited by claims instead of above-mentioned explanation, and all changes be therefore intended in the implication of the equivalency by dropping on claim and scope are included in the present invention.Any Reference numeral in claim should be considered as the claim involved by limiting.
In addition, be to be understood that, although this specification sheets is described according to embodiment, but not each embodiment only comprises an independently technical scheme, this narrating mode of specification sheets is only for clarity sake, those skilled in the art should by specification sheets integrally, and the technical scheme in each embodiment also through appropriately combined, can form other embodiments that it will be appreciated by those skilled in the art that.
Claims (3)
1. the expression method of scorpion derived antimicrobial peptide IsCT in pichia spp, is characterized in that, comprise the following steps:
(1) containing the acquisition of IsCT object fragment
With signal α peptide for template design primer, upstream primer: 5 ' GCG
tTCGAAaCGATGAGATTTCCTTCAATTTTTAC 3 ', downstream primer: 5 ' CCG
gAATTCtTAAAACAACTTCTTAATACCCTTCAAAATCTTACCCAAAATTCTTTTAGCTTCAG CCTCTCTTTTC 3 ', wherein TTCGAA is the restriction enzyme site of BstB I; GAATTC is the restriction enzyme site of EcoR I, and goal gene design is on downstream primer, and with plasmid pPICZ α A for template, pcr amplification obtains the fragment containing goal gene and signal α peptide; PCR primer is carried out 1.5% agarose gel electrophoresis detection and cuts glue reclaiming purifying;
(2) structure of multiple copied IsCT derivative recombinant plasmid
Double digestion product, with after Bgl II and BamH I double digestion, is carried out 1% agarose gel electrophoresis separation, reclaims expression cassette section and purifying after cutting glue by single copy recombinant plasmid pPICZ alpha A-IsCT; Use BamH I linearization plasmid pPICZ α A-IsCT simultaneously, and after dephosphorylation, connect with T4 ligase enzyme, obtain two copy plasmid pPICZ α A-(IsCT)
2, repeat this process, obtain the IsCT derivative of more multiple copied number;
(3) structure of pichia spp secreting, expressing IsCT derivative recombinant plasmid
Plasmid pPICZ α A and the fragment containing goal gene use BstB I and EcoR I double digestion, construction recombination plasmid pPICZ α A-IsCT simultaneously; Then CaCl is used
2method proceeds to E. coli competent cell, coated plate on Zeocin+ LBL flat board, incubated overnight; Extract positive transformant plasmid and carry out BstB I and the qualification of EcoR I double digestion;
(4) structure of recombinant yeast pichia pastoris and screening
With Mss I linearizing recombinant plasmid pPICZ alpha A-IsCT, adopt electricity to transform Host Strains P. pastoris X33 coated plate on Zeocin+ YPDS flat board, cultivate 2-3d for 28-32 DEG C, random choose transformant carries out bacterium colony PCR qualification;
(5) the shake flask fermentation abduction delivering of recombinant bacterium
Be inoculated in 10mL BMGY substratum by screening the recombinant conversion sub-X33/pPICZ α A-IsCT obtained, 30 DEG C, 16-20h to OD600=2-6 is cultivated in 200r/mim concussion; Collected by centrifugation thalline, again X33/pPICZ α A-IsCT is suspended in 25mL BMMY substratum, and make initial OD600=1, continue concussion to cultivate, in BMMY substratum, the methyl alcohol of 1% is added every 24h, obtain recombinant bacterium, be scorpion derived antimicrobial peptide IsCT derivative, and analyze the growth curve of recombinant bacterium and the anti-microbial activity of IsCT derivative.
2. the expression method of scorpion derived antimicrobial peptide IsCT according to claim 1 in pichia spp, it is characterized in that, PCR reaction system for pcr amplification in step (1) is: each 10pmol/L of primer, Premix prime STAR 25 μ L, template 1 μ L, adding sterilized water to cumulative volume is 50 μ L; Reaction conditions is: 98 DEG C of 5min; 98 DEG C of 10s, 55 DEG C of 10s, 72 DEG C of 20s, 30 circulations; 72 DEG C of 10min; PCR primer is carried out 1.5% agarose gel electrophoresis detection and cuts glue reclaiming purifying.
3. the scorpion derived antimicrobial peptide IsCT derivative that prepared by the expression method of a scorpion derived antimicrobial peptide IsCT as claimed in claim 1 or 2 in pichia spp infects the application of class disease in treatment wound class.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410031070.3A CN104263749B (en) | 2014-01-23 | 2014-01-23 | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410031070.3A CN104263749B (en) | 2014-01-23 | 2014-01-23 | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104263749A true CN104263749A (en) | 2015-01-07 |
CN104263749B CN104263749B (en) | 2017-03-29 |
Family
ID=52155328
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410031070.3A Active CN104263749B (en) | 2014-01-23 | 2014-01-23 | A kind of expression of scorpion derived antimicrobial peptide IsCT in Pichia pastoris and its clinically application for the treatment of infectious trauma |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104263749B (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104782909A (en) * | 2015-03-04 | 2015-07-22 | 深圳市圣西马生物技术有限公司 | Antibacterial peptide mold removal agent for feed, preparation method thereof and animal feed additive |
CN105331626A (en) * | 2015-09-18 | 2016-02-17 | 中国水产科学研究院南海水产研究所 | Method for constructing tandem expression vector and engineering strain of Pinctada martensii muscle antioxidant peptide |
CN112094833A (en) * | 2020-03-24 | 2020-12-18 | 深圳市康佑生物技术有限公司 | Bacteriostatic protein, coding gene, application and strain method thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101063102A (en) * | 2007-04-26 | 2007-10-31 | 武汉大学 | East-Asia scorpion antibiotic peptide gene and preparation method and application |
CN101392249A (en) * | 2007-09-21 | 2009-03-25 | 中国科学院沈阳应用生态研究所 | Antibiotic peptide gene, preparation method thereof and construction of expression plasmid of the same in pichia vector |
-
2014
- 2014-01-23 CN CN201410031070.3A patent/CN104263749B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101063102A (en) * | 2007-04-26 | 2007-10-31 | 武汉大学 | East-Asia scorpion antibiotic peptide gene and preparation method and application |
CN101392249A (en) * | 2007-09-21 | 2009-03-25 | 中国科学院沈阳应用生态研究所 | Antibiotic peptide gene, preparation method thereof and construction of expression plasmid of the same in pichia vector |
Non-Patent Citations (2)
Title |
---|
SAADET ALBAYRAK: "CONSTRUCTION AND SCREENING OF CUSTOM PEPTIDE LIBRARIES DERIVED FROM SYNTHETIC DNA POOLS", 《A DISSERTATION SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY (CHEMICAL ENGINEERING) IN THE UNIVERSITY OF MICHIGAN》, 15 September 2011 (2011-09-15) * |
郑文官等: "抗菌肽[L6,K11]-IsCT抑菌性能及其稳定性研究", 《中国畜牧兽医》, vol. 40, no. 4, 31 December 2013 (2013-12-31) * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104782909A (en) * | 2015-03-04 | 2015-07-22 | 深圳市圣西马生物技术有限公司 | Antibacterial peptide mold removal agent for feed, preparation method thereof and animal feed additive |
CN105519798A (en) * | 2015-03-04 | 2016-04-27 | 深圳市圣西马生物技术有限公司 | Animal feed additive |
CN105331626A (en) * | 2015-09-18 | 2016-02-17 | 中国水产科学研究院南海水产研究所 | Method for constructing tandem expression vector and engineering strain of Pinctada martensii muscle antioxidant peptide |
CN112094833A (en) * | 2020-03-24 | 2020-12-18 | 深圳市康佑生物技术有限公司 | Bacteriostatic protein, coding gene, application and strain method thereof |
CN112094833B (en) * | 2020-03-24 | 2022-12-27 | 深圳市康佑生物技术有限公司 | Bacteriostatic protein, and coding gene, application and strain thereof |
Also Published As
Publication number | Publication date |
---|---|
CN104263749B (en) | 2017-03-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN102517235B (en) | Bacillus subtilis | |
CN102399737A (en) | Biological engineering bacterial strain for producing novel microorganism source fungicide and application of biological engineering bacterial strain | |
CN108048373B (en) | Bacillus subtilis AH1005 and application thereof | |
CN101985605B (en) | Saprolegnia antagonist and application thereof | |
CN106957805A (en) | It is a kind of with the bacterial strains of bacillus GBacillus 9 and its separation method of fungistatic effect and application | |
CN105368866A (en) | Application of improved ATMT (Agrobacterium Tumefaciens-Mediated Transformation) to construction of trichoderma atroviride T23 deltaCrel | |
CN104263749A (en) | An expression method of scorpion-source antibacterial peptide IsCT in pichia pastoris and applications of the method in clinical treatment of infectious traumas | |
CN105907661A (en) | Industrial fermentation method for Bacillus subtillis | |
CN104131021A (en) | Antibacterial peptide coexpression vector, construction and expression method thereof | |
CN106520572A (en) | Chinese toon Alternaria mali 56-50 and its secondary metabolite, preparation method and use | |
CN109722408B (en) | Method for promoting bacillus subtilis to produce spores | |
CN110484480A (en) | A kind of preparation of bacillus subtilis bacterium competence cell and method for transformation | |
CN108004154B (en) | Sporobolomyces yunnanensis 17wy1, microbial preparation thereof and application thereof in wheat powdery mildew prevention and treatment | |
CN101124317A (en) | Method of modifying the viability of a lyophilized microorganism by treating the growth medium thereof with gases | |
CN107523512B (en) | High-spore-rate bacillus licheniformis fermentation method | |
CN102242092A (en) | Isolation and identification for bombyx mori intestinal tract probiotics, and cloning and expression of enzyme gene produced by bombyx mori probiotics | |
CN103013977A (en) | Method for breeding enramycin strain by induced mutation of cabicidin streptomycete with ion beam | |
CN106701867B (en) | Method for improving output of nikkomycin | |
CN105732792A (en) | Yeast expressed chicken Cathelicidin antibacterial peptide as well as preparation method and application thereof | |
KR20120076873A (en) | Medium composition for high concentration culture of bacillus and uses thereof | |
CN105176887A (en) | Method for culturing escherichia coli | |
CN110819575A (en) | Culture method of bacillus for producing nattokinase | |
Yang et al. | Optimized submerged batch fermentation for metabolic switching in Streptomyces yanglinensis 3–10 providing platform for reveromycin A and B biosynthesis, engineering, and production | |
CN103960483A (en) | Liquid-state fermentation production method of feed probiotic preparation mainly for producing cellulose | |
CN110699302B (en) | Culture method for improving biomass of bacillus subtilis natto |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |