CN104232799B - Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus - Google Patents
Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus Download PDFInfo
- Publication number
- CN104232799B CN104232799B CN201410512665.0A CN201410512665A CN104232799B CN 104232799 B CN104232799 B CN 104232799B CN 201410512665 A CN201410512665 A CN 201410512665A CN 104232799 B CN104232799 B CN 104232799B
- Authority
- CN
- China
- Prior art keywords
- seqidno
- probe
- kit
- primer
- enteritis virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Abstract
The invention discloses a kind of genetic chip and kit that detects transmissible gastro-enteritis virus and/or porcine rotavirus. Genetic chip of the present invention and detection kit can be accurate and effective detection transmissible gastro-enteritis virus and porcine rotavirus, and high specificity, highly sensitive, consuming time short, detects fast, application prospect is good.
Description
Technical field
The present invention relates to a kind of genetic chip and kit that detects transmissible gastro-enteritis virus, porcine rotavirus.
Background technology
Along with the scale expanding day that centralization is raised pigs, the diarrhea disease of pig becomes and is on the rise. And cause grice diarrhoeaThe cause of disease of disease studies confirm that but also constantly increased Escherichia coli, salmonella, clostridieum welchii, Porcine Epidemic DiarrheaPoison, transmissible gastro-enteritis virus, porcine rotavirus, gentle swine fever, swine dysentery, pig coccidia etc. And by transmissible gastroenteritis of swineThe baby pig disease virus diarrhea disease that virus, porcine rotavirus cause increases increasingly, and this two classes epidemic disease can cause the height morbidity of pigletRate and high mortality, and have some areas to present the phenomenon of mixed infection and scabies secondary infection, pig industry has been caused to the utmost pointLarge loss. Very harmful to piglet aborning in view of this two-strain, the many countries and regions including China arePrevent and control these two kinds main diarrhoea class epidemic diseases, having dropped into a large amount of human and material resources, financial resources, but produced little effect.
Because this two class diarrhoea class epidemic disease is all extremely similar in clinical symptoms and fashion trend, there is no effective vaccine can be byEpidemic situation control, therefore in clinical diagnosis, treatment, and has great difficulty in control. Linchuan symptom is in particular in: general 212-24 hour there will be vomiting after with interior Infection in Piglets age in week, then occurs serious water sample or pasty state diarrhoea, and it is yellow that ight soil isLook, often accompanies indigested ziega, stench, and body weight declines rapidly, and piglet obviously dewaters, the death in 2-7 days of falling ill, the death rate reaches100%; The 2-3 piglet in age in week, the death rate is at 0-10%; Morbidity in 2-4 days after ablactation pig infects, performance watery diarrhea, is spurting,Ight soil gray or brown, indivedual pig vomitings were suffered from diarrhoea and are stopped after 5-8 days, seldom dead, but Body weight loss, normal performance is grownBad, become cad pig; Some resistance to pigs are excessively to be also often with malicious pig with being the stealthy swinery infecting.
The method of these two kinds of diseases of traditional detection is as Virus Isolation and serum inspection, often consuming time long. RecentlyAll set up RT-PCR/PCR detection method with domestic abroad, and multi-PCR detection method, past in extensive batch detectionToward also there being certain limitation. For this reason, be necessary to set up one and examine altogether chip technology to pig epidemic diarrhea, pig transmissible stomach and intestineScorching, porcine rotavirus carries out antidiastole, to realize the fast and accurately detection sick to these 3 kinds, for taking as early as possible effectivelySpecific aim prophylactico-therapeutic measures, reduces the loss that these diseases cause pig industry and carries out place mat. In sum, with examining altogether chip detectionIt is very necessary that technology is carried out other diagnostic method to pig epidemic diarrhea, transmissible gastroenteritis of swine, porcine rotavirus.
Follow the development of Molecular Biology and technology, chip technology has high flux, diversity, micro-in context of detectionThe advantageous feature of type and automation. In to the Molecular Detection of various pathogen, often examine for the gene of pathogenSurvey. And chip technology can carry out to the RNA of various pathogen, DNA the analysis of quantitative and qualitative analysis, thus the clear and definite disease of assisted diagnosis personSick kind and the gradient of infection of disease. Therefore chip technology is being brought into play in the diagnosis of communicable disease and the examination of pathogenMore and more important effect.
Genetic chip, claims again DNA microarray, and its principle is by by cDNA or the intensive solid phase that is fixed on of oligonucleotide probeSurface, then carry out hybridization reaction with the target-gene sequence that mark is good. Show image and software processing through scanner scanningAnalyze data, thereby obtain the specific molecular information comprising in sample that detects, the corresponding sample that detects of combining image and data judgingWhether contain, the number of amount. Traditional detection technique time and effort consuming, and be difficult to carry out with the common detecting pattern of many cause of diseasesCoherent detection. Utilize biochip technology that the specific and conserved sequence fragment of multiple cause of disease is separately fixed to chip surface, withThe sample detecting is hybridized after treatment, just can obtain the detection information of multiple cause of disease. This detection method is to extensive batchAmount detects and has opened up a new situation, for the integrated control of animal epidemic provides effectively and diagnosis and treatment platform fast.
Deng Junhua etc., " structure of TGEV-PEDV-PRV gene chip probes ", Chinese animal and veterinary association animal and veterinary is rawThe 7th Conference Papers collection of thing technology branch and Chinese immunology meeting animal doctor immunity branch, in July, 2008, disclosing mayFor detection of the probe of the popular transmissible gastro-enteritis virus of pig and porcine rotavirus, but unexposed concrete genetic chipAnd detection kit, also whether unexposed its can detect transmissible gastro-enteritis virus and pig colyliform disease special, delicatelyPoison.
Summary of the invention
In order to address the above problem, the invention provides a kind of high specificity, highly sensitive can detecting at the same time or separatelyThe genetic chip of transmissible gastro-enteritis virus and porcine rotavirus and kit.
The present invention detects the genetic chip of transmissible gastro-enteritis virus and/or porcine rotavirus, and it comprises solid phase carrierAnd be fixed on the probe on solid phase carrier; Described probe comprises shown in SEQIDNO:1 or 2 any one or two few coresThuja acid fragment, and/or any one or two oligonucleotide fragments shown in SEQIDNO:3 or 4.
Genetic chip, refer to refer to by distinct methods by biomolecule (oligonucleotides, cDNA, genomicDNA, polypeptide,Antibody, antigen etc.) be bonded to the life forming on the solid phase mediators such as silicon chip, sheet glass (pearl), plastic sheet (pearl), gel, nylon membraneThing molecular lattice, its outstanding feature is microminiaturized, integrated, parallelization and high flux.
Preferably, it also comprises position probe, and position probe is the genetic fragment shown in SEQIDNO:13.
The present invention detects the kit of transmissible gastro-enteritis virus and/or porcine rotavirus, and it comprises aforesaid geneThe reagent of the gene of chip and amplification transmissible gastro-enteritis virus and/or porcine rotavirus; Wherein, amplification pig transmissible stomach and intestineThe reagent of scorching viral gene comprises primer pair shown in SEQIDNO:5~6 and/or SEQIDNO:7~8; Amplification pig colyliform diseaseThe reagent of virus gene comprises primer pair shown in SEQIDNO:9~10 and/or SEQIDNO:11~12.
Preferably, it also comprises primer pair shown in SEQIDNO:14~15.
Preferably, in described primer pair, upstream primer and SEQIDNO:6,8,10 shown in SEQIDNO:5,7,9,11,The mol ratio of downstream primer shown in 12 is 1:40.
The invention provides shown in SEQIDNO:1 or 2 any one or two oligonucleotide fragments and/or SEQAny one or two oligonucleotide fragments shown in IDNO:3 or 4, preparation detect transmissible gastro-enteritis virus and/orPurposes in the genetic chip of porcine rotavirus.
Preferably, described genetic chip also comprises position probe, and position probe is the gene sheet shown in SEQIDNO:19Section.
The invention provides primer pair and SEQIDNO:1 shown in SEQIDNO:5~6 and/or SEQIDNO:7~8Or any one or two oligonucleotide fragments shown in 2, and/or SEQIDNO:9~10 and/or SEQIDNO:11~12Shown in any one or two oligonucleotide fragments shown in primer pair and SEQIDNO:3 or 4 detect pig transmissible in preparationPurposes in the kit of marcy agent and/or porcine rotavirus; Wherein, primer pair is amplifing reagent; SEQIDNO:1~4 is detector probe.
Preferably, described kit also comprises shown in primer pair shown in SEQIDNO:14~15 and SEQIDNO:13Position probe.
Preferably, in described primer pair, upstream primer and SEQIDNO:6,8,10 shown in SEQIDNO:5,7,9,11,The mol ratio of downstream primer shown in 12 is 1:40.
Genetic chip of the present invention and kit can effectively detect transmissible gastro-enteritis virus and porcine rotavirus, sensitivityProperty is high, and the minimal detectable concentration of two-strain is 104Copies/ μ L, high specificity, consuming time short, detect fast, have goodApplication prospect.
The detailed description of the invention of form by the following examples, does further to say in detail to foregoing of the present inventionBright. But this should be interpreted as to the scope of the above-mentioned theme of the present invention only limits to following embodiment. All based on right of the present invention wantAsk the technology that content that secretary is carried realizes all to belong to scope of the present invention.
Brief description of the drawings
Fig. 1 detects distribution and the matrix arranging situation in four duplicate detection districts of microarray.
Fig. 2 forward primer and reverse primer are pressed the asymmetric PCR amplification gel electrophoresis figure of different proportion, and (1-11 is generation respectivelyTable 1:1,1:10,1:20,1:40,1:50,1:80,1:160,1:200, negative control).
Fig. 3 forward primer and reverse primer are pressed 1:1,1:10, and 1:20,1:40 ratio is examined chip hybridization figure altogether.
The common inspection chip scanning data of different probe under Figure 41-6h hybridization time.
The common inspection chip scanning data of different probe under Figure 54 4-52 DEG C hybridization temperature.
Fig. 6 specificity experimental result.
Fig. 7 sensitivity experiment result, A: dilution 105Doubly; B: dilution 106Doubly; C: dilution 107Doubly; D: dilution 108Doubly; E:PProbe dilution 109Doubly.
Detailed description of the invention
One, experiment material and instrument
Material is prepared
Strain:
Transmissible gastro-enteritis virus (TGEV), porcine rotavirus (PoRV strain), purchased from China Veterinary Drugs Supervisory Inst..
Reagent:
Total RNA extraction agent box is sky root (Beijing) biochemical technology Co., Ltd product;
PrimeScriptTMRTreagentKit (PerfectRealTime), for precious bioengineering (Dalian) limitedCompany's product; Plasmid extraction kit, a small amount of glue reclaim kit in a small amount, are OMEGA (U.S.) biotech company product.
Amino slide,2 × point sample buffer solution,Prehybridization buffer solution,HybridizationBuffer solution, all purchased from Baiao Science and Technology Co. Ltd., Shanghai; Cy3-dCTP:25nmol, PA53021, Lot300989, AmershamBiosciences, UK; Washing lotion I: 0.1%SDS2 × SSC; Washing lotion II: 0.1%SDS0.2 × SSC; Washing lotion III: 0.2 ×SSC; Washing lotion 4: distilled water.
Instrument:
Superclean bench: SW-CJ-2FD, SuZhou Antai Air Tech Co., Ltd.;
Ultra-pure water instrument: MilliQplus, method is domestic;
Grads PCR instrument: P × 2, Thermohybaid, the U.S. produces;
High speed freezing centrifuge 3K18 type:Germany produces;
Mini-SUB gel electrophoresis apparatus:Italy produces;
Electrophoresis apparatus: POWERPac300,Italy produces;
Gel electrophoresis images analytical system 2000 types:Italy produces;
Constant-temperature table: ThermoForma, the U.S. produces;
Nucleic acid-protein detector: Bio-RAD, SmartSpaeeTM3010;
Hybridization Oven: Thermo, the U.S. produces;
Multi-example fence, Multi-example fence paste tool, Multi-example fence cover plate, chip hybridization box is Beijing Bo AoshengThing company;
Brilliant core48, micro-array chip point sample system: CapitalbioCorporation, northJing Boao biotech firm;
Brilliant core10K micro-array chip scanner: CapitalbioCorporation, Beijing is rich difficult to understandBiotech firm;
Vacuum machine: SinBo, Hong Kong;
CO2 constant incubator: Thermo, the U.S. produces.
The preparation of embodiment 1 genetic chip of the present invention
1, material and instrument
With aforementioned experiment material and instrument.
2, experimental technique
The preparation of 2.1PCR primer, detector probe
(1) design cause of disease specific probe: by the transmissible gastro-enteritis virus of including in GenBnak, pig colyliformThe nucleotide sequence contraposition arrangement analysis of virus, selected conservative region sequence: TGEVN, S; PoRVNSP4, VP7. For conservative orderRow design detects multipair probe, selects the probe sequence of high specificity.
(2) Auele Specific Primer of designing probe sequence: for above-mentioned conservative probe sequence, utilize bioinformatics softwareDNAman, Primer5.0 etc. design Auele Specific Primer. Auele Specific Primer is synthesized by Shanghai bio-engineering corporation.
(3) probe preparation: with total RNA extraction agent box extraction transmissible gastro-enteritis virus, porcine rotavirus, in utilizationState Auele Specific Primer and two kinds of cause of disease nucleic acid are carried out to RT-PCR amplification, purifying concentration determination.
Reverse transcription system and condition (with reference to the method for PrimeScriptRTreagentKit)
Pcr amplification system and condition:
Reaction condition is as follows:
4, the screening of probe: will use gene chip sample applying instrument point in amination after synthetic probe dissolving appropriate dilutionOn glass substrate, make common inspection chip, carry out probe screening by cross experiment, finally obtain detecting DNA for the preparation of the present inventionSpecial, the sensitive probe that microarray is required: TGEVN, S; PoRVNSP4, VP7.
5, the genomic foundation of probe: the TGEVN, the S that glue are reclaimed to purifying; PoRVNSP4, VP7 pMD19-TVector connects, and linked system is pMD19-TVector0.5ul, and glue reclaims probe 5.0ul, and connecting fluid 4.5ul is totalAmount 10.0ul. 16h is carried out in coupled reaction at 16 DEG C; 10.0ul probe is connected to the 200ul that product adds Calcium Chloride Method to prepareIn competent cell DH5 α, mix gently rear ice bath 30min, after 42 DEG C of heat shock 90s, put into immediately the cooling 5min of ice bath, addEnter 800ulLB fluid nutrient medium, 37 DEG C of slight shaken cultivation 3h. Getting 200ul culture coats and contains X--Gal, IPTG, containsThe LB Agar Plating of ammonia benzyl, 37 DEG C of overnight incubation, select white colony increase bacterium cultivate and plasmid PCR identify and giveThe order-checking of precious biotech firm.
6, the genomic preservation of probe: the correct plasmid of order-checking is carried out to amplification cultivation, and with 20% skim milk conductProtective agent carries out freeze-drying, as for-80 DEG C of preservations.
The nucleotide sequence of primer and probe is as follows:
SEQIDNO:1(TGEV-N)
Source gene source: TGEV separated strain, SC-H strain
Gene size and sequence: 362bp
TTCCTGAAAGGTGGTTCTTCTACTACTTAGGTACTGGACCTCATGCAGATGCCAAATTTAAAGATAAATTAGATGGAGTTGTCTGGGTTGCCAAGGATGGTGCCATGAACAAACCAACCACGCTTGGTAGTCGTGGTGCTAATAATGAATCCAAAGCTTTGAAATTCGATGGTAAAGTGCCAGGCGAATTTCAACTTGAAGTTAATCAATCAAGAGACAATTCAAGGTCACGCTCTCAATCTAGATCTCGGTCTAGAAATAGATCTCAATCTAGAGGCAGGCAACAATTCAATAACAAGAAGGATGACAGTGTAGAACAAGCTGTTCTTGCCGCACTTAAAAAGTTAGGTGTTGACACAGAA
SEQIDNO:2(TGEV-S)
Source gene source: TGEV separated strain, SC-H strain
Gene size and sequence: 276bp
AGGCTTGACGAATTGAGTGCTGATGCACAAGTTGACAGGCTGATCACAGGAAGACTTACAGCACTTAATGCATTTGTGTCTCAGACTCTAACCAGACAAGCGGAGGTTAGGGCTAGTAGACAACTTGCCAAAGACAAGGTTAATGAATGCGTTAGGTCTCAGTCTCAGAGATTCGGATTCTGTGGTAATGGTACACATTTGTTTTCACTCGCAAATGCAGCACCAAATGGCATGATTTTCTTTCACACAGTGCTATTACCAACGGCTTATGAAACT
SEQIDNO:3(PoRV-NSP4)
The source gene source of clone gene: PoRV, OSU strain
Gene size and sequence: 270bp
GAACAGGTTACTACTAAGGATGAAATTGAACAACAGATGGACAGAATTGTTAAGGAGATGAGGCGTCAACTGGAAATGATTGACAAATTGACAACTCGTGAAATTGAACAAGTTGAATTACTTAAGCGTATACATGACAAATTAGCTGCTAGACCAGTTGATGCTATAGATATGTCGAAGGAATTTAATCAGAAAAATATTCGAACGCTAGATGAATGGGAAAGTGGAAAAAATCCATATGAACCGTCGGAAGTAACTGCGTCTATGTGA
SEQIDNO:4(PoRV-VP7)
Source gene source: PoRV, OSU strain
Gene size and sequence: 381bp
TTGAATGAATGGCTATGTAATCCAaTGgATATAATGCTATATTATTATCAGCAAACAGATGAAGCTAATAAATGGATATCAATGGGTACATCATGTACGATTAAAGTATGTCCTCTAAATACGCAGACTCTCGGGATAGGATGTTCGACTACAGACATAAATTCATTTGAAACAGTGGCCAATGCAGAGAAATTAGCTATAACTGATGTTGTCGATGGAGTCAATCATAAATTAGACGTAACAACGAGTACATGTACTATAAGAAATTGTAAAAAACTTGGACCAAGAGAAAATGTCGCTGTAATTCAGGTAGGAGGTCCAAACATACTCGACATAACAGCTGATCCAACAACTGCACCACAAACTGAAAGAATGATGCGT
SEQIDNO:5~6(TN-primer)
F5'-TTCCTGAAAGGTGGTTCTTCTACTA-3'
R5`–TTTTCTGTGTCAACACCTAACTTT-3`
SEQIDNO:7~8(TS-primer)
F5`-AGGCTTGACGAATTGAGTGCTGATG-3`
R5`-AGTTTCATAAGCCGTTGGTAATAGC-3`
SEQIDNO:9~10(NSP4-primer)
F5`-GAACAGGTTACTACTAAGGATG-3`
R5`-TCACATAGACGCAGTTACTTCC-3`
SEQIDNO:11~12(VP7-primer)
F5`-TTGAATGAATGGCTATGTAATCC-3`
R5`-ACGCATCATTCTTTCAGTTTGT-3`
The sequence (SEQIDNO:13) of gene location
SEQIDNO:14~15 (amplimer of gene location complementary series)
F:AAAGCGACGCAATGAGGCACT
R:GTTCCACGACCGCAACTGC
The structure of 2.2 standard plasmids
2.2.1 genomic extracting
Total RNA extracting adopts the total RNA extraction reagent box of day root, and with reference to explanation, concrete operation method is as follows:
1) directly get 200 μ L virus allantoic fluids in 1.5mL centrifuge tube, add 600 μ L lysates, fully vibration mixes;
2) homogenate sample is placed to 5min at 15-30 DEG C;
3) 4 DEG C, the centrifugal 5min of 12000r/min, is drawn onto supernatant in new centrifuge tube;
4) add 200 μ L chloroforms, the 15sec that acutely vibrates up and down, room temperature leaves standstill 3min;
5) 4 DEG C, the centrifugal 10min of 12000r/min, sample can produce layering, lightly the water colourless the superiors is forwarded toIn new pipe;
6) add 0.5 times of volume absolute ethyl alcohol, mix, transfer in adsorption column, 4 DEG C, the centrifugal 30sec of 12000r/min;
7) add 500 μ L protein liquid removals, 4 DEG C, the centrifugal 30sec of 12000r/min;
8) add 600 μ L rinsing liquids, leave standstill 2min, 4 DEG C, the centrifugal 30sec of 12000r/min; Repeat once
9) 4 DEG C, the centrifugal 2min of 12000r/min, discards residual liquid;
10) adsorption column is forwarded in RNase-Free centrifuge tube, add 50 μ LRNase-Free ultra-pure waters, room temperature leaves standstill2min, 4 DEG C, the centrifugal 2min of 12000r/min. The viral RNA that centrifugate obtain saves backup or directly carries out at-20 DEG CReverse transcription.
2.2.2 the RT-PCR of probe gene and pcr amplification
Taking the RNA of extracting as template, the synthetic cDNA taking Random6primers as primer, reaction system is as follows:
RT Enzyme Mix | 0.5μL |
Random 6primers | 0.5μL |
5×PrimeScript RT Buffer | 2.0μL |
RNA | 2.0μL |
RNase-Free ultra-pure water | 5.0μL |
Total | 10.0μL |
After being mixed, above-mentioned system carries out cDNA by program below synthetic: response procedures is 37 DEG C, 15min; 85 DEG C,5sec; 4 DEG C, preserve.
Taking the synthetic cDNA of reverse transcription as template, carry out PCR reaction, reaction system is as follows:
2×Taq PCR MasterMix | 12.5μL |
cDNA/DNA | 2.0μL |
Upstream Auele Specific Primer (25.0 μ mol/L) | 0.5μL |
Downstream Auele Specific Primer (25.0 μ mol/L) | 0.5μL |
Ultra-pure water | 9.5μL |
Total | 25.0μL |
Reaction condition is as follows:
After PCR, get respectively 7 μ L amplified production Ago-Gels and carry out electrophoretic analysis.
2.2.3 the glue of probe gene reclaims
The glue of probe gene reclaims, and adopts OMEGA glue recovery kit in a small amount, carries out reclaimer operation, step with reference to explanationAs follows:
1) get 20 μ LPCR products and carry out electrophoresis, 6V/cm, 25min, uviol lamp incision glue, weighs. According to kit explanationCarry out glue recovery;
2) add BindingBuffer (XP2) in the ratio of 1:1,55 DEG C of-60 DEG C of water-baths until glue all melt, during this timeEvery the 2-3min centrifuge tube that turns upside down;
3) liquid is added in adsorption column, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
4) add 300BindingBuffer (XP2), the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
5) add 700mL rinsing liquid SPW, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
6) room temperature 12000r/min sky, from 2min, is outwelled filtrate;
7) adsorption column is put in new centrifuge tube, adds 30mL elution buffer, room temperature leaves standstill 1min;
8) the centrifugal 2min of room temperature 12000r/min, gets 7 μ L recovery products and carries out electrophoresis, checking recovering effect, all the other recoveryProduct saves backup in-20 DEG C.
2.2.4 the connection of probe gene restructuring
Adopt pMD19-TSimpleVector clone kit, carry out the connection restructuring of probe gene, concrete steps are pressedExplanation is carried out. Linked system is as follows:
PMD19-T Simple carrier | 0.5μL |
Glue reclaims PCR product | 5.0μL |
Solution I | 4.5μL |
Total | 10.0μL |
4 DEG C of connections are spent the night, and connect product and are used for transforming DH5 α competent cell.
2.2.5 the Making and banking of competent cell
With reference to " molecular cloning experiment guide " Calcium Chloride Method[56]Preparation DH5 α competent cell, the competence preparing is thinBorn of the same parents are packed as 100 μ L/ pipes, are directly used in to transform or in-70 DEG C of preservations.
2.2.6 connect the conversion of product
100 μ L permissive cells are placed on ice, add wherein 10 μ L and connect product, ice bath 30min; 42 DEG C of water-bath heat shocks90s, the fast cooling 5min of ice bath; Add immediately the LB fluid nutrient medium (without operation on ice) of 600 μ L37 DEG C preheatings, 37 DEG C,150r/min shaken cultivation 1h, makes the recipient bacterium state that restore normal growth; Getting 150 μ L cultures evenly coats LB flat board and (contains100mg/mLAmp), dry, in 37 DEG C of about 12h of cultivation, picking colony is identified.
2.2.7 the qualification of probe plasmid bacterium and preservation
2.2.7.1 the DNA extracting of probe plasmid bacterium
Positive plasmid bacterium is inoculated in 5mLLB (containing 100mg/mLAmp) fluid nutrient medium to 37 DEG C of shaken cultivation 12h;Press Omega plasmid extraction kit illustration method extraction plasmid in a small amount. Concrete steps are as follows:
1) inhale 1mL bacterium liquid in centrifuge tube, the centrifugal 1min of room temperature 12000r/min, inhales and abandons supernatant;
2) add 250 μ LSolutionI (4 DEG C of storages), vibration suspends thalline;
3) add 250 μ LSolutionII, put upside down and mix lightly, leave standstill 2min;
4) add 350 μ LSolutionIII, gentleness is put upside down for several times to forming white flocky precipitate, room temperature 12000r/Min, centrifugal 10min;
5) liquid of previous step is proceeded in adsorption column, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
6) add 500 μ LBufferHB to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate;
7) add 700 μ LBufferWashBuffer to it, the centrifugal 1min of room temperature 12000r/min, outwells filtrate; RepeatOnce;
8) room temperature 12000r/min sky, from 2min, is loaded on pillar in a clean centrifuge tube, adds 30 μ L to itElutionBuffer, leaves standstill 2min, the centrifugal 1min of 12000r/min, and the centrifugate of collection is the DNA of extraction.
2.3.7.2 the PCR of probe plasmid bacterium qualification
The probe plasmid bacterium of extracting is carried out respectively to PCR qualification, do negative with the blank carrier of pMD19-TSimple simultaneouslyContrast, reaction system is as follows:
2×Taq PCR MasterMix | 7.5μL |
Upstream Auele Specific Primer (25.0 μ mol/L) | 0.5μL |
Downstream Auele Specific Primer (25.0 μ mol/L) | 0.5μL |
Plasmid (50 times of dilutions) | 2.0μL |
Ultra-pure water | 4.5μL |
Total | 15.0μL |
Response procedures is the same. React complete, get respectively 5 μ L and carry out electrophoretic analysis in 2.0% Ago-Gel.
2.2.8 the sequencing of probe plasmid bacterium and analysis
Adopt the two deoxidation end cessation method of Sanger to carry out sequence survey to being accredited as positive probe plasmid bacterium through PCRFixed, sequencing work transfers to Shanghai Jie Li Bioisystech Co., Ltd to complete.
Plasmid bacterium T/TGEV-N, T/TGEV-S, T/PoRV-NSP4, the T/PoRV-VP7 that must check order correct, comprises respectivelySEQIDNO:1(TGEV-N)、SEQIDNO:2(TGEV-S)、SEQIDNO:3(IPoRV-NSP4)、SEQIDNO:4(PoRV-VP7) described genetic fragment.
2.2.9 the preservation of probe plasmid bacterium
Probe plasmid bacterium correct sequencing is expanded and cultivated, then using 20% skimmed milk power as protective agent freeze-drying ,-70 DEG C of preservations.
2.3 chip preparations
(1) design of chip matrix: as shown in Figure 1, every chip is divided into Si Ge district, Si Ge district is four repeat arrays,Separate with hybridization fence, to carry out the hybridization reaction of four different samples simultaneously. Each array parameter is: every row's probe geneBe 9 sampling points with gene location, the spacing 650um of various kinds dot center, sampling point diameter is 220um.
(2) examine altogether the preparation of chip:
To comprise that by point sample buffering transmissible gastro-enteritis virus, porcine rotavirus probe, gene location are quantitatively to usingConcentration is 600ng/ul.
In 96 (384) hole load sample plate holes, add quantitative transmissible gastro-enteritis virus, pig wheel by chip design requirementShape virus probe, gene location, blank negative Quality Control gene, seal orifice plate, with gene chip sample applying system (MicroarrayPrintingSystem, SpotArrayTM16) on amination substrate, carry out contact point sample. Point sample envionmental humidityBe 70%.
The chip that makes of point is placed on the original position PCR instrument of 80 DEG C and dries 8h, then uses 60-80 DEG C of hydration-treated 4s,, ultravioletAfter crosslinked 30s, leave standstill washing 5min with 0.2%SDS washing lotion, centrifugal drying fast, vacuum seal, 4 DEG C save backup.
Embodiment 2 detection method of the present invention
1, the extracting of nucleic acid extracting viral RNA: use day root (Beijing) RNA of biochemical technology Co., Ltd to extract kit.By this kit, extracting RNA is described:
Get the pathological material of disease liquid 300ul handling well and be placed in centrifuge tube, add after 500ulRV liquid room temperature after thermal agitation 2minLeave standstill 5min;
Add 750ul isopropyl alcohol, shake up gently;
Pipette 800ul to adsorption column, the centrifugal 30s of 12000r at 4 DEG C;
Abandon liquid in collecting pipe, remaining lysate is moved in adsorption column, the centrifugal 30s of 12000r at 4 DEG C;
Abandon to collect after liquid and add 500ulRP liquid, the centrifugal 30s of 12000r removes protein at 4 DEG C;
Add 500ulW3 liquid, leave standstill after lmin, the centrifugal 15s of 12000r at 4 DEG C;
Repeating step previous step;
Adsorption column is transferred in another clean centrifuge tube, added 30ul ultra-pure water in adsorbed film central authorities, room temperature leaves standstill2min;
The centrifugal 2min of 12000 × g, centrifugate is the RNA extracting ,-70 DEG C save backup.
The reverse transcription of viral RNA: the reverse transcription kit that precious bioengineering (Dalian) Co., Ltd provides. Reverse transcription system10.0ul system:
Reverse transcription reaction program is:
42 DEG C, reverse transcription 30min; 85 DEG C, deactivation 30s; 4 DEG C of maintenances.
2, the asymmetric PCR mark of cDNA amplification, wherein the ratio of forward primer and reverse primer is 1:1,1:10,1:20,1:40,1:50,1:80,1:100,1:160,1:200. Attached gel electrophoretogram and chip hybridization analysis.
Add forward primer and operation later all in darkroom, to carry out. Carry out amplified reaction program for reaction by following programCondition, response procedures is as follows:
Experimental result is as shown in Fig. 2~3 and table 1:
Table 1 forward primer and reverse primer are pressed 1:1,1:10, and 1:20,1:40 ratio is examined chip scanning result altogether
Result shows, forward primer and reverse primer under 1:40 ratio, hybridization efficiency optimum. In kit of the present invention justMol ratio to primer and reverse primer is preferably 1:40.
3, detect
The prehybridization of chip: get the DNA microarray that preparation is preserved, in 95-100 DEG C of distilled water, sex change 1-2min. goes up therebetweenLower extracting is in order to avoid form bubble in surface of glass slide, puts immediately in 95% ethanol of precooling cooling rear centrifugal drying fast, by micro-battle arrayRow are placed in hybridization cabin, add prehybridization solution 25ul in microarray detection zone, cover glass is put down gently on it, in order to avoid form bubble,Make prehybridization solution uniform fold microarray detection zone, chip is placed in the wet box of sealing to prehybridization lh at 42 DEG C.
The hybridization of chip: absorb prehybridization solution, utilize the nucleic acid samples of asymmetric PCR mark amplification in 95 DEG C of sex change 3minAfter, put immediately cooling 5min in ice, then mix with the hybridization buffer of a certain amount of precooling, get this mixed liquor 50ul and be added to microarrayDetection zone, puts down gently on it with cover glass, and microarray is put into hybridization cabin in a wet box lucifuge hybridization, in 40,44,48,52Under DEG C hybridization temperature, hybridize 1,2,3,4,5, the 6h time. As shown in Figures 4 and 5, under 48 DEG C of hybridization temperatures, hybridize 3h hybridization timeCondition optimum.
Examine altogether the dry behaviour of washing of chip: after hybridization, remove gently the cover glass of chip, chip is placed on to slide frameUpper, analyze washing 5min by warm washing lotion 1, washing lotion 2, washing lotion 3, washing lotion 4, washing lotion 5 immediately. scanning analysis after centrifugal drying.Washing process completes in hint.
The common inspection chip gene chip scanning instrument of scanning analysis centrifugal drying4000 scannings detect. SweepRetouching parameter is Laserpower95%, PMT550, and resolution ratio 10um, scanning result is preserved figure with 16 TIFF and BMP formPicture.
Data output and processing: the yin and yang attribute of judging sample according to result.
Embodiment 3 specific tests
One, test method
Adopt the genetic chip prepared of embodiment 1, according to the method for embodiment 2 (forward primer and reverse primer moleRatio is 1:40, and hybridization temperature is 48 DEG C, and hybridization time is 3h), (pig breeding is comprehensive with breathing for detection PoRV, TGEV, PRRSVLevy virus), CSFV (CSFV), JEV (Latex agglutination test), 7 kinds of viruses of PRV (PRV), to verify thisThe specificity of invention genetic chip and kit.
Two, result
Experimental result as shown in Figure 6, adopts the inventive method to detect, and the testing result of PoRV, TGEV is positive, PRRSV,The testing result of CSFV, JEV, PRV is all negative.
The inventive method only can detect 2 kinds of viruses of the present invention, can not detect other viruses, and kit of the present invention and base are describedBecause of the high specificity of chip.
Embodiment 4 sensitivity tests
One, test method
Get plasmid T/TGEV-N, T/TGEV-S, T/PoRV-NSP4, T/PoRV-VP7 prepared by embodiment 1, nucleic acid-proteinInstrument is measured the OD of each plasmid260, being converted into the copy number of DNA, concentration is respectively T/TGEV-N (1.26 × 011copies/μL)、T/TGEV-S(1.22×1011copies/μL)、T/PoRV-NSP4(1.39×1011copies/μL),T/PoRV-VP7(1.46×1011Copies/ μ L), do respectively 101、102、103、104、105、106、107、108、109After doubling dilution, adopt embodiment 1 to makeStandby genetic chip, according to the method detection of embodiment 2, (molar ratio of forward primer and reverse primer is 1:40, hybridization temperatureDegree is 48 DEG C, and hybridization time is 3h).
Two, result
Result is as shown in Fig. 7 and table 2:
The fluorescent scanning signal results of the different plasmid concentration extension rates of table 2
Result shows, T/TGEV-N plasmid minimal detectable concentration is 1.26 × 104Copies/ μ L, TGEV-S plasmid are minimumDetectable concentration 1.22 × 104Copies/ μ L, the minimal detectable concentration of TGEV is 104Copies/ μ L; T/PoRV-NSP4 plasmidMinimal detectable concentration 1.39 × 104Copies/ μ L, T/PoRV-VP7 plasmid minimal detectable concentration 1.46 × 104copies/Μl,The minimal detectable concentration that is PoRV is 104copies/μL。
Experimental result explanation, adopts kit of the present invention and genechip detection, and the minimal detectable concentration of TGEV, PoRV is equalBe 104Copies/ μ L, highly sensitive.
Embodiment 5 replica tests
1, experimental technique
The repeatability of individual chip: get a chip preparing and hybridize, after scanning analysis, immediately by this chip againInferiorly hybridize next time, continue scanning analysis, so repeat N time. Evaluate the highest number of times of reusing of this detection microarray.
2, experimental result
The repeated result of individual chip shows, this genetic chip can reuse at most 7 times, good stability.
Embodiment 6 adopts genechip detection pathological material of disease of the present invention
One, detection method
1, taking and pretreatment of pathological material of disease:
1) taking of pathological material of disease: collected from Mianyang, Sichuan Province, Aba Mao County, Pengzhou, Anyue, Ziyang, Meishan, Guangan, climbed56 parts, branch flower, Palestine and China Tongjiang have Small Intestine of Piglets and the content of symptom of diarrhea.
2) pretreatment of pathological material of disease:
The processing of the dirty tissue of device: the pathological material of disease gathering is ground with sterilizing PBS, act on 30 minutes, multigelation 3 times at 37 DEG CAnd use ultrasonic wave processing, and centrifugal, supernatant-20 DEG C preservation.
2, (molar ratio of forward primer and reverse primer is 1:40, and hybridization temperature is in the method detection of employing embodiment 248 DEG C, hybridization time is 3h)
Two, testing result
Testing result is as shown in the table:
The testing result of table 356 part small intestine sample
Infection type | Examine altogether chip (Y) | Detect infection rate |
TGEV | 4/56 | 7% |
PoRV | 2/56 | 3% |
Add up to | 6/56 | 10% |
Adopt kit of the present invention and genetic chip, 4 duplicate samples contain transmissible gastro-enteritis virus, and 2 duplicate samples containPorcine rotavirus, all the other samples do not detect.
Experimental result explanation, kit of the present invention and genetic chip can effectively detect transmissible gastro-enteritis virus and pigRotavirus.
To sum up, genetic chip of the present invention and kit can effectively detect transmissible gastro-enteritis virus and pig colyliform diseasePoison, high specificity, highly sensitive, consuming time short, detects fast, has a good application prospect.
Claims (10)
1. a genetic chip that detects transmissible gastro-enteritis virus and porcine rotavirus, is characterized in that: it comprises solid phaseCarrier and be fixed on the probe on solid phase carrier; Described probe is any one or two widows shown in SEQIDNO:1 or 2Any one or two oligonucleotide fragments shown in nucleotide fragments and SEQIDNO:3 or 4.
2. genetic chip according to claim 1, is characterized in that: it also comprises position probe, and position probe is SEQGenetic fragment shown in IDNO:13.
3. a kit that detects transmissible gastro-enteritis virus and porcine rotavirus, is characterized in that: it comprises that right willAsk the reagent of the gene of the genetic chip described in 1 or 2 and increase transmissible gastro-enteritis virus and porcine rotavirus; Wherein, expandThe reagent that increases transmissible gastro-enteritis virus gene comprises primer shown in SEQIDNO:5~6 and/or SEQIDNO:7~8Right; The reagent of amplification transmissible gastro-enteritis virus gene comprises SEQIDNO:9~10 and/or SEQIDNO:11~12Show primer pair.
4. kit according to claim 3, is characterized in that: it also comprises primer shown in SEQIDNO:14~15Right.
5. kit according to claim 3, is characterized in that: in described primer pair, and SEQIDNO:5,7,9,11The mol ratio of showing downstream primer shown in upstream primer and SEQIDNO:6,8,10,12 is 1:40.
Shown in any one or two oligonucleotide fragments and SEQIDNO:3 or 4 shown in 6.SEQIDNO:1 or 2 arbitrarilyOne or two oligonucleotide fragments detect in the genetic chip of transmissible gastro-enteritis virus and porcine rotavirus in preparationPurposes.
7. purposes according to claim 6, is characterized in that: described genetic chip also comprises position probe, position probeIt is the genetic fragment shown in SEQIDNO:13.
Shown in 8.SEQIDNO:5~6 and/or SEQIDNO:7~8 shown in primer pair and SEQIDNO:1 or 2 any oneOr primer pair and SEQ shown in two oligonucleotide fragments and SEQIDNO:9~10 and/or SEQIDNO:11~12Any one or two oligonucleotide fragments shown in IDNO:3 or 4 detect transmissible gastro-enteritis virus and pig wheel in preparationPurposes in the kit of shape virus; Wherein, kit comprises amplifing reagent, and amplifing reagent comprises primer pair, SEQIDNO:1~4 is detector probe.
9. purposes according to claim 8, is characterized in that: described kit also comprises shown in SEQIDNO:14~15Position probe shown in primer pair and SEQIDNO:13.
10. purposes according to claim 8, is characterized in that: in described primer pair, shown in SEQIDNO:5,7,9,11The mol ratio of downstream primer shown in upstream primer and SEQIDNO:6,8,10,12 is 1:40.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410512665.0A CN104232799B (en) | 2014-09-29 | 2014-09-29 | Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410512665.0A CN104232799B (en) | 2014-09-29 | 2014-09-29 | Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104232799A CN104232799A (en) | 2014-12-24 |
CN104232799B true CN104232799B (en) | 2016-05-25 |
Family
ID=52221689
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410512665.0A Active CN104232799B (en) | 2014-09-29 | 2014-09-29 | Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104232799B (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1616682A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig virus disease and its use |
-
2014
- 2014-09-29 CN CN201410512665.0A patent/CN104232799B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1616682A (en) * | 2002-12-12 | 2005-05-18 | 山东澳兰生物工程研究院 | Diagnostic gene chip for pig virus disease and its use |
Non-Patent Citations (1)
Title |
---|
TGEV-PEDV-PRV基因芯片探针的构建;邓俊花等;《中国畜牧兽医学会畜牧兽医生物技术学分会暨中国免疫学会兽医免疫分会第七次研讨会论文集》;20080701;383-386页 * |
Also Published As
Publication number | Publication date |
---|---|
CN104232799A (en) | 2014-12-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104293977B (en) | The genetic chip of detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus and kit | |
CN107630109A (en) | A kind of fluorescence quantification PCR primer and kit for detecting Novel pig acute diarrhea syndrome coronavirus | |
CN104232801B (en) | Detection Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and the kit of porcine rotavirus | |
CN104328218A (en) | Nucleic acids of liquid-phase gene chip for synchronously detecting five porcine viruses and detection method thereof | |
CN104946795B (en) | Primer, probe and kit for Site Detection various serotype foot and mouth disease virus | |
CN104232802B (en) | Detect the test kit of avian infectious laryngotracheitis virus, newcastle disease virus and avian infectious bronchitis virus | |
CN104232800A (en) | Gene chip and kit for detecting porcine japanese encephalitis virus, swine fever virus and porcine reproductive and respiratory syndrome virus | |
CN105273065B (en) | 1 type duck hepatitis A virus VP2 recombinant protein of one kind, ELISA kit and preparation method thereof | |
CN104293976B (en) | Gene chip and kit for detecting pig epidemic type B encephalitis virus and/or pig porcine reproductive and respiratory syndrome virus | |
CN104611465A (en) | Fluorogenic quantitative PCR kit for detecting swine transmissible gastroenteritis virus | |
CN108546779A (en) | RPA- Sidestream chromatographies detection primer, probe and the kit of bovine rota | |
CN101118234B (en) | Method for detecting bacillus coli inducing diarrhoea and hydropsy during pig weaning period and reagent kit thereof | |
CN104293981A (en) | Gene chip and kit for detecting swine epidemic encephalitis B viruses (SEEBVs) and/or swine fever viruses (SFVs) | |
CN111197110A (en) | RPA-FLD method for detecting feline panleukopenia virus | |
CN106755572A (en) | I types DHV and duck plague virus double fluorescent quantitative PCR method | |
CN108330214A (en) | The quickly RPA primers and reagent and kit of detection bovine leucosis provirus | |
CN103146846A (en) | Single standard product-based four-color fluorogenic quantitative PCR (Polymerase Chain Reaction) method and kit | |
CN104293979B (en) | Avian infectious bronchitis virus and/or the genetic chip of avian infectious laryngotracheitis virus and kit | |
CN105330727B (en) | 1 type duck hepatitis A virus VP4 recombinant protein of one kind, ELISA kit and preparation method thereof | |
CN104232803B (en) | Detect gene chip and the test kit of newcastle disease virus, avian infectious bronchitis virus and avian infectious laryngotracheitis virus | |
CN104232799B (en) | Detect genetic chip and the kit of transmissible gastro-enteritis virus and/or porcine rotavirus | |
CN104263856B (en) | Detect genetic chip and the kit of Porcine epidemic diarrhea virus and/or transmissible gastro-enteritis virus | |
CN104263855B (en) | Detect genetic chip and the kit of Porcine epidemic diarrhea virus and/or porcine rotavirus | |
CN104862423B (en) | The visualization genetic chip and kit of porcine pseudorabies virus, pig parvoviral and porcine circovirus 2 type | |
CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |