CN104208665A - Edwardsiella tarda subunit vaccine and its preparation method and use - Google Patents
Edwardsiella tarda subunit vaccine and its preparation method and use Download PDFInfo
- Publication number
- CN104208665A CN104208665A CN201410200936.9A CN201410200936A CN104208665A CN 104208665 A CN104208665 A CN 104208665A CN 201410200936 A CN201410200936 A CN 201410200936A CN 104208665 A CN104208665 A CN 104208665A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- tarda
- fbaa
- fructose
- fish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to an edwardsiella tarda subunit vaccine and its preparation method and use. The invention discloses a novel antigen fructose 1,6-diphosphate aldolase (FbaA). The novel antigen fructose 1,6-diphosphate aldolase (FbaA) has good immunogenicity and can be used for preparation of a wide-spectrum protective vaccine. The edwardsiella tarda subunit vaccine is an economic, effective and safe vaccine for preventing edwardsiella tarda-caused fish diseases and other pathogenic bacterium-caused fish diseases.
Description
Technical field
The invention belongs to biotechnology and field of immunology, more specifically, the present invention relates to a kind of Edwardsiella tarda subunit vaccine and its preparation method and application.
Background technology
Along with the continuous stable development of fishery cultivating, various disease problem becomes increasingly conspicuous, and cultured output and growth is caused to having a strong impact on.In China, sudden, the explosive disease of the seawater cage culture grown up in recent years and industrialized culture Fish frequently occurs.At present, the sea-farming Mean Death loss rate of China is more than 30%, and annual economic loss reaches 16,000,000,000 yuan, and disease problem has become the key factor that restriction mariculture industry develops in a healthy way.
For the generation of various disease, be that the chemotherapy of representative had once played positive role to the control of disease and control with antibiotic.But the negative effects such as the drug residue of the environmental pollution that this Disease management measure causes, a large amount of appearance of drug resistance cause of disease, aquatic products are on the rise.At European Union, America & Canada, the chemicals based on antibiotic is disabled gradually in culture fishery.Relative to antibiotic, vaccine pointed strong, disease-resistant cycle is long, can lifetime immunity, Be very effective and control advantage initiatively.Based on pathogen cell inactivation body, the inactivated vaccine of form is prevented and treated for aquiculture disease and is provided effective means; but inactivated vaccine generally has the technology applied defect of administration inconvenience (drug administration by injection just has good immune protective efficiency); for need immune thousands of quantity fish culture industry very inconvenience, administration cost often can not be born by culture fishery.And, serious fry is occurred for disease and juvenile fish then cannot implement drug administration by injection, meanwhile, to many disease inactivated vaccines often poor effect or invalid.Everything brings obstruction all to the extensive use of aquiculture disease immune protection technology.
The industrial character of culture fishery requires the necessary economy of disease prevention techniques, application implementation conveniently.Therefore, the exploitation of vaccine product is except the technical requirement of high-titer, and immune cost must be cheap, can not exceed the ability to bear of aquaculture.Subunit vaccine, because having immunizing potency high (can reduce dosage), with low cost, the new technique advantage that can develop broad-spectrum vaccine (live bacterial vaccines often has intersecting protective), has become the hot-point and frontier field of current vaccine research used for aquiculture and exploitation in the world.
Edwardsiella is the pathogen causing a class of fresh water, Principal Bacterial Diseases of Mariculture Fish common, specifically be divided into Edwardsiella tarda (Edwardsiella tarda), Edwardsiella ictaluri (Edwardsiella ictaluri) and guarantor section tarda (Edwardsiella hoshinae).The Fish hueppe's disease caused by it is referred to as tarda disease (Edwardsiellosis).It is wide that this disease propagates area, without obviously seasonal, infection rate and mortality rate high, the kind of harm is many, has Cyprinus carpio, tilapia, anguilla japonica, Mugil cephalus, salmon, Squaliobarbus ourriculus, and the great majority such as Flounder Pleuronectidae have the fingerling of higher economic worth.In addition, Edwardsiella tarda also infects shellfish, reptiles, amphibian, birds, mammals.Merit attention, Edwardsiella tarda or a kind of important infecting both domestic animals and human cause of disease bacterium, it is unique member infecting the mankind in Edwardsiella.At present, the pathogen that the sick disease of China's cultured fishes tarda is more serious is mainly Edwardsiella tarda, and has the grave danger that there is pathogen and shift to human body.Effective prophylactico-therapeutic measures of this disease is there is no at present in China.
Because still lack systematic understanding to Edwardsiella tarda pathogenesis, its many hosts adaptability also causes the control of this bacterium particularly difficult.At present, the control of tarda disease mainly relies on antibiotic use, based on chemotherapy.Because antibiotic can constantly be tolerated, their application in aquaculture are more and more restricted.In addition, the Edwardsiella tarda of causing a disease usually is found there is natural resistance to multiple antibacterial element complex, adds the difficulty of the treatment based on antibiotic.By contrast, from a long-term viewpoint, vaccine is the safer more effective method of Disease epizootic.Because the antigenicity of inactivated vaccine is more weak, and the safety of attenuated vaccine is unstable, for this reason, develops easy to use, efficient, easy commercialization large-scale production, effective subunit vaccine, particularly necessary to aquatic products industry.
Given this, this area, in the urgent need to researching and developing novel respond well immune vaccine, makes cultured fishes possess the immunocompetence of good antagonism pathogenic bacterium.
Summary of the invention
The object of the present invention is to provide a kind of Edwardsiella tarda subunit vaccine and its preparation method and application.
In a first aspect of the present invention, provide the purposes of tarda fructose 1,6-diphosphate aldolase (FbaA), for the preparation of the vaccine of protection Fish from pathogenic infection.
In a preference, the aminoacid sequence of described tarda fructose 1,6-diphosphate aldolase (FbaA) is as shown in SEQ ID NO:1.
In another preference, described pathogenic bacterium include, but is not limited to: Edwardsiella tarda (E.tarda), Vibrio anguillarum (V.anguillarum), Aeromonas hydrophila (A.hydrophila), Vibro harveyi (V.harveyi), vibrio alginolyticus (V.alginolyticus).
In another aspect of this invention, provide a kind of and protect Fish from the vaccine of pathogenic infection, described vaccine comprises: the immunological adjuvant of tarda fructose 1,6-diphosphate aldolase and effective dose.
In a preference, described tarda fructose 1,6-diphosphate aldolase and the ratio of immunological adjuvant are 1:(1-5); Preferably ratio is 1:(1.5-4); More preferably ratio is 1:(2-3); More preferably 1:(2-2.5 further).
In another preference, described immunological adjuvant is MONTANIDE
tMiSA763A.
In another preference, in described vaccine, also comprise pharmaceutically acceptable carrier.
In another aspect of this invention, provide the method for the vaccine described in preparation, described method comprises: mixed by the immunological adjuvant of tarda fructose 1,6-diphosphate aldolase and effective dose, the vaccine described in acquisition.
In a preference, described tarda fructose 1,6-diphosphate aldolase and the ratio of immunological adjuvant are 1:(1-5); Preferably ratio is 1:(1.5-4); More preferably ratio is 1:(2-3); More preferably 1:(2-2.5 further).
In another preference, described immunological adjuvant is MONTANIDE
tMiSA763A.
In another aspect of this invention, provide a kind of and protect Fish from the test kit of pathogenic infection, in described test kit, comprise described vaccine.
Other side of the present invention, due to disclosure herein, is apparent to those skilled in the art.
Accompanying drawing explanation
The aminoacid sequence of Fig. 1, Edwardsiella tarda recombinant antigen FbaA.
SDS-PAGE figure after Fig. 2, recombinant antigen FbaA expression and purification of the present invention.
Relative immunity protection after Fig. 3, recombinant antigen FbaA of the present invention immunity Brachydanio rerio is analyzed.
Relative immunity protection after Fig. 4, recombinant antigen FbaA of the present invention immunity turbot is analyzed.
For the antiserum analysis of FbaA and other fish bacterial pathogenses after Fig. 5, recombinant antigen FbaA of the present invention immunity turbot.
Relative immunity protection for multiple fish bacterial pathogens after Fig. 6, recombinant antigen FbaA of the present invention immunity Brachydanio rerio is analyzed.
Fig. 7, Edwardsiella tarda candidate antigens protein screening process based on reverse vaccinology.
Detailed description of the invention
The present inventor is through a large amount of screening studies, and find a kind of novel antigens fructose 1,6-diphosphate aldolase (FbaA), it has good immunogenicity, can prepare broad spectrum type protectiveness vaccine.The tarda disease that the present invention is cultured fishes and the fish disease that other pathogenic bacterium cause provide safety, effectively, and economic vaccine.
FbaA
Fructose 1,6-diphosphate aldolase (FbaA) is a kind of albumen participating in tarda glycolytic pathway, and molecular weight is about 40kD.It is the enzyme in glycolytic pathway, fructose 1,6-diphosphate can be resolved into glyceraldehyde 3-phosphate and dihydroxyacetone phosphate.It studies as glycolytic pathway relevant enzyme by prior art usually, also has research using it target spot as pharmaceutical analysis.But, in view of its glycolytic pathway correlation function, usually it is believed that it is expressed in bacterial cell, and play a role in cell.
The present inventor is devoted to the research of fish immunity protective antigen, finds in further investigation, and FbaA can be expressed by tarda and reach outside the born of the same parents of bacterial cell.More unexpectedly, also find that it has good immunogenicity.FbaA albumen is prepared into vaccine, can available protecting Fish from the infection of Edwardsiella tarda and other fish bacterial pathogenses, effectively prevent and treat the generation that Edwardsiella tarda disease waits fish disease.
FbaA albumen can be: the albumen of the aminoacid sequence shown in (a) SEQ ID NO:1; Or (b) by aminoacid sequence shown in SEQ ID NO:1 through one or more (preferred 1-20, more preferably 1-10, more preferably 1-5; More preferably 1-3) replacement of amino acid residue, disappearance or interpolation form, and have the albumen derivative by (a) of SEQ ID NO:1 identical function; Or the bioactive fragment of the albumen of aminoacid sequence shown in (c) SEQ ID NO:1.
The implication of the bioactive fragment of FbaA albumen refers to as a peptide species, and it still can keep all or part of function of the FbaA albumen of total length.Under normal circumstances, described bioactive fragment at least keeps the activity of the total length FbaA of 50%.Under still more preferential conditions, described active fragment can keep the activity of 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% of total length FbaA.FbaA or its bioactive fragment comprise the alternative sequence of a part of conserved amino acid, and described sequence of replacing through aminoacid does not affect its activity or remains the activity of its part.Suitable replacement aminoacid is technology well known in the art, and described technology can be implemented easily, and guarantees the biological activity not changing gained molecule.In general, change single amino acids in the unwanted regions of a peptide species and substantially can not change biological activity.
The encoding gene of FbaA albumen easily obtains, and when albumen is known, those skilled in the art all understand the encoding gene how obtaining FbaA, such as, the mode of pcr amplification can be adopted to obtain from genome, or adopt the mode of chemosynthesis.
In a particular embodiment of the present invention, FbaA protein vaccine is carried out immunoassay on Brachydanio rerio and turbot, all there is higher immune protective efficiency.
In addition, the present inventor also finds, FbaA albumen has the conservative of height in multiple pathogen, and on zebra fish model, show good cross immunity effect.Our research of Edwardsiella tarda antigen that is found to be of FbaA provides target spot.
FbaA vaccine and preparation thereof
The present invention also provides a kind of compositions, and preferably compositions is vaccine, and described vaccine refers to the vaccine that can be used for preventing pathogenic infection will obtained after FbaA albumen of the present invention and adjuvant mixing.Usually also comprise other pharmaceutically acceptable carrier in described compositions, described vaccine can be used for Fish, usually can be made into the form of injection.
Described " pharmaceutically acceptable carrier " refers to the carrier being used for the treatment of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carrier is well known to those of ordinary skill in the art.Pharmaceutically acceptable carrier can contain liquid, as water, saline, buffer in the composition.In addition, in these carriers, also may there is complementary material, as filler, lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance etc.
In the present invention, described " pathogenic bacterium " refer to and infect the bacterioid of Fish, its surface expression FbaA or albuminoid or homologous protein, can be suppressed by the antibodies of anti-FbaA.As optimal way of the present invention, described pathogenic bacterium include but not limited to: Edwardsiella tarda (E.tarda), Vibrio anguillarum (V.anguillarum), Aeromonas hydrophila (A.hydrophila), Vibro harveyi (V.harveyi), vibrio alginolyticus (V.alginolyticus).
As optimal way of the present invention, described vaccine can comprise: the immunological adjuvant of tarda fructose 1,6-diphosphate aldolase and effective dose.
Multiple adjuvant for fish immunity can be applicable in the present invention.As optimal way of the present invention, described immunological adjuvant is MONTANIDE
tMiSA763A, MONTANIDE
tMiSA780VG and MONTANIDE
tMiMS1312VG PR.
As optimal way of the present invention, described tarda fructose 1,6-diphosphate aldolase and the ratio of immunological adjuvant are 1:(1-5); Preferably ratio is 1:(1.5-4); More preferably ratio is 1:(2-3); More preferably 1:(2-2.5 further), described ratio has good administering effect, can produce the antibody of more efficient valency in fish body.
After the purposes obtaining tarda fructose 1,6-diphosphate aldolase described in cicada, method well known in the art can be adopted by described vaccine administration in Fish.Include but not limited to: subcutaneous injection, intramuscular injection, percutaneous give.
Antigen effective dose of the present invention can change with order of severity of the pattern of administration and disease to be treated etc.The selection of preferred effective dose can be determined according to various factors by those of ordinary skill in the art.Described factor includes but not limited to: pharmacokinetic parameter such as bioavailability, metabolism, the half-life etc. of described tarda fructose 1,6-diphosphate aldolase; The approach etc. of the kind of fish, body weight, immune state, administration.Usually, when antigen of the present invention gives with the dosage of about 0.1-100 μ g/ tail (preferably 0.5-50 μ g/ tail), gratifying effect can be obtained.When for during Brachydanio rerio preferably about 1.5 μ g/ tails, when for preferred about 1.5 μ g/ tails during turbot, other Fish can refer to the body weight of Brachydanio rerio and turbot to change injected dose.
The Edwardsiella tarda protective antigen FbaA that the present invention builds, the experimental result that immune Brachydanio rerio and turbot obtain illustrates that antigen protein FbaA has immunity preferably and Cross immunogenicity effect.Meanwhile, for subunit vaccine exploitation, the preferred target spot that FbaA also will design as follow up vaccine.
Vaccine of the present invention, can be prepared to the form of medicine box or test kit, so that those skilled in the art use.Also comprise operation instructions wherein alternatively.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, conveniently condition such as J. Pehanorm Brooker etc. is write usually, Molecular Cloning: A Laboratory guide, the third edition, Science Press, the condition described in 2002, or according to the condition that manufacturer advises.
The preparation of embodiment 1, recombinant protein vaccine
Experiment material
1, bacterial strain and plasmid
Escherichia coli Escherichia coli DH5 α, E. coli BL21 (DE3) are purchased from TIANGEN Biotech (Beijing) Co., Ltd., Edwardsiella tarda E.tarda EIB202, preserving number is: CCTCC-M208068 (Edwardsiella tarda EIB202, Xiao Jingfan etc., " Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China ", " Aquaculture Research " Vol.40,2009), Vibrio anguillarum V.anguillarum MVM425 (is located away from Lateolabrax japonicus, Wu, H.Z., Ma, Y., Zhang, H.Z.and Zhang, Y.X. (2004) Complete sequence of virulence plasmid from the marine fish pathogen Vibrio anguillarum strain MVM425and location of its replication region.J Appl Microbio97, 1021-1028), Aeromonas hydrophila A.hydrophila LSA34 (is located away from fresh-water fishes, Zhou, L.Y., Wang, X.H., Liu, Q., Wang, Q.Y., Zhao, Y.and Zhang, Y.X. (2010) A novel multivalent vaccine based on secretary antigen-delivery induces protective immunity against Vibrio anguillarum and Aeromonas hydrophila.J Biotechnol146, 25-30), Vibro harveyi V.harveyi VIB647 (is located away from castor, Zhang, X.H., Meaden, P.G.and Austion, B. (2001) Duplication of hemolysin genes in a virulent isolate of Vibrio harveyi.Appl Environ Microbiol67, 3161-3167.), vibrio alginolyticus V.alginolyticus EPGS020401 (is located away from malaber reefcod, Rui, H.P., Liu, Q., Wang, Q.Y., Ma, Y., Liu, H., Shi, C.B.and Zhang, Y.X. (2009) Role of alkaline serine protease Asp in Vibrio alginolyticus virulence and regulation of its expression by LuxO-LuxR regulatory system.J Microbiol Biotechnol19, 431 – 438), pET28a (+) carrier is purchased from precious biological engineering (Dalian) company limited.
2, culture medium and condition of culture
LB culture medium: 1% (w/v) peptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl.Solid medium adds 2% (w/w) agar.121 DEG C of autoclaving 20min.For the cultivation of escherichia coli, Edwardsiella tarda E.tarda EIB202, Aeromonas hydrophila A.hydrophila LSA34.
LB20 culture medium: 1% (w/v) peptone, 0.5% (w/v) yeast extract, 2% (w/v) NaCl.Solid medium adds 2% (w/w) agar.121 DEG C of autoclaving 20min.For the cultivation of Vibrio anguillarum V.anguillarum MVM425, Vibro harveyi V.harveyi VIB647, vibrio alginolyticus V.alginolyticus EPGS020401.
DHL culture medium: 60g deoxycholate hydrogen sulfide lactose agar culture medium is dissolved in 1L deionized water, repeatedly boils and is dissolved to clarification, make flat board after cooling.
Condition of culture:
Escherichia coli shaking table concussion in 37 DEG C of LB solid medium middle plateform quiescent culture or LB fluid medium is cultivated.
Edwardsiella tarda and Aeromonas hydrophila are inoculated in LB fluid medium, 30 DEG C, 200r/min spends the night jolting; Vibrio anguillarum, Vibro harveyi, vibrio alginolyticus are inoculated in LB20 culture medium, 30 DEG C, 200r/min spends the night jolting.Edwardsiella tarda liquid is coated with or lines on DHL solid medium, is inverted in incubated overnight in 30 DEG C of constant incubators, DHL solid medium is formed the translucent evil mind bacterium colony in edge; Aeromonas hydrophila is coated with or lines on LB solid medium, is inverted in incubated overnight in 30 DEG C of constant incubators; Vibrio anguillarum, Vibro harveyi, vibrio alginolyticus are coated with or line on LB20 solid medium, are inverted in incubated overnight in 30 DEG C of constant incubators.
3, experiment reagent
Conventional molecular biological reagent and test kit are purchased from TIANGEN Biotech (Beijing) Co., Ltd.; Restricted enzyme BamH I, Xho I are purchased from precious biological engineering (Dalian) company limited.Protein expression and purification conventional reagent, purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Affinity chromatography medium Ni-Sepharose FF is purchased from GE Healthcare.The monoclonal antibody of Chinese People's Anti-Japanese Military and Political College brill IgM is purchased from Aquatic Diagnostics, and sheep anti mouse monoclonal antibody is purchased from Tiangen.
Physiology sea water formula: prepare 1 liter of physiology sea water, often liter contains: NaCl20g, MgCl
22H
2o4.8g, MgSO
47H
2o3.5g, KCl0.7g, NaHCO
30.11g, CaCl
22H
2o1.208g.
4, antigenic protein gene sequence
According to E.tarda EIB202 whole genome sequence, obtain the DNA sequence of corresponding fbaA gene.Its aminoacid sequence is shown in Fig. 1 (SEQ ID NO:1).
5, antigen protein primer
With the Auele Specific Primer of Primer Premier5 software design fbaA gene, primer, through the synthesis of Shanghai bio-engineering corporation, is PAGE purified product.
fbaAF：CGCGGATCCATGTCTAAAATCTTTGACTTT(BamH?I)(SEQ?ID?NO:2)；
fbaAR：CCGCTCGAGCAGCACGTCGATGCAG(Xho?I)(SEQ?ID?NO:3)。
6, laboratory animal and immunoreagent
Brachydanio rerio, is purchased from Shanghai plant, and the long 4cm of body, body weight is about 0.4g.First be placed in aquarium endoadaptation before experiment and raise and train 2 weeks, after move to fish feeding system adapt to 2 weeks.Water body is changed in flowing every day of fish feeding system, cultivation temperature about 22 DEG C.Feed every day 2 times and remove feces residue in time.
Turbot, is purchased from Weifang, Shandong plant, body weight 30g, and the long 10cm of body is placed in tank endoadaptation and raises and train 2 weeks, for subsequent use.In experiment, every day uses natural sea-water replace 2/3 volume aquaculture water and inflate, water temperature 14-16 DEG C.Cultivation program management conveniently before and after immunity inoculation.
Fish anesthetis tricaine methanesulphonate (MS-222) is purchased from Sigma company.Fish adjuvant MONTANIDE
tMiSA763A, buys in French SEPPIC company.
Embodiment 1, screening for the preparation of the antigen of vaccine
The present invention utilizes reverse vaccinology method to carry out candidate vaccine screening in early stage.
Based on reverse vaccinology ultimate principle, multiple bioinformatics software is adopted to analyze Edwardsiella tarda whole genome sequence.
Edwardsiella tarda EIB202 is separated from Yantai, Shandong turbot lesion tissue, carries out its genome sequencing, this bacterium genome sequence total length 3.7Mbp, about containing 3500 open reading frame, comprising the plasmid be made up of 53 open reading frame.Candidate antigens analysis of protein based on whole genome sequence predicts that flow process is as Fig. 7.
3486 open reading frame are obtained to after Edwardsiella tarda virulent strain EIB202 complete genome sequencing, utilize transbilayer helix and the cross-film number of times of its coded product of TMMHM software analysis, remove the albumen that transmembrane helix structure is greater than 2, PSORT program is utilized to carry out protein subcellular positioning analysis further, final acquisition protein 53 0, comprises cell membrane outer protein, cytoplasmic membrane protein and secretory protein etc.
Gained candidate albumen is screened, analyzes the adhesion situation of above-mentioned albumen simultaneously; Analyze the binding ability of each albumen and Brachydanio rerio and turbot MHC I molecule, avoid producing autoimmune; The homologous protein that screening Immune efficiency is high, final acquisition 275 candidate antigens albumen.
With the immune protective rate of Brachydanio rerio Animal Experimental Analysis candidate antigens albumen.PBS buffer dilution candidate antigens protein solution is to 1mg/ml, and candidate antigens albumen mixes with the ratio of 3:7 with ISA763A oil adjuvant, makes final immunizing dose be 1.5 μ g/ tails.4 weeks cycles of immunity, the counteracting toxic substances dosage counteracting toxic substances determined according to pre-counteracting toxic substances.Counteracting toxic substances after 2 ~ 3 days Brachydanio rerio there is ulcerative phenomena, and reached the peak mortality phase in 3 ~ 7 days.Record Brachydanio rerio death condition, until the recovery from illness of Brachydanio rerio ulcer in body surface, the travelling physical signs such as to ingest tends towards stability, and terminates record (generally wanting about 20 days), goes out the relative immunity protective rate of candidate antigens albumen according to formulae discovery.
By said process, large-scale wide sieve is carried out to candidate's protective antigen of Edwardsiella tarda virulent strain EIB202, has determined the relative immunity protective rate of multiple candidate antigens albumen, as table 1.
The RPS of table 1, Brachydanio rerio Immunization experimental identification Edwardsiella tarda candidate protective antigen albumen
Found that, FbaA candidate antigens albumen has higher immune protective efficiency in the zoopery taking Brachydanio rerio as model.
The preparation of embodiment 2, FbaA recombinant antigen protein
1, the structure of FbaA recombinant antigen protein gene
The extracting of vector plasmid pET28a is carried out according to the operating instruction of TIANprep Mini Plasmid Kit.Operating instruction according to TIANamp Bacteria DNA Kit carries out the genomic extraction of Edwardsiella tarda EIB202.Genome is used for PCR reaction, and the primer is the Auele Specific Primer fbaAF/fbaAR of design, obtains the object product that two ends contain BamH I and Xho I restriction enzyme digestion sites.Select restricted enzyme BamH I and Xho I to carry out double digestion, the genes of interest after enzyme action and carrier, through agarose gel electrophoresis, after the lower object band of cutting, utilize agarose gel DNA to reclaim test kit and reclaim DNA.
Obtain, with after the genes of interest of sticky end and plasmid, under the effect of DNA ligase, both being coupled together, form the recombiant plasmid containing genes of interest.Namely recombiant plasmid may be used for turning clone E. coli BL21 (DE3) Host Strains.Clone on flat board is defined as the positive through order-checking and digestion verification, is recombination bacillus coli BL21 (the DE3)/pET-28a-FbaA of Edwardsiella tarda FbaA albumen.
2, the expression and purification of FbaA recombinant antigen protein
The successful expression strain that will check order is inoculated, and grows into and to a certain degree adds derivant IPTG and carry out abduction delivering.Collect the centrifugal rear supercritical ultrasonics technology breaking cellular wall of bacterium liquid, collected after centrifugation supernatant.Protein electrophoresis detects the FbaA recombiant protein of abduction delivering, sees Fig. 2.Protein electrophoresis result shows, FbaA recombiant protein has great expression.
A His labelling has respectively been with at FbaA recombiant protein two ends, can be combined with Ni specifically.Therefore exclusively protein of interest can be carried out with Ni post.The albumen obtained by eluting, loading molecular cut off is in the bag filter of 14kD, dialyses in PBS solution ,-70 DEG C of preservations.
Embodiment 3, take Brachydanio rerio as the drug administration by injection Immunoprotection test of experimental animal
Determination of protein concentration
Nucleic acid quantification instrument NanoDrop ND-1000spectrophotometer is utilized to detect its OD
280, determine the concentration of recombiant protein, with PBS buffer, albumen be diluted to predetermined concentration.
The inoculation of Brachydanio rerio
Purification FbaA recombiant protein mixes according to the ratio of 3:7 with adjuvant ISA763A, and final protein concentration reaches 0.3 μ g/ μ l, and final immunizing dose is 1.5 μ g/ tails.Brachydanio rerio random packet cultivates, and 30/group, every bar Brachydanio rerio carries out tail muscles injecting immune.Then normally raise, observe activity and the death condition of fish.Immunization time is one month.Negative control is PBS and adjuvant mixing group.
Before injection operation, first Brachydanio rerio is soaked in 100ng/ml MS-222 and anaesthetizes.After terminating experimental period, residue Brachydanio rerio is carried out euthanasia, to be namely soaked in 300ng/ml MS-222 more than 10 minutes.
The counteracting toxic substances injection of Brachydanio rerio
Collect Edwardsiella tarda E.tarda EIB202, Vibrio anguillarum V.anguillarum MVM425, Aeromonas hydrophila A.hydrophila LSA34, Vibro harveyi V.harveyi VIB647, vibrio alginolyticus V.alginolyticus EPGS020401 thalline, with sterile physiological seawer washing three times, the cell density after resuspended with spectrophotometric determination, quantitative OD
600be 1, and with PBS, bacterium liquid be diluted to desired concn gradient; Every bar test Brachydanio rerio carries out tail muscles injecting immune according to the dosage of 5 μ l/ tails; Observed and recorded respectively organizes the situation of Brachydanio rerio morbidity and death.
The mensuration of recombiant protein immune protective efficiency
After cultivating 4 weeks after Brachydanio rerio immunity, according to wild strain median lethal dose(LD 50) LD50 value, suitable dosage is selected to carry out challenge viral dosage to the Brachydanio rerio of immunity; Observed and recorded respectively organizes Brachydanio rerio morbidity and death condition.
By (1) formulae discovery relative protection ratio (Relative percent survival, RPS):
RPS=(mortality rate/% of 1-% immunity fish contrasts the mortality rate of fish) × 100% (1).
Death condition after Brachydanio rerio counteracting toxic substances in 7 days is shown in Fig. 3.After Brachydanio rerio counteracting toxic substances, matched group is mainly mortality in first 3 days, and with rotten tail, abdominal part swelling and the travelling symptom such as slow.Then there is not mortality phenomenon in immune group, and has pathological changes to postpone phenomenon.Wherein the mortality rate of blank group is 75%, and the mortality rate of immune group is 28.6%.Calculating is learnt, FbaA albumen is 61.9% for the relative protection ratio of Edwardsiella tarda E.tardaEIB202.
Brachydanio rerio cross-immunity experiments situation is shown in Fig. 6, except the protection for Aeromonas hydrophila A.hydrophilaLSA34 is slightly low, for the protection of other several fish bacterial pathogenses all between 50-70%.
Be coated with respective plate after sick fish tissues is suitably processed dilution, 30 DEG C of incubated overnight, through colony identification and the order-checking of 16S primer, illustrate that Brachydanio rerio is nosogenetic and infected corresponding pathogenic bacterium really.
Embodiment 4, take turbot as the drug administration by injection Immunoprotection test of experimental animal
The immunity of turbot
Turbot random packet cultivates, and 30/group, every bar carries out tail muscles injection according to the dosage of 100 μ l/ tails.After purifying protein dialysed overnight, according to its concentration, be mixed to protein concentration with adjuvant ISA763A according to the ratio of 7:3 and reach 0.3 μ g/ μ l.PBS and adjuvant ISA763A immune group are negative control.Then normally raise, observe fish activity and with or without death.Immunization time is 10 weeks.
Before injection operation, first turbot is soaked in 100ng/ml MS-222 and anaesthetizes.After terminating experimental period, residue turbot is carried out euthanasia, to be namely soaked in 300ng/ml MS-222 more than 10 minutes.
The counteracting toxic substances of turbot
The counteracting toxic substances of turbot is identical in Brachydanio rerio counteracting toxic substances method, and turbot, after immunity, the 4th week, according to wild strain LD50 value, selects suitable dosage to carry out grouping challenge viral dosage to the turbot of immunity.
Antigen protein is immune protective efficiency analysis in turbot body
Death condition after turbot counteracting toxic substances in 21 days is shown in Fig. 4.Experimental result shows, after turbot counteracting toxic substances the 13 day starts there is death condition, and have obvious disease symptom: the gill cover edge of sick fish, film fin base portion and the subcutaneous hyperemia of the outside of belly, rubescent, and hemorrhage place's focus generation pus infections subsequently, forms subcutaneous abscess.Within 21st day, death condition tends towards stability.Wherein the mortality rate of blank group is 73%, and the mortality rate of immune group is 23.3%.Calculating is learnt, the relative protection ratio of FbaA albumen is 68.1%.
The experimental result that comparison Brachydanio rerio and turbot immunity FbaA albumen obtain; the candidate antigens albumen FbaA that on primary animal model Brachydanio rerio, primary dcreening operation obtains is described; secondary animal model turbot also there is good immanoprotection action; this lays good basis for the experiment of follow-up further sieve again on the one hand, also demonstrate that Brachydanio rerio can become the new animal model of screening protective antigen.Meanwhile, for subunit vaccine exploitation, the preferred target spot that FbaA also will design as follow up vaccine.
Embodiment 5, FbaA antigen protein immune level are analyzed
Turbot blood sampling and sero-fast preparation
After turbot immunity FbaA recombiant protein, at the 4th week from experiment fish tail venous blood sampling, every tail takes out about 0.3ml blood.Whole blood room temperature leave standstill after centrifugal, collect upper serum, be stored in-80 DEG C for subsequent use.
Serum antibody is for FbaA albumen and above-mentioned five kinds of pathogenic bacterium specificity analyses
The specific antibody level that the immunity of experiment fish turbot produces afterwards measures conventional indirect ELISA method and detects:
By the recombiant protein FbaA and five after purification kind of pathogenic bacterium wrapper sheet incubated overnight.Wash plate 3 times, pat dry; Add confining liquid solution, in 22 DEG C of closed 2h.Wash plate 3 times, pat dry; Add the fish immune serum of dilution 10 times, 100 μ l/ holes, do same treatment in contrast by blank serum.3h is hatched in 22 DEG C.Wash plate 5 times, pat dry; Add the monoclonal antibody of Chinese People's Anti-Japanese Military and Political College brill IgM, hatch 1h in 22 DEG C.Wash plate 5 times, pat dry; Add sheep anti mouse monoclonal antibody (HRP labelling), hatch 1h in 22 DEG C.Wash plate 5 times, pat dry; Add soluble type tmb substrate washing liquid, room temperature lucifuge places 10min; Add reaction terminating liquid, be placed in microplate reader with OD
450wavelength detecting.
Utilize conventional indirect ELISA method to detect the specificity of turbot immunity FbaA recombiant protein generation antibody, the results are shown in Figure 5.Result shows, sero-fast light absorption value is greater than blank serum.Create the specific antibody for FbaA and various pathogens after turbot immunity FbaA recombiant protein, also show FbaA albumen has prospect as broad spectrum type candidate vaccine.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the purposes of tarda fructose 1,6-diphosphate aldolase, is characterized in that, for the preparation of the vaccine of protection Fish from pathogenic infection.
2. purposes as claimed in claim 1, it is characterized in that, the aminoacid sequence of described tarda fructose 1,6-diphosphate aldolase is as shown in SEQ ID NO:1.
3. purposes as claimed in claim 1, it is characterized in that, described pathogenic bacterium comprise: Edwardsiella tarda (E.tarda), Vibrio anguillarum (V.anguillarum), Aeromonas hydrophila (A.hydrophila), Vibro harveyi (V.harveyi), vibrio alginolyticus (V.alginolyticus).
4. protect Fish from a vaccine for pathogenic infection, it is characterized in that, described vaccine comprises: the immunological adjuvant of tarda fructose 1,6-diphosphate aldolase and effective dose.
5. vaccine as claimed in claim 4, it is characterized in that, described tarda fructose 1,6-diphosphate aldolase and the ratio of immunological adjuvant are 1:(1-5); Preferably ratio is 1:(1.5-4); More preferably ratio is 1:(2-3); More preferably 1:(2-2.5 further).
6. vaccine as claimed in claim 4, it is characterized in that, described immunological adjuvant is MONTANIDE
tMiSA763A.
7. the method for the vaccine of preparation described in claim 5 or 6, it is characterized in that, described method comprises: mixed by the immunological adjuvant of tarda fructose 1,6-diphosphate aldolase and effective dose, the vaccine described in acquisition.
8. method as claimed in claim 7, it is characterized in that, described tarda fructose 1,6-diphosphate aldolase and the ratio of immunological adjuvant are 1:(1-5); Preferably ratio is 1:(1.5-4); More preferably ratio is 1:(2-3); More preferably 1:(2-2.5 further).
9. method as claimed in claim 7, it is characterized in that, described immunological adjuvant is MONTANIDE
tMiSA763A.
10. protect Fish from a test kit for pathogenic infection, it is characterized in that, in described test kit, comprise the arbitrary described vaccine of claim 4-6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410200936.9A CN104208665B (en) | 2014-05-13 | 2014-05-13 | A kind of Edwardsiella tarda subunit vaccine and its preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410200936.9A CN104208665B (en) | 2014-05-13 | 2014-05-13 | A kind of Edwardsiella tarda subunit vaccine and its preparation method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104208665A true CN104208665A (en) | 2014-12-17 |
| CN104208665B CN104208665B (en) | 2016-06-29 |
Family
ID=52090837
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410200936.9A Expired - Fee Related CN104208665B (en) | 2014-05-13 | 2014-05-13 | A kind of Edwardsiella tarda subunit vaccine and its preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104208665B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108285904A (en) * | 2018-02-09 | 2018-07-17 | 河北科技师范学院 | A kind of Wdwardsiella tarda flagellin FlgJ with immanoprotection action |
-
2014
- 2014-05-13 CN CN201410200936.9A patent/CN104208665B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| CUIQING MA等: "Similar Ability of FbaA with M Protein to Elicit Protective Immunity Against Group A Streptococcus Challenge in Mice", 《CELLULAR & MOLECULAR IMMUNOLOGY》, vol. 6, no. 1, 28 February 2009 (2009-02-28) * |
| E. LING等: "Glycolytic enzymes associated with the cell surface of Streptococcus pneumoniae are antigenic in humans and elicit protective immune responses in the mouse", 《CLIN EXP IMMUNOL》, vol. 138, 31 December 2004 (2004-12-31) * |
| NELE DE KLERK等: "Fructose-bisphosphate aldolase and pyruvate kinase, two novel immunogens in Madurella mycetomatis", 《MEDICAL MYCOLOGY》, vol. 50, 28 February 2012 (2012-02-28) * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108285904A (en) * | 2018-02-09 | 2018-07-17 | 河北科技师范学院 | A kind of Wdwardsiella tarda flagellin FlgJ with immanoprotection action |
| CN108285904B (en) * | 2018-02-09 | 2021-07-06 | 河北科技师范学院 | Edwardsiella tarda flagellin FlgJ with immune protection effect |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104208665B (en) | 2016-06-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ina‐Salwany et al. | Vibriosis in fish: a review on disease development and prevention | |
| Kibenge et al. | Countermeasures against viral diseases of farmed fish | |
| CN104884084B (en) | Fish subunit's soaking vaccine | |
| CN104513827B (en) | A kind of Porcine epidemic diarrhea virus strain, its attenuated vaccine strain and application | |
| CN103255089B (en) | The strong malicious slow Edwardsiella vaccine strain of one strain and application thereof | |
| LiHua et al. | Evaluation of an outer membrane protein as a vaccine against Edwardsiella anguillarum in Japanese eels (Anguilla japonica) | |
| CA2873305C (en) | Fish vaccine | |
| CN101880647B (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| CN108823218A (en) | Chicken infectivity bursa of Fabricius virus VP 2 gene, its expression product, its subunit vaccine and application | |
| CN104560851A (en) | Aeromonas salmonicida live vaccine preparation as well as preparation method and application of lyophilized vaccine product | |
| CN105112349B (en) | A kind of brucella melitensis molecular marker vaccine strain and its application | |
| CN101629149B (en) | Marker-free gene-deletion attenuated mutant strain derived from Edwardsiella tarda wild strain, related preparation and application thereof | |
| CN103554254A (en) | Chicken egg yolk antibody resisting human A rotavirus as well as preparation method and application thereof | |
| CN102206257B (en) | Edwardsiella tarda immunogenic protective antigen, and related expression vector, vaccine and application | |
| CN101157907B (en) | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof | |
| Ispir et al. | Effect of immersion booster vaccination with Yersinia ruckeri extracellular products (ECP) on rainbow trout Oncorhynchus mykiss | |
| CN104059134B (en) | Septic Pasteurella toxin recombinant protein and its application | |
| CN103014051B (en) | Multiple-potency live vaccine for fish and application thereof | |
| CN104208665B (en) | A kind of Edwardsiella tarda subunit vaccine and its preparation method and application | |
| CN101974472B (en) | Marker-free gene deletion attenuated mutant strain of Edwardsiella tarda wild strain as well as relevant preparations and application thereof | |
| CN103275890A (en) | Vibrio anguillarum (listonella anguillarum) virulent strain and application thereof | |
| Hu et al. | Construction and evaluation of a live vaccine against Edwardsiella tarda and Vibrio harveyi: laboratory vs. mock field trial | |
| CN103127498A (en) | Recombination antigen composition, vaccine and carrier and method for preparing antigen composition | |
| CN105316252A (en) | Five-gene-deleted streptococcus suis serotype 2 strain and application | |
| CN102676421B (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160629 Termination date: 20200513 |