CN103834646B - Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit - Google Patents
Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit Download PDFInfo
- Publication number
- CN103834646B CN103834646B CN201410081539.4A CN201410081539A CN103834646B CN 103834646 B CN103834646 B CN 103834646B CN 201410081539 A CN201410081539 A CN 201410081539A CN 103834646 B CN103834646 B CN 103834646B
- Authority
- CN
- China
- Prior art keywords
- seqidno
- pcr
- sample
- strain
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 84
- 235000009566 rice Nutrition 0.000 title claims abstract description 84
- 238000000034 method Methods 0.000 title claims abstract description 36
- 238000012360 testing method Methods 0.000 title claims abstract description 7
- 230000009261 transgenic effect Effects 0.000 title abstract description 30
- 240000007594 Oryza sativa Species 0.000 title 1
- 241000209094 Oryza Species 0.000 claims abstract description 83
- 239000004472 Lysine Substances 0.000 claims abstract description 39
- 230000031787 nutrient reservoir activity Effects 0.000 claims abstract description 39
- 238000001514 detection method Methods 0.000 claims abstract description 34
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 19
- 238000003780 insertion Methods 0.000 claims abstract description 9
- 230000037431 insertion Effects 0.000 claims abstract description 9
- 238000005304 joining Methods 0.000 claims abstract description 9
- 239000002773 nucleotide Substances 0.000 claims description 45
- 125000003729 nucleotide group Chemical group 0.000 claims description 45
- 238000011144 upstream manufacturing Methods 0.000 claims description 11
- 238000012408 PCR amplification Methods 0.000 claims description 10
- TWRXJAOTZQYOKJ-UHFFFAOYSA-L Magnesium chloride Chemical compound [Mg+2].[Cl-].[Cl-] TWRXJAOTZQYOKJ-UHFFFAOYSA-L 0.000 claims description 8
- 238000013461 design Methods 0.000 claims description 8
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Chemical compound O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 7
- 239000000284 extract Substances 0.000 claims description 6
- 238000002156 mixing Methods 0.000 claims description 6
- 108090000790 Enzymes Proteins 0.000 claims description 4
- 102000004190 Enzymes Human genes 0.000 claims description 4
- 238000013016 damping Methods 0.000 claims description 4
- 239000012153 distilled water Substances 0.000 claims description 4
- 239000012530 fluid Substances 0.000 claims description 4
- 229910001629 magnesium chloride Inorganic materials 0.000 claims description 4
- 230000004087 circulation Effects 0.000 claims description 2
- 230000001186 cumulative effect Effects 0.000 claims description 2
- 238000007859 qualitative PCR Methods 0.000 abstract description 10
- 238000002474 experimental method Methods 0.000 abstract description 4
- 238000012795 verification Methods 0.000 abstract description 2
- 230000003321 amplification Effects 0.000 description 21
- 238000003199 nucleic acid amplification method Methods 0.000 description 21
- 239000012634 fragment Substances 0.000 description 14
- 241000196324 Embryophyta Species 0.000 description 10
- 239000000243 solution Substances 0.000 description 10
- 239000000463 material Substances 0.000 description 8
- 239000013642 negative control Substances 0.000 description 8
- 238000000137 annealing Methods 0.000 description 7
- 238000004519 manufacturing process Methods 0.000 description 7
- 238000012163 sequencing technique Methods 0.000 description 7
- 238000011895 specific detection Methods 0.000 description 6
- 108700019146 Transgenes Proteins 0.000 description 5
- 240000008042 Zea mays Species 0.000 description 5
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 5
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 5
- 238000004458 analytical method Methods 0.000 description 5
- 235000005822 corn Nutrition 0.000 description 5
- 239000006228 supernatant Substances 0.000 description 5
- 239000000203 mixture Substances 0.000 description 4
- 229920000742 Cotton Polymers 0.000 description 3
- 244000068988 Glycine max Species 0.000 description 3
- 235000010469 Glycine max Nutrition 0.000 description 3
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 description 3
- 238000007596 consolidation process Methods 0.000 description 3
- 101150000411 lrp gene Proteins 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 238000012216 screening Methods 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- 208000003643 Callosities Diseases 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 2
- 206010020649 Hyperkeratosis Diseases 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- BKHZIBWEHPHYAI-UHFFFAOYSA-N chloroform;3-methylbutan-1-ol Chemical compound ClC(Cl)Cl.CC(C)CCO BKHZIBWEHPHYAI-UHFFFAOYSA-N 0.000 description 2
- 238000010586 diagram Methods 0.000 description 2
- 239000000539 dimer Substances 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000011536 extraction buffer Substances 0.000 description 2
- 238000005457 optimization Methods 0.000 description 2
- 238000012546 transfer Methods 0.000 description 2
- 239000005418 vegetable material Substances 0.000 description 2
- ISWSIDIOOBJBQZ-UHFFFAOYSA-N Phenol Chemical compound OC1=CC=CC=C1 ISWSIDIOOBJBQZ-UHFFFAOYSA-N 0.000 description 1
- BDKZHNJTLHOSDW-UHFFFAOYSA-N [Na].CC(O)=O Chemical compound [Na].CC(O)=O BDKZHNJTLHOSDW-UHFFFAOYSA-N 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000004090 dissolution Methods 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 244000037671 genetically modified crops Species 0.000 description 1
- 235000013617 genetically modified food Nutrition 0.000 description 1
- 238000013412 genome amplification Methods 0.000 description 1
- 229960000789 guanidine hydrochloride Drugs 0.000 description 1
- YQOKLYTXVFAUCW-UHFFFAOYSA-N guanidine;isothiocyanic acid Chemical compound N=C=S.NC(N)=N YQOKLYTXVFAUCW-UHFFFAOYSA-N 0.000 description 1
- PJJJBBJSCAKJQF-UHFFFAOYSA-N guanidinium chloride Chemical compound [Cl-].NC(N)=[NH2+] PJJJBBJSCAKJQF-UHFFFAOYSA-N 0.000 description 1
- 238000002372 labelling Methods 0.000 description 1
- 230000007246 mechanism Effects 0.000 description 1
- 108091040857 miR-604 stem-loop Proteins 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 238000010298 pulverizing process Methods 0.000 description 1
- 230000001954 sterilising effect Effects 0.000 description 1
- 239000000725 suspension Substances 0.000 description 1
- 238000010200 validation analysis Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses transgenic paddy rice PA110-15 strain specificity PCR qualitative detection primer and qualitative checking method and test kit.The present invention provide firstly the joining region sequence turning insertion vector gene and flank rice sequences in high-lysine storage protein trans-genetic hybrid rice PA110-15 strain, does is its base sequence SEQ? ID? shown in No.2.Invention further provides the PCR turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity and detect primer and qualitative checking method.Specificity verification experiment shows, what the present invention set up turns the specificity that high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative PCR detection method has height.
Description
Technical field
The specific PCR that the present invention relates to transgenic rice lines detects primer and detection kit, particularly relate to and turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity PCR qualitative detection primer, qualitative checking method and detection kit, belong to transgenic rice lines detection field.
Background technology
Along with the extensive plantation of transgenic plant, the safety issue of genetically modified food also causes people to pay close attention to greatly, and existing more than 30 country implements transgenic product mark system in succession, comprises China.The enforcement of transgenic labeling system depends on the composition detection to transgenic plant and converted products thereof.Round pcr detects most widely used method in transgenic product both at home and abroad at present.When applying this technology and carrying out genetically modified crops qualitative detection, according to its specificity, be divided into selective mechanisms method, gene specific method, built specificity method and strain specificity method.Event-specific detection is that the joining region sequence by detecting insertion vector and Plant Genome realizes, due to each Transgenic Plant Lines, all there is the joining region sequence of special exogenous insertion vector and Plant Genome, compare with first three methods, strain specificity has higher specificity and accuracy, the most applicablely does GMO detection.
At present, partial monopoly and the bibliographical information event-specific detection method of transgenic plant is had.Such as: magnify the people such as soldier established transgenosis MON863 corn event-specific detection method in 2006; The people such as Xie Jiajian establish a series of event-specific detection method such as transgenic paddy rice Kemingdao, Bt Shanyou 63, section rich No. 6 and rich No. 8 of section etc.; The people such as Lu Changming established the event-specific detection method of a series of transgene rape in 2007.But, so far, not yet find any about turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity PCR detection method.
Summary of the invention
An object of the present invention is to provide the PCR qualitative detection primer turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity;
Two of object of the present invention sets up to turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity PCR qualitative checking method;
Three of object of the present invention is to provide and turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity PCR qualitative detection test kit.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
The present invention is that LRP gene (SEQIDNo.1) obtains external source insertion gene 5 ' end paddy rice flanking sequence and 3 ' end paddy rice flanking sequence by Hi-TAILPCR according to turning the goal gene inserted in high-lysine storage protein trans-genetic hybrid rice PA110-15 strain, and the exogenous insertion vector containing LRP gene obtained and both sides 5 ' thereof are held and the joining region nucleotides sequence of 3 ' side wing rice sequences is classified as shown in SEQIDNo.2.
The present invention is further according to the joining region sequences Design 9 pairs of specificity of transformant qualitative detection primers inserting genophore and 3 ' end flanking sequence, and these 9 pairs of transformant primers are respectively: nucleotides sequence is classified as the primer pair 1 shown in SEQIDNo.3 and SEQIDNo.4; Nucleotides sequence is classified as the primer pair 2 shown in SEQIDNo.5 and SEQIDNo.6; Nucleotides sequence is classified as primer pair 3 shown in SEQIDNo.7 and SEQIDNo.8; Nucleotides sequence is classified as the primer pair 4 shown in SEQIDNo.9 and SEQIDNo.10; Nucleotides sequence is classified as the primer pair 5 shown in SEQIDNo.11 and SEQIDNo.12; Nucleotides sequence is classified as the primer pair 6 shown in SEQIDNo.13 and SEQIDNo.14; Nucleotides sequence is classified as the primer pair 7 shown in SEQIDNo.15 and SEQIDNo.16; Nucleotides sequence is classified as the primer pair 8 shown in SEQIDNo.17 and SEQIDNo.18; Nucleotides sequence is classified as the primer pair 9 shown in SEQIDNo.19 and SEQIDNo.20.The present invention applies conventional PCR reaction conditions, adopts 9 pairs of transformant primers to carry out pcr amplification respectively, arranges 2 repetitions; From amplification, these 9 pairs of transformant primers all can amplify expection fragment from turning high-lysine storage protein trans-genetic hybrid rice PA110-15 positive material sample specifically, but with primer pair 8(SEQIDNo.17 and SEQIDNo.18) shown in the band (159bp) of primer amplification the most clear, amplification efficiency is higher, and primer dimer is less.
Two of object of the present invention is to provide one and turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity PCR detection method, and the method comprises: (1) extracts the DNA of paddy rice sample to be detected; (2) with the DNA extracted for template, design Auele Specific Primer pair with Nucleotide shown in SEQIDNo.2 for target gene, set up PCR amplification system go forward side by side performing PCR amplification; (3) if amplify the specific band of expection from sample to be detected, then paddy rice sample to be detected turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain; If fail to amplify the specific band of expection from sample to be detected, then paddy rice sample to be detected is not turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain.
Wherein, described Auele Specific Primer is to any pair that is selected from following 9 pairs of primers: nucleotides sequence is classified as the primer pair 1 shown in SEQIDNo.3 and SEQIDNo.4; Nucleotides sequence is classified as the primer pair 2 shown in SEQIDNo.5 and SEQIDNo.6; Nucleotides sequence is classified as primer pair 3 shown in SEQIDNo.7 and SEQIDNo.8; Nucleotides sequence is classified as the primer pair 4 shown in SEQIDNo.9 and SEQIDNo.10; Nucleotides sequence is classified as the primer pair 5 shown in SEQIDNo.11 and SEQIDNo.12; Nucleotides sequence is classified as the primer pair 6 shown in SEQIDNo.13 and SEQIDNo.14; Nucleotides sequence is classified as the primer pair 7 shown in SEQIDNo.15 and SEQIDNo.16; Nucleotides sequence is classified as the primer pair 8 shown in SEQIDNo.17 and SEQIDNo.18; Nucleotides sequence is classified as the primer pair 9 shown in SEQIDNo.19 and SEQIDNo.20.
Invention further provides a kind of PCR qualitative checking method turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, comprising: (1) extracts the DNA of paddy rice sample to be detected; (2) with the DNA extracted for template, with the primer pair shown in SEQIDNo.17 and SEQIDNo.18 set up PCR reaction system go forward side by side performing PCR amplification; (3) if amplify the object band of 159bp from sample to be detected, then paddy rice sample to be detected turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain; If fail to amplify the object band of 159bp from sample to be detected, then paddy rice sample to be detected is not turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain
Wherein, the described method extracting DNA from paddy rice sample to be detected can be the various common methods extracting DNA from vegetable material, such as, can be the various methods such as CTAB method, guanidine isothiocyanate method or guanidine hydrochloride method.
In PCR reaction system, the final concentration of primer and annealing temperature all have a certain impact for the specificity sensitivity of detected result; The present invention has investigated the impact for the specificity detected and sensitivity of the final concentration of primer in PCR reaction system and annealing temperature, experimental result find primer final concentration be 0.2 μM, annealing temperature be 58 DEG C time, the specificity of detected result is the strongest, and sensitivity is the highest.
PCR amplification system described in the present invention can be set up with reference to following methods: the cumulative volume of reaction system is 25.0 μ L, wherein, 10 × PCR damping fluid 2.5 μ L, 25mmol/L magnesium chloride solution 1.5 μ L, dNTPs mixing solutions (each 2.5mmol/L) 2 μ L, 0.2 μm of ol/L upstream primer 0.5 μ L, 0.2 μm of ol/L downstream primer 0.5 μ L, 0.025U/ μ LTaq enzyme 1.5 μ L, 25mg/LDNA template 2.0 μ L, surplus is distilled water.
Described pcr amplification condition optimization is: 94 DEG C of sex change 5min; 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 72 DEG C extend 30s, carry out 35 circulations altogether; 72 DEG C extend 2min.
Further aim of the present invention is to provide a kind of PCR qualitative detection test kit turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, comprise: 10 × PCR damping fluid, magnesium chloride solution, dNTPs mixing solutions, PCR qualitative detection primer pair, Taq enzyme and distilled water; Wherein, described PCR qualitative detection primer pair is selected from any pair in following 9 pairs of primers: nucleotides sequence is classified as the primer pair 1 shown in SEQIDNo.3 and SEQIDNo.4; Nucleotides sequence is classified as the primer pair 2 shown in SEQIDNo.5 and SEQIDNo.6; Nucleotides sequence is classified as primer pair 3 shown in SEQIDNo.7 and SEQIDNo.8; Nucleotides sequence is classified as the primer pair 4 shown in SEQIDNo.9 and SEQIDNo.10; Nucleotides sequence is classified as the primer pair 5 shown in SEQIDNo.11 and SEQIDNo.12; Nucleotides sequence is classified as the primer pair 6 shown in SEQIDNo.13 and SEQIDNo.14; Nucleotides sequence is classified as the primer pair 7 shown in SEQIDNo.15 and SEQIDNo.16; Nucleotides sequence is classified as the primer pair 8 shown in SEQIDNo.17 and SEQIDNo.18; Nucleotides sequence is classified as the primer pair 9 shown in SEQIDNo.19 and SEQIDNo.20.
Be preferably nucleotides sequence and be classified as the primer pair 8 shown in SEQIDNo.17 and SEQIDNo.18.
The strain specificity PCR qualitative checking method adopting the present invention to set up has carried out qualitative detection to rich No. 6 of transgenic paddy rice section, rich No. 8 of section, Kemingdao, M12, TT51 and other transgenic plant and non-transgenic plant material, qualitative PCR amplification shows, only turning in high-lysine storage protein trans-genetic hybrid rice PA110-15 positive material genome amplification and obtain the band of object clip size, in other transgenic paddy rice and the genome such as other transgenic plant and conventional rice bright extensive 63, amplification is not had to obtain expection object fragment; Experimental result shows, what the present invention set up turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative PCR detection method high specificity.
Accompanying drawing explanation
Fig. 1 goal gene upstream and downstream Hi-TAILPCR second takes turns and third round amplified production; M:1kpplusDNAmarker; 1,2 be respectively: goal gene downstream Hi-TAILPCR second takes turns and third round amplified production; 3,4 be respectively: goal gene upstream Hi-TAILPCR second takes turns and third round amplified production.
Fig. 2 sequencing result is analyzed.
The primer long segment amplification that Fig. 3 primer and isolated Gt1 gene order design; M:1kpplusDNAmarker; 1: blank; 2: negative control; 3:PA110-15 sample.
The sequencing result analysis of Fig. 4 long segment amplified production.
Fig. 5 Gt1 upstream region of gene Hi-TAILPCR second takes turns and third round amplification; M:1kpplusDNAmarker; 1,2 be respectively: Gt1 upstream region of gene Hi-TAILPCR second takes turns and third round amplified production.
Fig. 6 sequencing result and splice result with the first step.
The schematic diagram of Fig. 7 thick consolidation structure and flanking sequence.
Figure 83 ' holds flanking sequence 9 pairs of specificity of transformant primer screening results; Draw M:100bpmarker; 1: blank; 2,3: negative control; 4,5:PA110-15 sample.
Fig. 9 primer concentration is the amplification of 0.1 μM/L; M:100bpMarker; 1: negative control; 2: positive a:54 DEG C; B:56 DEG C; C:58 DEG C; D:60 DEG C; E:62 DEG C.
Figure 10 primer concentration is the amplification of 0.2 μM/L; M:100bpMarker; 1: negative control; 2: positive a:54 DEG C; B:56 DEG C; C:58 DEG C; D:60 DEG C; E:62 DEG C.
Figure 11 primer concentration is the amplification of 0.4 μM/L; M:100bpMarker; 1: negative control; 2: positive a:54 DEG C; B:56 DEG C; C:58 DEG C; D:60 DEG C; E:62 DEG C.
Figure 12 primer concentration is the amplification of 0.8 μM/L; M:100bpMarker; 1: negative control; 2: positive a:54 DEG C; B:56 DEG C; C:58 DEG C; D:60 DEG C; E:62 DEG C.
Figure 13 specificity verification result; M:100bpmarker; 1: blank; 2: negative control; 3:PA110-15 sample; 4-13: be respectively sample 1, sample 2, sample 3, sample 4, sample 5, sample 6, sample 7, sample 8, sample 9, sample 10.
Embodiment 1 turn of high-lysine storage protein trans-genetic hybrid rice PA110-15 external source inserts the acquisition of the flanking sequence of gene
Turning high-lysine storage protein trans-genetic hybrid rice PA110-15 external source insertion goal gene is LRP gene, and its base sequence is for shown in SEQIDNo.1.
Integrated structure (external source insertion gene flanking sequence) is obtained by Hi-TAILPCR
The first step: design upstream and downstream nested primers on goal gene LRP
LRP-Sp-1TGGTCCTGGAACCATCAAGAAGATC
LRP-Sp-2ACGATGGACTCCAGTCCGGCCTGCTGGACCTTCTGGAGGCTCTGTT
LRP-Sp-3CCAAGGGTGATGCTCTCTTCAAGGC
LRP-Ap1CAGCCTTGAAGAGAGCATCACCCTT
LRP-Ap2ACGATGGACTCCAGTCCGGCCTGAGTTTCCCAACAGAGCCTCCAGAAGLRP-Ap3GCAAAGCAGCACCACCAACTATGCT
For the purpose of Fig. 1, gene upstream and downstream Hi-TAILPCR second takes turns and third round amplified production.Fig. 2 is shown in sequencing result analysis.
Second step: by two kinds of methods
1. on GenBank, obtain 5 ' coupled Rice Genome Sequence according to 3 ' the end Rice Genome Sequence obtained, then design the primer that primer and isolated Gt1 gene order design and carry out long segment amplification.
RICE-5’-F:TCAGTGCATCTGCTGTGGCTGGTAG
Gt1-R：TGCTGTCATCTTAGCTTTTCCATGCAAC
Amplification is shown in Fig. 3; Fig. 4 is shown in sequencing result analysis.
2. according to the Gt1 sequence that the first step obtains, design upstream Hi-TAILPCR nested primers
Gt1-Ap1TGGGTTGCCTACACCATGATTAACTT
Gt1-Ap2ACGATGGACTCCAGTCCGGCCCTAATTGTTTGAACTGCACGGCACCTT
Gt1-Ap3TGCTGTCATCTTAGCTTTTCCATGCAAC
Amplification is shown in Fig. 5; Sequencing result and splice with the first step and the results are shown in Figure 6.
3rd step: obtain the more Rice Genome Sequence of 5 ', 3 ' end with regular-PCR
Fig. 7 is shown in by the schematic diagram of thick consolidation structure and flanking sequence, and the nucleotides sequence of thick consolidation structure and flanking sequence is classified as shown in SEQIDNo.2.
The screening of experimental example 1 turn of high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative detection Auele Specific Primer and the optimization of amplification condition
One, the foundation of specificity of transformant detection method
9 pairs of specificity of transformant primers are designed according to 3 ' end flanking sequence.The joining region sequence of amplification exogenous insertion vector and rice genome, the size of amplified production is all not less than 100bp.
Arrange 9 pairs of primers altogether, primer sequence is respectively:
Primer 1: object fragment length is 276bp
F：TTCGCTCATGTGTTGAGCATAT(SEQIDNo.3)
R：GAGATTTGATTTGGCTGATCTAGG(SEQIDNo.4)
Primer 2: object fragment length is 314bp
F：TTCGCTCATGTGTTGAGCATAT(SEQIDNo.5)
R：GTTAAATGTCAACAGCCATCTGC(SEQIDNo.6)
Primer 3: object fragment length is 328bp
F：TTCGCTCATGTGTTGAGCATAT(SEQIDNo.7)
R：ATCGTTTGGTTCCTGTTAAATGTC(SEQIDNo.8)
Primer 4: object fragment length is 138bp
F：TTCAGTACATTAAAAACGTCCGC(SEQIDNo.9)
R：GAGATTTGATTTGGCTGATCTAGG(SEQIDNo.10)
Primer 5: object fragment length is 176bp
F：TTCAGTACATTAAAAACGTCCGC(SEQIDNo.11)
R：GTTAAATGTCAACAGCCATCTGC(SEQIDNo.12)
Primer 6: object fragment length is 190bp
F：TTCAGTACATTAAAAACGTCCGC(SEQIDNo.13)
R：ATCGTTTGGTTCCTGTTAAATGTC(SEQIDNo.14)
Primer 7: object fragment length is 121bp
F：GTCCGCAATGTGTTATTAAGTTGTC(SEQIDNo.15)
R：GAGATTTGATTTGGCTGATCTAGG(SEQIDNo.16)
Primer 8: object fragment length is 159bp
F：GTCCGCAATGTGTTATTAAGTTGTC(SEQIDNo.17)
R：GTTAAATGTCAACAGCCATCTGC(SEQIDNo.18)
Primer 9: object fragment length is 173bp
F：GTCCGCAATGTGTTATTAAGTTGTC(SEQIDNo.19)
R：ATCGTTTGGTTCCTGTTAAATGTC(SEQIDNo.20)
Primer screening the results are shown in Figure 8.From the selection result: all obtain expecting size strip positive material, and do not obtain in negative control, the exactness of 3 ' the end flanking sequence that preliminary identification obtains, the exactness of follow-up available LA-PCR method validation integrated structure also sets up specificity of transformant detection method.
From the amplification of Fig. 8, primer 8 amplification efficiency is higher, and primer dimer is less.Therefore, the present invention preferably adopts primer shown in SEQIDNo.17 and SEQIDNo.18 to detect primer as detection transgenic paddy rice PA110-15 strain specificity PCR.
2.PCR reaction system and condition optimizing
The final concentration of primer in adjusting and optimizing PCR reaction system, arrange 0.1 μM, 0.2 μM, 0.4 μM, 4 concentration gradients such as 0.8 μM of grade, and with 54 DEG C, 56 DEG C, 58 DEG C, 60 DEG C, 62 DEG C are carried out the amplification of PCR reaction for annealing temperature, result shows, the fragment of expection size can be amplified under set different primers concentration and different annealing temperature condition, but be 0.2 μM at primer final concentration, effect best (Fig. 9: primer concentration is 0.1 μM/L when annealing temperature is 58 DEG C, Figure 10: primer concentration is 0.2 μM/L, Figure 11: primer concentration is 0.4 μM/L, Figure 12: primer concentration is 0.8 μM/L).
The foundation of experimental example 2 turns of high-lysine storage protein trans-genetic hybrid rice PA110-15 event-specific detection systems and response procedures
One, the extraction of plant genome DNA and detection
1 DNA of plants is extracted
The preparation of 1.1CTAB Extraction buffer
Add 81.7gNaCl and 20gCTAB in 600mL water, after fully dissolving, add 1mol/LTris-HCl(pH7.5) solution 100mL, 0.5mol/LEDTA(pH8.0) solution 100mL, finally adjusts pH to 8.0 by HCl or NaOH solution, adds water and be settled to 1000mL.Use after sterilizing 20min under High Temperature High Pressure (103.4kPa/121 DEG C) condition.
1.2 extracting method
A.100mg sample, fully pulverizing lastly is transferred in 2ml centrifuge tube;
B.1ml be preheated to the CTAB Extraction buffer of 65 DEG C, fully mixing, suspension sample, and softly mix.
C.65 DEG C water-bath 40min, period puts upside down mixing for several times;
D.12000r/min centrifugal 15min.The new centrifuge tube of transfer supernatant to, adds equal-volume phenol, chloroform-isoamyl alcohol (24:1), fully mixes;
E.12000r/min centrifugal 10min.The new centrifuge tube of transfer supernatant to, adds equal-volume chloroform-isoamyl alcohol (24:1), fully mixes;
F.12000r/min centrifugal 10min, gets supernatant, adds 2/3 volume isopropanol, 1/10 volumes of acetic acid sodium.Place 2 hours or the longer time for-20 DEG C;
G.12000r/min centrifugal 10min;
H. abandon supernatant, add 500 μ L, 70% ethanolic soln, and put upside down centrifuge tube for several times.The centrifugal 10min of 12000r/min;
I. abandon supernatant, centrifuge tube is stood upside down in thieving paper and blot, and ethanol is fully volatilized, dry DNA.
G. 100 μ l water dissolution DNA are added;
K. be 100ng/ μ l with double distilled water by DNA solution Concentration Modulation, be stored in-20 DEG C for subsequent use.
2DNA detects
Get the DNA solution that 3ul extracts, with the agarose gel electrophoresis of 0.8%, judge the quality of DNA according to its brightness and banding pattern.Adopt ultraviolet spectrophotometer to measure put forward concentration and the purity of DNA.
Two, the foundation of high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative PCR detection system and response procedures is turned
Through optimizing, turn the system of high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative PCR detection in table 1.
Table 1PA110-15 rice strain specificity qualitative PCR detection system
Table 2PA110-15 rice strain specificity qualitative PCR response procedures
The specificity analyses of experimental example 3 turns of high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity qualitative PCR detection methods
One, experiment material
1, vegetable material
Sample 1: the lucky round-grained rice 88 of non-transgenic paddy rice, Japan is fine, raise rice No. 6, bright extensive 86, and balanced mix makes a sample;
Sample 2: the lucky list 180 of non-transgenic corn, lucky east 26, Shen Yu 21, Yu Qing 281, balanced mix makes a sample;
Sample 3: soybean is negative;
Sample 4: cotton is negative;
Sample 5: rape is negative;
Sample 6: rich No. 6 of transgenic paddy rice section, rich No. 8 of section, Kemingdao, M12, TT51, be mixed and made into a sample, content each 5%;
Sample 7: transgenic corns Bt11, Bt176, MON810, MON863, GA21, NK603, T25, TC1507, MON89034,59122, MIR604, MON88017, be mixed and made into 1 sample, content each 5%;
Sample 8: genetically engineered soybean 356043,305423, CV127, MON89788, A5547-127, A2704-12, GTS40-3-2, be mixed and made into 1 sample, content each 5%;
Sample 9: transgene cotton MON1445, MON531, MON15985, LLCOTTON25, MON88913, is mixed and made into 1 sample, content each 5%;
Sample 10: transgene rape MS1, MS8, RF1, RF2, RF3, T45, Oxy235, Topas19/2, is mixed and made into 1 sample, content each 5%;
Sample 11: transgenic paddy rice PA110-15.
Above experiment material provided by Ministry of Agriculture's development in science and technology center and the Chinese Academy of Agricultural Sciences's biology.
Two, experimental technique and result
With SEQIDNo.17 and SEQIDNo.18 for Auele Specific Primer pair, the PA110-15 strain rice strain specificity qualitative PCR detection method set up according to experimental example 2 carries out amplification to various material and shows, only in paddy rice PA110-15 strain genome, amplification obtains the band (159bp) of object clip size, in other transgenic paddy rice (rich No. 6 of section, rich No. 8 of section, Kemingdao, M12 and TT51), other transgenic plant material (genetically engineered soybean, transgenic corns, transgene cotton and transgene rape) and non-transgenic paddy rice, do not have in the genomes such as non-transgenic corn to increase and obtain the fragment (Figure 13) of object clip size.Consistent with object amplified fragments sequence by sequencing analysis show to increase in the PA110-15 rice genome sequence that obtains.The above results shows that the transgenic paddy rice PA110-15 strain specificity qualitative PCR detection method that the present invention sets up has specificity highly.
Claims (10)
1. turn the joining region Nucleotide of insertion vector gene and flank rice sequences in high-lysine storage protein trans-genetic hybrid rice PA110-15 strain, it is characterized in that: its nucleotides sequence is classified as shown in SEQIDNo.2.
2. joining region according to claim 1 Nucleotide detects the application turning high-lysine storage protein trans-genetic hybrid rice PA110-15 strain as target gene.
3. turn the PCR qualitative detection primer of high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, it is characterized in that, be selected from any pair in following 9 pairs of primers: nucleotides sequence is classified as the primer pair 1 shown in SEQIDNo.3 and SEQIDNo.4; Nucleotides sequence is classified as the primer pair 2 shown in SEQIDNo.5 and SEQIDNo.6; Nucleotides sequence is classified as primer pair 3 shown in SEQIDNo.7 and SEQIDNo.8; Nucleotides sequence is classified as the primer pair 4 shown in SEQIDNo.9 and SEQIDNo.10; Nucleotides sequence is classified as the primer pair 5 shown in SEQIDNo.11 and SEQIDNo.12; Nucleotides sequence is classified as the primer pair 6 shown in SEQIDNo.13 and SEQIDNo.14; Nucleotides sequence is classified as the primer pair 7 shown in SEQIDNo.15 and SEQIDNo.16; Nucleotides sequence is classified as the primer pair 8 shown in SEQIDNo.17 and SEQIDNo.18; Nucleotides sequence is classified as the primer pair 9 shown in SEQIDNo.19 and SEQIDNo.20.
4. turn a PCR qualitative checking method for high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, it is characterized in that, comprising: (1) extracts the DNA of paddy rice sample to be detected; (2) with the DNA extracted for template, design Auele Specific Primer pair with joining region according to claim 1 Nucleotide for target gene, set up PCR reaction system go forward side by side performing PCR amplification; (3) if amplify the object band of expection from sample to be detected, then paddy rice sample to be detected turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain; If fail to amplify the object band of expection from sample to be detected, then paddy rice sample to be detected is not turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain.
5. turn a PCR qualitative checking method for high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, it is characterized in that, comprising: (1) extracts the DNA of paddy rice sample to be detected; (2) with the DNA extracted for template, detect primer with PCR according to claim 3 and set up PCR reaction system and to go forward side by side performing PCR amplification; (3) if amplify the object band of expection from sample to be detected, then paddy rice sample to be detected turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain; If fail to amplify the object band of expection from sample to be detected, then paddy rice sample to be detected is not turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain.
6. turn a PCR qualitative checking method for high-lysine storage protein trans-genetic hybrid rice PA110-15 strain specificity, it is characterized in that, comprising: (1) extracts the DNA of paddy rice sample to be detected; (2) with the DNA extracted for template, with the primer pair shown in SEQIDNo.17 and SEQIDNo.18 set up PCR reaction system go forward side by side performing PCR amplification; (3) if amplify the object band of 159bp from sample to be detected, then paddy rice sample to be detected turns high-lysine storage protein trans-genetic hybrid rice PA110-15 strain; If fail to amplify the object band of 159bp from sample to be detected, then paddy rice sample to be detected is not turn high-lysine storage protein trans-genetic hybrid rice PA110-15 strain.
7. according to the PCR qualitative checking method of claim 4-6 described in any one, it is characterized in that, described PCR reaction system is: the cumulative volume of reaction system is 25.0 μ L, wherein, 10 × PCR damping fluid 2.5 μ L, 25mmol/L magnesium chloride solution 1.5 μ L, dNTPs mixing solutions 2 μ L, 0.2 μm of ol/L upstream primer 0.5 μ L, 0.2 μm of ol/L downstream primer 0.5 μ L, 0.025U/ μ LTaq enzyme 1.5 μ L, 25mg/LDNA template 2.0 μ L, surplus is distilled water.
8., according to the PCR qualitative checking method of claim 4-6 described in any one, it is characterized in that, described pcr amplification condition is: 94 DEG C, 5min; 94 DEG C, 30s, 58 DEG C, 30s, 72 DEG C, 30s, 35 circulations; 94 DEG C, 2min.
9. turn a strain specificity PCR qualitative detection test kit of high-lysine storage protein trans-genetic hybrid rice PA110-15, comprising: 10 × PCR damping fluid, magnesium chloride solution, dNTPs mixing solutions, detect upstream and downstream primer pair, Taq enzyme and distilled water; It is characterized in that: described detection upstream and downstream primer is that PCR according to claim 3 detects primer.
10. according to strain specificity PCR qualitative detection test kit according to claim 9, it is characterized in that: the nucleotides sequence that described PCR detects primer is classified as shown in SEQIDNo.17 and SEQIDNo.18.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410081539.4A CN103834646B (en) | 2014-03-06 | 2014-03-06 | Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410081539.4A CN103834646B (en) | 2014-03-06 | 2014-03-06 | Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834646A CN103834646A (en) | 2014-06-04 |
| CN103834646B true CN103834646B (en) | 2016-03-23 |
Family
ID=50798543
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410081539.4A Expired - Fee Related CN103834646B (en) | 2014-03-06 | 2014-03-06 | Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834646B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105132581A (en) * | 2015-10-20 | 2015-12-09 | 中国农业科学院生物技术研究所 | Genetically modified rice PA110-15 transformant specificity quantitative PCR detection primer |
| CN105132582A (en) * | 2015-10-20 | 2015-12-09 | 中国农业科学院生物技术研究所 | PCR detection primer in genetically modified rice PA110-15 foreign gene homozygous and heterozygous state |
| CN108251551A (en) * | 2017-12-21 | 2018-07-06 | 中国农业科学院生物技术研究所 | Using the joint inspection of RPA-DNA test strips to transgenic paddy rice PA110-15 event-specific detection methods |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102134603B (en) * | 2010-12-21 | 2013-02-13 | 中国检验检疫科学研究院 | Primer, probe, test kit and method for testing genetically modified rice or products thereof |
| KR101288403B1 (en) * | 2010-12-24 | 2013-07-23 | 대한민국 | Primers and probes for detecting insect resistance characteristic genetically modified organism and detecting method using the same |
| CN102888398B (en) * | 2011-07-22 | 2014-03-05 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof |
| CN103397081B (en) * | 2013-03-28 | 2014-12-10 | 湖北省农业科学院粮食作物研究所 | Primer for detecting exogenous gene in transgenic rice T1C-19, and detection method thereof |
| CN103320437B (en) * | 2013-07-10 | 2015-04-29 | 广东省农业科学院植物保护研究所 | Gene-specific molecular marker Pi2SNP of rice blast-resistant gene Pi2 as well as preparation method and application thereof |
| CN103397094B (en) * | 2013-08-02 | 2016-08-10 | 中国检验检疫科学研究院 | A kind of method detecting transgenic rice lines Bt63 and test kit |
-
2014
- 2014-03-06 CN CN201410081539.4A patent/CN103834646B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 农业转基因生物安全评价审查（2010年）;浙江农业执法网;《www.zjnyzf.gov.cn/uploadFiles/2011-01/1296181711202.doc》;20100315;第117页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834646A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5 ‘-transgene integration sequence | |
| CN103923999B (en) | The qualitative PCR detection method of transgenic pest-resistant herbicide-resistant paddy rice G6H1 and derived varieties thereof | |
| CN103966208B (en) | Transgenic paddy rice PA110-15 external source Insert Fragment flanking sequence and application | |
| CN103834646B (en) | Transgenic paddy rice PA110-15 strain specificity PCR detects primer and qualitative checking method and test kit | |
| CN102154454B (en) | Method for detecting transgenosis constituents in plant by GeXP multi-PCR (polymerase chain reaction) technology and application thereof | |
| CN107236733A (en) | The transformation event foreign insertion vector flanking sequences of genetically engineered soybean W82 HAL1 8062 and its application | |
| CN105177172A (en) | Transgenic maize T4-1-1 strain specific detection method and reagent kit | |
| CN110512018A (en) | PCR primer, kit and its application for the screening of wild cabbage self-compatibility material | |
| CN102888398B (en) | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof | |
| CN102051416B (en) | LAMP (loop-mediated isothermal amplification) primer group for detecting transgenic corn strain MIR604 at normal temperature | |
| Shin et al. | Event-specific detection system of stacked genetically modified maize by using the multiplex-PCR technique | |
| CN101956011B (en) | Detection method for rapidly identifying transgenic components in cotton and application thereof | |
| Yang et al. | Event-specific qualitative and quantitative polymerase chain reaction analysis for genetically modified canola T45 | |
| CN102304587A (en) | Method for rapidly identifying erect panicle of rice | |
| CN102559921A (en) | Specific primer and fluorescently-labeled probe for detecting transgenosis corn MIR162 and application thereof | |
| CN103146824A (en) | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice | |
| CN104031982A (en) | Real-time fluorogenic quantitative PCR detection primers, detection method and kit for transgenic rice Kefeng No. 2 line specificity | |
| Luo et al. | Development of EST-SSR and TRAP markers from transcriptome sequencing data of the mango | |
| CN103525810A (en) | Exogenous gene insertion site flanking sequence of phytase transgenic corn and detection method | |
| CN103834737B (en) | Transgenic rice Kefeng No.2 line specific PCR detection primer as well as qualitative detection method and kit | |
| CN103834645A (en) | Connecting region sequence of exogenous inserting gene and flanking rice sequence of transgenic rice kefeng No.2 and application thereof | |
| CN104031912A (en) | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof | |
| CN109055592A (en) | A kind of anti-ring spot virus papaya YK16-0-1 of transgenosis and its efficient qualitative, quantitative identification method of spin-off | |
| CN104404161A (en) | Transgenic maize multiple PCR screening detection primer and detection method | |
| CN102286624B (en) | Qualitative and quantitative PCR (polymerase chain reaction) detection method for strain specificity of transgenic carnation Moonlite |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160323 |