CN104195260B - A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof - Google Patents
A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof Download PDFInfo
- Publication number
- CN104195260B CN104195260B CN201410485406.3A CN201410485406A CN104195260B CN 104195260 B CN104195260 B CN 104195260B CN 201410485406 A CN201410485406 A CN 201410485406A CN 104195260 B CN104195260 B CN 104195260B
- Authority
- CN
- China
- Prior art keywords
- primer
- transgenic corn
- mir604
- corn lines
- competition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The present invention passes through to design the Auele Specific Primer for the tape label of Transgenic corn lines MIR604 and competitive primer dexterously, and application pcr amplification and test strip associated detection technique, achieve the efficient rapid detection of MIR604.The method high specificity, highly sensitive and good stability, convenient to use, the cost-saving and time, principle and simple to operate, does not need specific apparatus, is applicable to inspection and quarantine department and uses and promote.
Description
Technical field
The present invention relates to Transgenic corn lines detection field, provide a kind of method and the test kit thereof that utilize pcr amplification and nucleic acid test strip associated detection technique rapid detection Transgenic corn lines MIR604, be applicable to the detection of Check and Examination of Port quarantine mechanism's application to Transgenic corn lines MIR604.
Background technology
Along with the fast development of transgenic technology, genetically modified crops kind gets more and more, cultivated area is cumulative year after year also, the crop species that transgenosis relates to is various, comprise soybean, corn, wheat, cotton, tomato, potato etc., and each transgenic strain has unique genome on position and border sequence, current China takes examination and approval system to import transgenic corns product, corn strain is without permission prohibited from entering China, and setting up transgenic product ore grade indexes method has actual demand.
Due to the special inspecting equipment that gel imaging detects, real-time fluorescence PCR detection method all needs price high of regular-PCR method, expensive plant and instrument cost limits the popularization of PCR detection method.
This research of the present invention is by designing Auele Specific Primer for the tape label of Transgenic corn lines MIR604 and competitive primer dexterously, application pcr amplification and nucleic acid test strip associated detection technique, achieve the efficient rapid detection of Transgenic corn lines MIR604.The method high specificity, highly sensitive and good stability, has important effect for accuracy, the shortening improving MIR604 strain detection time.This detection method is convenient and swift, the cost-saving and time, principle and simple to operate, does not need specific apparatus, is applicable to inspection and quarantine department and uses and promote, also have important reference simultaneously to the rapid detection of other corn strains.
Summary of the invention
The technical issues that need to address of the present invention are to provide Auele Specific Primer for detecting MIR604 and competitive primer.
The present invention needs another problem solved to be to provide the PCR detection kit comprising above-mentioned primer.
The present invention for detecting the PCR primer sequence of MIR604 is:
Upstream primer 604-F-bio:5 ' biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '.
MIR604 detection kit of the present invention, comprises following composition:
(1) MIR604DNA template and negative control intend MIR604DNA template
(2) MIR604 upstream and downstream primer and competition primer
Upstream primer 604-F-bio:5 ' biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '.
(3) 10 × ExTaqPCRBuffer, DDH
2o, 2.5mMdNTP, 5U/ μ lExTaq enzyme
Carry out pcr amplification with aforesaid method to testing sample DNA, PCR primer ELISA test strip, if control line is normal, detection line presents the positive, then illustrate that this sample contains MIR604, if present feminine gender, then illustrates in this sample not containing MIR604.
Compared with prior art, progress of the present invention is: use instrument simple, without the need to agarose gel electrophoresis, ultraviolet gel imaging, thus avoid the pollution of ethidium bromide, and save time, high specificity, highly sensitive, good stability, reduces the input in laboratory, and applicable laboratories is promoted the use of.
Accompanying drawing explanation
Fig. 1 is Transgenic corn lines MIR604 test strip specific detection result, 1 is MON810,2 is MON863,3 is TC1507,4 is ES3272,5 is MIR604 for GA21,6 is 59122,7,8 is BT11,9 is BT176,10 is NK603,11 is non-transgenic corn genomic dna, 12 for DDH
2o, uses this test kit can detect Transgenic corn lines MIR604 exactly as can be seen from Figure 1.
Embodiment
MIR604 design of primers:
1
TCCGCAATGTGTTATTAAGAGTTGGTGGTACGGGTACTTTAACTAACGAGGTGTGTCGCG
61CAGCGCTCCTGCACGGATGTAGCTTTGGATTGCTGGATAATGTCTCGCGCAAGCGTCGTA
121TTTATTTATTTATTTATTACAGCCTCCACCGCCGTGCG
TGCTCCGTTTCGGATTATAATA
According to the insertion point distinguished sequence of Transgenic corn lines MIR604, primer-design software is utilized to design two groups of primers (underline position), upstream primer 5 ' marks vitamin H (biotin), downstream primer 5 ' mark fluorescent element (fitc), and upstream primer competition primer.
Upstream primer 604-F-bio:5 ' biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '.
This experiment test 10 kinds of Transgenic corn lines and a kind of non-transgenic corn, see the following form:
| Numbering | For examination corn kind |
| 1 | MON810 |
| 2 | MON863 |
| 3 | TC1507 |
| 4 | ES3272 |
| 5 | GA21 |
| 6 | 59122 |
| 7 | MIR604 |
| 8 | BT11 |
| 9 | BT176 |
| 10 | NK603 |
| 11 | Non-transgenic corn |
the detection of embodiment 1, Transgenic corn lines MIR604
dNA extraction: adopt QiagenDNeasyplantminikit test kit, extract corn gene group DNA by step and be dissolved in 100uLTE ,-20 DEG C save backup.
pcr amplification: respectively with MON810, MON863, TC1507, ES3272, GA21,59122, BT11, BT176, NK603, non-transgenic corn genomic dna for negative control, MIR604 genomic dna as positive control, ddH
2o is blank, carries out pcr amplification.
PCR reaction system:
10×ExTaqBuffer2.5μl
dNTP（2.5mmol/L）1μl
Upstream primer (10 μm of ol/L) 0.5 μ l
Downstream primer (10 μm of ol/L) 0.5 μ l
Competition primer (10 μm of ol/L) 4 μ l
Template DNA 1 μ l
ExTaq enzyme (5U/ μ L) 0.25 μ l
ddH
2O15.25μl
Cumulative volume: 25 μ l
PCR reaction conditions: 94 DEG C of denaturation 1min, 94 DEG C of sex change 30s, 57 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min.
eLISA test strip: get 4 μ L amplified productions respectively and be added in the sample pad of test strip, then drip 2-3 and drip damping fluid, interpretation after 5min also records result, result is as Fig. 1,1 is MON810,2 is MON863,3 is TC1507,4 is ES3272,5 is MIR604 for GA21,6 is 59122,7,8 is BT11,9 is BT176,10 is NK603,11 is non-transgenic corn genomic dna, 12 for DDH
2o.
Result shows, the control line of Fig. 1 is all normal, No. 7 MIR604 are only had to occur specificity red stripes at detection line, all the other Transgenic corn lines, non-transgenic corn and blank all occur without band, only when the detection line display specific band of MIR604 test strip, show to detect in thing containing Transgenic corn lines MIR604 composition.
Sequence table
SEQUENCELISTING
<110> Animal-Plant and food Detecting Center, Tianjin Exit-Entery Inspection & Quarant
The Transgenic corn lines MIR604 detection kit that <120> mono-kind is new and detection method thereof
<141>2014－08－20
<160>3
<210>1
<211>22
<212>DNA
<213> artificial sequence
<400>1
tccgcaatgtgttattaagagt22
<210>2
<211>22
<212>DNA
<213> artificial sequence
<400>2
tattataatccgaaacggagca22
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
ggccttaataacacattgcgga22
Sequence table
SEQUENCELISTING
<110> Animal-Plant and food Detecting Center, Tianjin Exit-Entery Inspection & Quarant
The Transgenic corn lines MIR604 detection kit that <120> mono-kind is new and detection method thereof
<160>3
<210>1
<211>22
<212>DNA
<213> artificial sequence
<400>1
tccgcaatgtgttattaagagt22
<210>2
<211>22
<212>DNA
<213> artificial sequence
<400>2
tattataatccgaaacggagca22
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
ggccttaataacacattgcgga22
Claims (3)
1., for Auele Specific Primer and the competitive primer of Transgenic corn lines MIR604 detection, it is characterized in that, sequence is:
Upstream primer 604-F-bio:5 ' Biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' Fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '.
2. one kind is characterized in that for the test kit detecting Transgenic corn lines MIR604, comprises following composition:
(1) positive control Transgenic corn lines MIR604DNA template and negative control non-transgenic corn DNA profiling
(2) MIR604 upstream and downstream primer and competition primer
Upstream primer 604-F-bio:5 ' Biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' Fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '
(3) 10 × ExTaqPCRBuffer, ddH
2o, 2.5mMdNTP, 5U/ μ LExTaq enzyme
(4) the membrane chromatographic test strip of vitamin H (Biotin), fluorescein (Fitc) antigenic mark.
3. a method for quick of Transgenic corn lines MIR604, comprises the steps:
(1) PCR reaction system:
10×ExTaqBuffer2.5μl
2.5mMdNTP1μl
10 μMs of upstream primer 604-F-bio0.5 μ l
10 μMs of downstream primer 604-B-fit0.5 μ l
10 μMs of competition primer 604-F-comp4 μ l
Template DNA 1 μ l
5U/ μ LExTaq enzyme 0.25 μ l
ddH
2O15.25μl
Cumulative volume: 25 μ l
The primer sequence related in PCR reaction system is as follows:
Upstream primer 604-F-bio:5 ' Biotin-TCCGCAATGTGTTATTAAGAGT-3 '
Downstream primer 604-B-fit:5 ' Fitc-TATTATAATCCGAAACGGAGCA-3 '
Competition primer 604-F-comp:5 '-GGCCTTAATAACACATTGCGGA-3 '
(2) PCR reaction conditions: 94 DEG C of denaturation 1min, 94 DEG C of sex change 30s, 57 DEG C of annealing 30s, 72 DEG C extend 30s, 30 circulations, and 72 DEG C extend 5min
(3) result of determination: PCR primer ELISA test strip, if control line is normal, detection line presents the positive, then illustrate that this sample contains Transgenic corn lines MIR604, if present feminine gender, then illustrates in this sample not containing Transgenic corn lines MIR604.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410485406.3A CN104195260B (en) | 2014-09-22 | 2014-09-22 | A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410485406.3A CN104195260B (en) | 2014-09-22 | 2014-09-22 | A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195260A CN104195260A (en) | 2014-12-10 |
| CN104195260B true CN104195260B (en) | 2015-12-30 |
Family
ID=52080622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410485406.3A Expired - Fee Related CN104195260B (en) | 2014-09-22 | 2014-09-22 | A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195260B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952861A (en) * | 2011-08-26 | 2013-03-06 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize |
| CN103205425A (en) * | 2012-01-17 | 2013-07-17 | 北京万达因生物医学技术有限责任公司 | Antisense interference oligonucleotide used for inhibiting primer non-specific amplification |
-
2014
- 2014-09-22 CN CN201410485406.3A patent/CN104195260B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102952861A (en) * | 2011-08-26 | 2013-03-06 | 深圳出入境检验检疫局动植物检验检疫技术中心 | Multiplex PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize |
| CN103205425A (en) * | 2012-01-17 | 2013-07-17 | 北京万达因生物医学技术有限责任公司 | Antisense interference oligonucleotide used for inhibiting primer non-specific amplification |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195260A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102206632A (en) | Para-gene for exogenous insertion vector of transgenic maize transformation event MON88017 and application thereof | |
| CN105132589B (en) | A kind of the PCR-RFLP primers and method of difference 1 type of duck hepatitis virus and new serotype | |
| CN102586442A (en) | Specific primer and probe for assaying genetically modified corn MIR162 and application thereof | |
| CN104480207A (en) | Primer pair capable of detecting specificity of human mitochondrial genome | |
| CN102051416B (en) | LAMP (loop-mediated isothermal amplification) primer group for detecting transgenic corn strain MIR604 at normal temperature | |
| CN102888398B (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
| CN102559921A (en) | Specific primer and fluorescently-labeled probe for detecting transgenosis corn MIR162 and application thereof | |
| CN105177172A (en) | Transgenic maize T4-1-1 strain specific detection method and reagent kit | |
| CN104031982A (en) | Real-time fluorogenic quantitative PCR detection primers, detection method and kit for transgenic rice Kefeng No. 2 line specificity | |
| CN103966208A (en) | Transgenic rice PA110-15 foreign insert flanking sequence and application | |
| CN104195260B (en) | A kind of new Transgenic corn lines MIR604 detection kit and detection method thereof | |
| CN103834646B (en) | Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit | |
| CN103740812B (en) | A kind of genomic method of qualification Avena species A, C | |
| CN103451185B (en) | Propylaea Japonica specific COI primers, kit containing primer and detection method thereof | |
| CN103497992B (en) | Novel detection kit for transgenic aspergillus oryzae and detection method thereof | |
| CN104561364B (en) | A kind of method of rapid detection saccharum SPSB gene pleiomorphism and application | |
| CN102586242A (en) | Transgenic soybean BPS-CV127-9 transformation event exogenous insertion carrier flanking gene and application thereof | |
| CN103834737B (en) | Transgenic rice Kefeng No.2 line specific PCR detection primer as well as qualitative detection method and kit | |
| CN104388579A (en) | Arm-PCR detection method of transgenic soybeans and derived varieties thereof | |
| CN104561365A (en) | Method for rapidly detecting polymorphism of sugarcane sucrose phosphate synthase B (SPSB) gene and application of method | |
| CN103451184A (en) | Schizaphis graminum specific SS-COI primers, kit comprising primers and detection method of schizaphis graminum | |
| CN103397087A (en) | Probe for transgenic component MLPA detection and primer for preparation of long probe thereof | |
| CN102952860B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT11 | |
| CN102952864B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain BT176 | |
| CN102952862B (en) | PCR-DHPLC (polymerase chain reaction-denaturing high performance liquid chromatography) detection primer and detection method for genetically modified maize strain MON89034 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhang Yujun Inventor after: Guo Jingze Inventor after: Zhao Jingyuan Inventor after: Liu Peng Inventor after: He Yan Inventor before: Zhang Yujun Inventor before: Guo Jingze Inventor before: Zhao Jinyuan Inventor before: Liu Peng Inventor before: He Yan |
|
| COR | Change of bibliographic data | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20151230 Termination date: 20160922 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |